Cover image of the article: Detection of Non-Typhoidal Salmonella Gastroenteritis in a Tertiary Children’s Hospital in China

Image Credit:Jundishapur Journal of Microbiology

Detection of Non-Typhoidal Salmonella Gastroenteritis in a Tertiary Children’s Hospital in China

Authors

Jing Yang1, Ling Meng1, Xinyao Liu1, Lan Ma1, Wei Wang2,*
1Department of Laboratory, The Second Hospital of Lanzhou University, Lanzhou, China
2Department of Urology, The Second Hospital of Lanzhou University, Lanzhou, China
*Corresponding Author: Department of Urology, The Second Hospital of Lanzhou University, Lanzhou 730000, China. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 12, issue 7; e84400
Published online:Jul 23, 2019
Article type:Research Article
Received:Sep 18, 2018
Accepted:Jun 01, 2019
How to Cite:Yang J, Meng L, Liu X, Ma L, Wang W. Detection of Non-Typhoidal Salmonella Gastroenteritis in a Tertiary Children’s Hospital in China. Jundishapur J Microbiol. 2019;12(7):e84400. doi: https://doi.org/10.5812/jjm.84400

Abstract

Background:

Non-typhoidal Salmonella (NTS) especially the invasive NTS (iNTS) is associated with various gastrointestinal diseases with a significant increase in antibiotic resistance.

Objectives:

We determined the prevalence, antibiotic susceptibility of NTS and iNTS isolated from stool and blood samples of children aged 2 - 15 years, respectively.

Methods:

A total of 537 stool and 405 blood samples were collected from 613 children with symptomatic gastroenteritis between January 2016 and May 2018. Samples were subjected to microbiological analysis and antibiotic resistance was determined by the minimum inhibitory concentration (MIC) assay. β-lactamase genes were detected by polymerase chain reaction (PCR).

Results:

A total of a total of 213 (39.7%) and 165 (40.7%) stool and blood samples grew Salmonella sp, respectively. Of these; 54 (10.1%) and 38 (9.4%) were identified as NTS and iNTS, respectively. Nalidixic acid (54.3%) resistance was the most the predominant resistance followed by ciprofloxacin (47.8%), cefotaxime (41.3%) and gentamicin (39.1%) among our isolates. The rate of resistance among iNTS was comparable and there was no significant (P > 0.05) difference observed in the resistance pattern between NTS and iNTS isolates. Among the resistant isolates, blaCMY-2gene (32.6%) was the most commonly detected gene.

Conclusions:

Overall, Salmonella typhimurium was the predominant species identified and blaCMY-2was the predominant gene amplified by our isolates. The high prevalence and increased resistance especially among iNTS is a cause of concern and reiterates the need to test blood samples along with the stool samples for better management of gastroenteritis.

1. Background

Non-typhoidal Salmonella (NTS) is a major foodborne pathogen associated with various gastrointestinal diseases both in developing and developed countries (1). Its clinical manifestation ranges from a self-limiting gastroenteritis characterized by vomiting, abdominal pain, diarrhea to serious invasive diseases such as bacteremia, extra-intestinal infections and meningitis (2-4). The occurrence of typhoid fever is more prevalent in developing countries, while NTS infections occur worldwide (5).
The NTS include Salmonella enterica subspecies enterica serotype enteritidis, S. typhimurium, S. newport, S. heidelberg, S. javiana, S. saintpaul, S. montevideo, S. infantis, S. muenchen, S. bareilly, S. braenderup and S. thompson (6). Globally, an estimated 93757000 cases of gastroenteritis and 155000 deaths due to NTS occur each year (1). Infants and young children are more susceptible to NTS infection compared to other age groups, making them a high-risk population (7). About 5% of the NTS infection in high-income countries occurs due to extra-intestinal and invasive NTS (iNTS). The iNTS found in the bloodstream of children is emerging with new pathogenic characteristics (8). Except for immunocompromised patients, the NTS infection does not necessitate antibiotic treatment, while, the iNTS infection requires an antibiotic treatment (9, 10). Similar to other enteropathogens, NTS exhibits an alarming level of increased resistance to various antibiotics especially to those used in developing countries (11, 12).
Resistance to first-line antibiotics including trimethoprim/sulphamethoxazole, chloramphenicol and ampicillin is high among the NTS. Thus, the treatment regimen mainly depends on fluoroquinolones or third generation cephalosporin’s. However, the decreased susceptibility to fluoroquinolones and extended-spectrum beta-lactamases (ESBLs) hampered NTS treatment. According to the US National Antimicrobial Resistance Monitoring System, about 5% of all NTS isolates were reported to be resistant to ceftriaxone (13). The rise of ciprofloxacin resistance has also been reported in both the US (27%) and China (5.5%) (14, 15).
The spread of antibiotic resistance makes it difficult to treat infants and children due to limited availability of therapeutic options, raising serious public health concerns (11, 16, 17). Antibiotic resistance especially due to extended-spectrum cephalosporins has been considered to be a major problem in various geographical regions including North/Western, Asia, Africa, US and Europe (18). In the last decade, the CTXM enzymes (blaCTX-M) which hydrolyse cefotaxime and ceftriaxone and the AmpC β-lactamase (blaCMY gene) which mediates resistance to other b-lactams, chloramphenicol, sulphonamides streptomycin, and tetracycline has gained much importance (18). In Europe and the USA, blaSHV, blaOXA, blaTEM, and blaCTX-Mare the frequently observed ESBLs among NTS (19). The spread of antibiotic resistance and the disease burden caused by NTS especially in children is on the rise worldwide, however, reports from China regarding the antibiotic resistance of NTS is scarce.

2. Objectives

The aim of this study was to determine the prevalence, antibiotic susceptibility of NTS and iNTS isolated from stool and blood samples of children aged 2 - 15 years, respectively.

3. Methods

A total of 537 stool samples and 405 blood samples were collected from 613 children with symptomatic gastroenteritis attending The Second Hospital of Lanzhou University, Lanzhou, China between January 2016 and May 2018. Children who had received prior antibiotic therapy within the last two weeks were excluded from the study. An informed consent from each child’s legal heir was obtained. Stool samples were collected using a sterile container, blood samples were collected in blood culture bottles (BD BACTECTM, USA). The collected stool and blood samples were immediately transported to the laboratory.

3.1. Isolation and Identification of Non-typhoidal Salmonella

The collected stool samples were cultured on MacConkey agar (Sigma-Aldrich, USA) and xylose lysine deoxycholate agar (Sigma-Aldrich, USA) and incubated at 37°C for 18 - 24 hours. Non-lactose fermenting colonies from MacConkey and pink colonies with a black center from xylose lysine deoxycholate agar plates showing typical colony morphology were isolated. Blood culture was done using an automated blood culture system (BD BACTECTM 9240, USA). The isolates were then identified through API® Rapid ID 32 E (bioMerieux, USA). The isolates were stored in brain heart infusion broth (Sigma-Aldrich, USA) supplemented with sterile glycerol (20%, v/v) at -80°C until used.

3.2. Minimum Inhibitory Concentration Assay

The minimum inhibitory concentration (MIC) for various antibiotics such as gentamicin, amikacin, ampicillin, cefotaxime, amoxicillin, ciprofloxacin, chloramphenicol, co-trimoxazole and nalidixic acid (Sigma-Aldrich, USA) against NTS was determined. The inoculum was prepared by adjusting the turbidity of the overnight culture grown on nutrient agar to that of 0.5 McFarland’s standard. The MIC assay (micro broth dilution method) was performed at a concentration of each antibiotic ranging from 0.03 to 128 µg/mL; using Muller-Hinton broth (MHB, Sigma-Aldrich, USA) as described in Clinical Laboratory Standard Institute (CLSI) guidelines (20). Briefly, 10 µL of culture was inoculated into MHB containing various concentrations and incubated at 37°C for 24 hours. After incubation, MIC was determined visually by the highest concentration showing the absence of growth.

3.3. DNA Extraction

DNA was extracted from the isolated cultures by the alkali lysis method (21). Briefly, a single colony of NTS was suspended in 100 µL of 50 mM NaOH and incubated at 95°C for 1 minute then immediately cooled to 4°C, neutralized with 16 µL of 1 M Tris-HCl (pH 8.0). Then the suspension was subjected to centrifugation for 2 minutes at 14000 rpm, the supernatant was collected and stored at -20°C until further use.

3.4. Resistance Gene Detection

A multiplex PCR to detect extended-spectrum β-lactamases (ESBL)-MBL resistant genes such as blaTEM, blaCTX-M-15, blaOXA, blaSHV and blaCMY-2was performed (22). Briefly, a 50 μL PCR reaction mix was prepared using a 2X ready PCR mix (Thermo Fisher Scientific, USA), 5 μL of template DNA and 5 pmoL of each primer as described in Table 1. PCR was performed using the thermocycler (Applied Biosystems, Verti Thermal Cycler, Thermo Fisher Scientific, USA), the PCR cycling conditions included: an initial denaturation at 94°C for 3 minutes followed by 30 cycles at 94°C for 30 seconds, appropriate primer annealing temperature for 30 seconds, extension at 72°C for 1 minute and final extension at 72°C for 7 minutes. After PCR, amplicons were resolved in 1.2% agarose gel electrophoresis.
Table 1.
Primer Sequence for the Detection of Resistance Genes
GenePrimer Sequence (5’ - 3’)Annealing Temperature (°C)Amplicon Size (bp)
blaCMY-2F: AACACGGTGCAAATCAAACA58332
R: CCGATCCTAGCTCAAACAGC
blaCTX-M-15F: CCAGAATCAGCGGCGCACGA64587
R: GCGCTTTGCGATGTGCAGCA
blaSHVF: AAGATCCACTATCGCCAGCAGG59319
R: ATTCAGTTCCGTTTCCCAGCGG
blaOXAF: ATGAAAAACACAATACATATCAACTTCGC55820
R: GTGTGTTTAGAATGGTGATCGCATT
blaTEMF: ATGAGTATTCAACATTTCCG55859
R: ACCAATGCTTAATCAGTGAG

3.5. Statistics

Continuous/categorical variables were represented as mean/ranges and numbers/percentages, respectively. Student t-test and ANOVA were performed using MINITAB (MINITAB, Version 13) statistical software. A P value of < 0.05 was considered as statistically significant.

4. Results

4.1. Patients and Isolates

Of the 613 patients, 374 (61%) were male and 239 (39%) were female. The mean age was 7.2 ± 0.5 years (range 1.2 - 13 years) (Table 2). Of the 537 stool samples and 405 blood samples, a total of 213 (39.7%) and 165 (40.7%) Salmonella sp. were isolated, respectively which was significantly higher than other bacterial species (P = 0.03). The majority of the isolates (172 vs. 134) were isolated from children within the age group of 1 - 5 years. Of the tested stool and blood samples, 54 (10.1%) and 38 (9.4%) isolates were identified as non-typhoidal Salmonella, respectively. The NTS isolated from stool samples were designated as NTS isolates and those which were isolated from blood samples were designated as iNTS isolates. Salmonella typhimurium was the predominant species identified in both NTS (38.9%) and iNTS (47.4%) groups, followed by S. enteritidis (29.6%) in the NTS and S. enterica in the iNTS (26.3%) groups (Table 3).
Table 2.
Baseline Patient Characteristics
DescriptionNo. of Patientsa
Male374 (61)
Female239 (39)
Mean age, y7.2 ± 0.5 (1.2 - 13)
Acute gastroenteritis216 (35.2)
Chronic diarrhea112 (18.3)
Watery diarrhea73 (11.9)
Vomiting214 (34.9)
Anemia268 (43.7)
Fever256 (41.7)
aValues are expressed as mean ± SD (range) or No. (%).
Table 3.
Distribution of Non-Typhoidal Salmonella Speciesa
SpeciesAll NTS (N = 92)NTS group (N = 54)iNTS group (N = 38)
Salmonella typhimurium39 (42.4)21 (38.9)18 (47.4)
S. enteritidis23 (25)16 (29.6)7 (18.4)
S. enterica20 (21.7)10 (22.2)10 (26.3)
S. infantis8 (8.7)5 (9.3)3 (7.9)
S. dublin2 (2.2)2 (3.7)0
aValues are expressed as No. (%).

4.2. Detection of Antibiotic Resistance

Of the overall 92 (NTS, 54; iNTS, 38) isolates tested for antibiotic susceptibility by MIC, the majority of the isolates were resistant to nalidixic acid (50, 54.3%) followed by ciprofloxacin (44, 47.8%), cefotaxime (38, 41.3%), gentamicin (36, 39.1%), amoxicillin (32, 34.8%), ampicillin (28, 30.4%), co-trimoxazole (28, 30.4%), amikacin (24, 26.1%) and chloramphenicol (17, 18.5%) (Table 4).
Of the 54 NTS isolates, the majority of the isolates were resistant to nalidixic acid 35 (64.8%) followed by ciprofloxacin (25, 46.3%), cefotaxime (21, 38.9%), gentamicin (20, 37%), amoxicillin (19, 35.2%), co-trimoxazole (18, 33.3%), ampicillin (16, 29.6%), amikacin (15, 27.8%) and chloramphenicol (9, 16.7%) (Table 4). We found that antibiotic resistance by NTS towards nalidixic acid was significantly higher than other tested antibiotics (ANOVA, F = 0.23; P < 0.05).
Of the 38 iNTS isolates, the majority of the isolates were resistant to ciprofloxacin (19, 50%) followed by cefotaxime (17, 44.7%), gentamicin (16, 42.1%), nalidixic acid (15, 39.5%), amoxicillin (13, 34.2%), ampicillin (12, 31.6%), co-trimoxazole (10, 26.3%), amikacin (9, 23.7%) and chloramphenicol (8, 21.1%) (Table 4). There was no significant difference in the presence of antibiotic resistance among the isolates (ANOVA, F = 0.01; P > 0.05). In comparison, the majority of the NTS and iNTS isolates were found to be resistant to nalidixic acid (64.8%) and ciprofloxacin (44.7%), respectively.
Table 4.
Distribution of Antibiotic Resistance Among Non-Typhoidal Salmonella Isolates
AntibioticsAll (N = 92)aNon-Typhoidal Salmonella (N = 54)Invasive Non-Typhoidal Salmonella (N = 38)
Resistant IsolatesaMIC50 (µg/mL)MIC90 (µg/mL)MIC GM (µg/mL)Range (µg/ml)Resistant IsolatesaMIC50 (µg/mL)MIC90 (µg/mL)MIC GM (µg/mL)Range (µg/mL)
Gentamicin36 (39.1)20 (37)86422.630.5 - 6416 (42.1)832160.5 - 64
Amikacin24 (26.1)15 (27.8)1612842.250.5 - 128≤9 (23.7)1612842.252 - 128≤
Ampicillin 28 (30.4)16 (29.6)43211.310.25 - 6412 (31.6)464161 - 64
Amoxicillin32 (34.8)19 (35.2)86422.630.5 - 12813 (34.2)832160.5 - 32
Cefotaxime38 (41.3)21 (38.9)26411.310.5 - 6417 (44.7)2840.06 - 8
Ciprofroxacin44 (47.8)25 (46.3)485.651 - 1619 (50)43211.310.25 - 32
Chloromphenicol17 (18.5)9 (16.7)23280.5 - 648 (21.1)23280.5 - 128
Co-trimoxazole28 (30.4)18 (33.3)412822.632 - 128≤10 (26.3)4≥ 128bNA0.06 - 128≤
Nalidixic acid50 (54.3)35 (64.8)326445.258 - 6415 (39.5)64≥ 128bNA0.12 - 128≤
Abbreviations: GM, geometric mean; NA, not applicable.
aValues are expressed as No. (%).
bCould not calculate GM as the exact value is not available.

4.3. Detection of β-Lactamase Genes

Of the β-lactamase genes tested in NTS and iNTS isolates, blaCMY-2was the predominant gene (33.3% vs. 31.6%) amplified by both the groups. The blaCTX-M-15and blaTEM were the next predominant genes amplified by NTS (20.4%) and iNTS (26.3%) isolates, respectively. There was no significant difference in the presence of resistant genes between the two groups (t-test, P > 0.05) (Table 5). Among these, blaCMY-2-blaCTX-M-15 was the common gene combination (7.4%) found in the NTS isolates while, blaCMY-2-blaCTX-M-15, blaCMY-2-blaOXA and blaTem-blaOXA were the predominant gene combination (5.3%) found in the iNTS isolates (Table 6).
Table 5.
Distribution of β-Lactamase Genes Among Non-Typhoidal Salmonella Isolatesa
GenesAll (N = 92)NTS (N = 54)iNTS (N = 38)
blaCMY-230 (32.6)18 (33.3)12 (31.6)
blaCTX-M-1517 (18.5)11 (20.4)6 (15.8)
blaSHV14 (15.2)9 (16.7)5 (13.2)
blaOXA13 (14.1)6 (11.1)7 (18.4)
blaTEM13 (14.1)3 (5.6)10 (26.3)
aValues are expressed as No. (%).
Table 6.
β-Lactamase Genes Combination Among Non-Typhoidal Salmonella Isolatesa
GenesAll (N = 92)NTS (N = 54)iNTS (N = 38)
blaCMY-220 (21.7)12 (22.2)8 (21.1)
blaCTX-M-153 (3.3)1 (1.9)2 (5.3)
blaSHV8 (8.7)4 (7.4)4 (10.5)
blaOXA4 (4.3)2 (3.7)2 (5.3)
blaTEM9 (9.9)1 (1.9)8 (21.1)
blaCMY-2, blaCTX-M-156 (6.5)4 (7.4)2 (5.3)
blaCMY-2, blaOXA3 (3.3)1 (1.9)2 (5.3)
blaCTX-M-15, blaSHV3 (3.3)2 (3.7)1 (2.6)
blaOXA, blaCTX-M-152 (2.2)1 (1.9)1 (2.6)
blaTem, blaOXA4 (4.3)2 (3.7)2 (5.3)
blaOXA, blaSHV, blaCTX-M-152 (2.2)2 (3.7)0
blaCMY-2, blaCTX-M-15, blaSHV1 (1.1)1 (1.9)0
aValues are expressed as No. (%).

5. Discussion

Non-typhoidal Salmonella is associated with self-limiting gastroenteritis to serious invasive diseases (2-4). In developing countries, diarrheal illness is one of the major causes of morbidity and mortality in children (23). Salmonellosis is considered to be one of the most common infections associated with diarrheal illness posing a serious and significant public health problem especially in children (24). In our study, 18.3% of the children had chronic diarrhea and 11.9% had watery diarrhea. In our study, Salmonella sp. were isolated from 39.7% and 40.7% of the stool and blood samples, respectively. A study from Venezuela which included pediatric patients with acute gastroenteritis reported 15.2% of Salmonella sp. from stool samples which is lower than that reported in our study (25).
The incidence of NTS varies globally. In sub-Saharan Africa, which has a high prevalence of HIV and malarial infections, NTS was the common etiological agent for bacteremia (26). Africa suffers a high burden of NTS infection compared to Asia where the incidence was relatively low. In our study, the prevalence of NTS was 10.1% and iNTS was 9.4%. A study from Northwest China reported NTS prevalence at a rate of 3.75% from the diarrheal patients and 0.31% from the non-diarrheal patients, which was much lower than that reported in our study (27). In contrast, studies from the US (42%) and Shangai (17.2%) reported NTS as the leading cause of bacterial enteric illness, which was much higher than that reported in our study (15, 28). Similarly, a study from the West Indies reported a higher rate of NTS (21.1%) compared to our results (29).
A study from Bangladesh reported iNTS at a rate of 0.2%, which is much lower (9.4%) than that reported in our study, however, the study reported that of the 20 patients who had iNTS infection 5 patients died. The study also mentioned that clinical sepsis, severe acute malnutrition and pneumonia were independent risk factors for NTS bacteremia (30). Kariuki et al. reported that a larger proportion of the iNTS were isolated from children below 3 years which corroborates with our result where 52.9% of our iNTS isolates were from children less than 5 years old (16). Thus, the varying prevalence of NTS infection across various regions suggests that a region-specific approach is required to monitor the prevalence of NTS infections.
In our study, S. typhimurium was the predominant subtype identified in both NTS (38.9%) and iNTS (47.4%) groups. Similar to our results, studies from Kenya (59%) (16) and Iraq (54.5%) (23), reported that S. typhimurium was the predominant subtype of the NTS isolated, however with slightly higher rates. In our study, S. enteritidis (29.6%) was the second common subtype identified among the NTS isolated from stool samples. A study from Southwest China reported S. enteritidis as the most predominant subtype identified, however with a much lower rate (1.87%) than that reported in our study (27). Another study from Venezuela reported that S. enteritidis (48.7%) as the predominant serovar followed by S. typhimurium (37.8%) which is contrary to our result where S. typhimurium was the most common subtype followed by S. enteritidis (25). A study from India reported that S. enterica serovar senftenberg as the predominant isolate followed by S. enterica serovar typhimurium and S. enterica serovar enteritidis (22). Another study from West Africa reported S. enterica serovar enteritidis (80.6%), followed by S. enterica serovar typhimurium (8%) (31).
Although the predominance of NTS subtypes varies from one geographical region to other, S. typhimurium, S. enteritidis and S. enterica were the three major NTS subtypes commonly isolated from gastroenteritis patients. The SalmSurv, a WHO-supported foodborne disease surveillance network study reported that S. typhimurium and S. enteritidis cause approximately 80% of all the human cases, which corroborates with our results; where S. typhimurium and S. enteritidis were the major sub types identified in our study (32). An alarming increase in the antibiotic resistance by NTS was reported elsewhere (11, 12). In our study, 54.3% of our isolates were found to be resistant to nalidixic acid, which is lower than that reported from India (77%) (22), Southwest China (66.7%) (27), and higher than that reported from Congo (4.3%) (33), Iraq (45.5%) (23), Ethiopia (23.9%) (34), and Iran (31.5%) (17). Among the NTS isolated from stool samples, Nalidixic acid was predominant among our NTS, (64.8%) which was very much higher than that reported from Kenya (6%) (16). In contrast to our results, other studies from South India (8), and West Africa (31), reported that none of their NTS isolates were resistant to nalidixic acid.
In our study ciprofloxacin resistance (47.8%) was the second most common resistance reported, which was higher than that reported from Ethiopia (4.5%) (34), Congo (4.3%) (33), India (23.5%) (22), and lower than that reported from South India (97%) (8). Other studies from West Africa (31) and Malaysia (35) reported 100% susceptibility to ciprofloxacin. We reported that 41.3% of our isolates were resistant to cefotaxime, which was higher than that reported from India (32.5%) (22), Congo (2.1%) (33), Southwest China (11.9%) (27), and comparable to that reported from Iraq (42.4%) (23). Gentamicin resistance was reported to be 39.1% among our isolates, while studies from Ethiopia (7.5%) (34), Southwest China (11.9%) (27), reported lower and a study from India (40%) (22), reported a comparable rate of resistance to gentamicin. Other antibiotics for which our isolates were found to be resistant included amoxicillin (34.8%), ampicillin (30.4%), co-trimoxazole (30.4%), amikacin (26.1%), and chloramphenicol (18.5%), a study from Congo reported lower rates of resistance to the above-mentioned antibiotics (33). In comparison, a study from India reported a lower rate of resistance to amikacin (21%) and higher resistance to co-trimoxazole (33%) (22). Other studies reported that none of their isolates were resistant to chloramphenicol (23, 35).
Overall, the rate of antibiotic resistance is higher compared to several previous studies. We do not have specific data on the usage of antibiotics for the included patients in the current study. The increased resistance may be due to the fact that as our institute is a tertiary care hospital, there was every possible chance that the patients must be treated in a primary care setting and might be exposed to some antibiotics during the treatment at such centers. Drugs including β-lactams, aminoglycosides and fluoroquinolones have been used to treat various infections and the prolonged use of such drugs may lead to a high rate of antibiotic resistance.
The ESBL and the AmpC β-lactamase in Salmonella sp. have been reported in developing countries including India and Pakistan (36-38). However, data regarding the report of β-lactamase and the AmpC β-lactamase among Salmonella sp. is scarce in China. In our study, 32.6% of our isolates were positive for the blaCMY-2gene and significantly higher than other genes (t-test, P < 0.05). The blaCTX-M-15 was the next predominant gene found in our study. Similar to our study, a study from India reported that blaCMY-2(20.9%) was the predominant gene while blaCTX-M-15 was the next predominant gene amplified by their NTS, however, their rates were much lower compared to our results (22). In the current clinical settings, third-generation cephalosporins are the drug of choice for treating NTS infections, the presence of blaCTX-M-15, which spread among bacteria, especially the co-occurrence of plasmid-mediated ESBL and AmpC which can hydrolyse even carbapenems and pose a serious threat during the treatment of NTS infections. The study is limited by its retrospective and single-center design.

5.1. Conclusions

Overall, S. typhimurium was the predominant species identified and blaCMY-2 was the predominant gene amplified by our isolates. In general, invasive isolates exhibit less resistance, however, in our study the iNTS isolated from blood samples showed a similar resistance pattern to that of the NTS isolated from stool samples. Compared to other literature, the high prevalence and increased resistance especially among iNTS is a cause of concern and reiterates the need to test blood samples along with the stool samples for better management of gastroenteritis.

Footnotes

  • Authors' Contribution: Study concept and design: Jing Yang, Lan Ma, and Wei Wang; acquisition of data: Jing Yang, Xinyao Liu, Ling Meng, Lan Ma, and Wei Wang; analysis and interpretation of data: Ling Meng and Lan Ma; drafting of the manuscript: Xinyao Liu, Ling Meng, and Wei Wang; critical revision of the manuscript for important intellectual content: Jing Yang, Lan Ma, and Wei Wang; statistical analysis: Ling Meng and Lan Ma; administrative, technical, and material support: Xinyao Liu, Ling Meng, and Lan Ma; study supervision: Jing Yang and Wei Wang.

  • Conflict of Interests: There is no conflict of interests.

  • Ethical Approval: Approval from the hospital Ethical Committee was obtained for the study (approval no. 2016-012).

  • Financial Disclosure: There is no financial disclosure.

  • Funding/Support: This study was supported by National Natural Science Foundation of China (No. 31700720).

References

  • 1.
    Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O'Brien SJ, et al. The global burden of nontyphoidal Salmonella gastroenteritis. Clin Infect Dis. 2010;50(6):882-9. [PubMed ID: 20158401]. https://doi.org/10.1086/650733.
  • 2.
    Dutta U, Garg PK, Kumar R, Tandon RK. Typhoid carriers among patients with gallstones are at increased risk for carcinoma of the gallbladder. Am J Gastroenterol. 2000;95(3):784-7. [PubMed ID: 10710075]. https://doi.org/10.1111/j.1572-0241.2000.01860.x.
  • 3.
    Foley SL, Lynne AM. Food animal-associated Salmonella challenges: Pathogenicity and antimicrobial resistance. J Anim Sci. 2008;86(14 Suppl):E173-87. [PubMed ID: 17878285]. https://doi.org/10.2527/jas.2007-0447.
  • 4.
    Hohmann EL. Nontyphoidal salmonellosis. Clin Infect Dis. 2001;32(2):263-9. [PubMed ID: 11170916]. https://doi.org/10.1086/318457.
  • 5.
    Gal-Mor O, Boyle EC, Grassl GA. Same species, different diseases: How and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front Microbiol. 2014;5:391. [PubMed ID: 25136336]. [PubMed Central ID: PMC4120697]. https://doi.org/10.3389/fmicb.2014.00391.
  • 6.
    Fuche FJ, Sow O, Simon R, Tennant SM. Salmonella serogroup C: Current status of vaccines and why they are needed. Clin Vaccine Immunol. 2016;23(9):737-45. [PubMed ID: 27413069]. [PubMed Central ID: PMC5014923]. https://doi.org/10.1128/CVI.00243-16.
  • 7.
    Jones TF, Ingram LA, Cieslak PR, Vugia DJ, Tobin-D'Angelo M, Hurd S, et al. Salmonellosis outcomes differ substantially by serotype. J Infect Dis. 2008;198(1):109-14. [PubMed ID: 18462137]. https://doi.org/10.1086/588823.
  • 8.
    Ballal M, Devadas SM, Shetty V, Bangera SR, Ramamurthy T, Sarkar A. Emergence and serovar profiling of non-typhoidal Salmonellae (NTS) isolated from gastroenteritis cases-A study from South India. Infect Dis (Lond). 2016;48(11-12):847-51. [PubMed ID: 27300440]. https://doi.org/10.3109/23744235.2016.1169553.
  • 9.
    Collard JM, Place S, Denis O, Rodriguez-Villalobos H, Vrints M, Weill FX, et al. Travel-acquired salmonellosis due to Salmonella Kentucky resistant to ciprofloxacin, ceftriaxone and co-trimoxazole and associated with treatment failure. J Antimicrob Chemother. 2007;60(1):190-2. [PubMed ID: 17449886]. https://doi.org/10.1093/jac/dkm114.
  • 10.
    Van Meervenne E, Botteldoorn N, Lokietek S, Vatlet M, Cupa A, Naranjo M, et al. Turtle-associated Salmonella septicaemia and meningitis in a 2-month-old baby. J Med Microbiol. 2009;58(Pt 10):1379-81. [PubMed ID: 19528160]. https://doi.org/10.1099/jmm.0.012146-0.
  • 11.
    Su LH, Chiu CH, Chu C, Ou JT. Antimicrobial resistance in nontyphoid Salmonella serotypes: A global challenge. Clin Infect Dis. 2004;39(4):546-51. [PubMed ID: 15356819]. https://doi.org/10.1086/422726.
  • 12.
    Graham SM. Salmonellosis in children in developing and developed countries and populations. Curr Opin Infect Dis. 2002;15(5):507-12. [PubMed ID: 12686884].
  • 13.
    Angelo KM, Reynolds J, Karp BE, Hoekstra RM, Scheel CM, Friedman C. Antimicrobial resistance among nontyphoidal Salmonella isolated from blood in the United States, 2003-2013. J Infect Dis. 2016;214(10):1565-70. [PubMed ID: 27609807]. https://doi.org/10.1093/infdis/jiw415.
  • 14.
    Crump JA, Medalla FM, Joyce KW, Krueger AL, Hoekstra RM, Whichard JM, et al. Antimicrobial resistance among invasive nontyphoidal Salmonella enterica isolates in the United States: National Antimicrobial Resistance Monitoring System, 1996 to 2007. Antimicrob Agents Chemother. 2011;55(3):1148-54. [PubMed ID: 21199924]. [PubMed Central ID: PMC3067073]. https://doi.org/10.1128/AAC.01333-10.
  • 15.
    Li Y, Xie X, Xu X, Wang X, Chang H, Wang C, et al. Nontyphoidal salmonella infection in children with acute gastroenteritis: Prevalence, serotypes, and antimicrobial resistance in Shanghai, China. Foodborne Pathog Dis. 2014;11(3):200-6. [PubMed ID: 24313784]. https://doi.org/10.1089/fpd.2013.1629.
  • 16.
    Kariuki S, Revathi G, Kariuki N, Kiiru J, Mwituria J, Hart CA. Characterisation of community acquired non-typhoidal Salmonella from bacteraemia and diarrhoeal infections in children admitted to hospital in Nairobi, Kenya. BMC Microbiol. 2006;6:101. [PubMed ID: 17173674]. [PubMed Central ID: PMC1764016]. https://doi.org/10.1186/1471-2180-6-101.
  • 17.
    Anvarinejad M, Pouladfar GR, Pourabbas B, Amin Shahidi M, Rafaatpour N, Dehyadegari MA, et al. Detection of Salmonella spp. with the BACTEC 9240 automated blood culture system in 2008 - 2014 in Southern Iran (Shiraz): Biogrouping, MIC, and antimicrobial susceptibility profiles of isolates. Jundishapur J Microbiol. 2016;9(4). e26505. [PubMed ID: 27284396]. [PubMed Central ID: PMC4897598]. https://doi.org/10.5812/jjm.26505.
  • 18.
    Miriagou V, Tassios PT, Legakis NJ, Tzouvelekis LS. Expanded-spectrum cephalosporin resistance in non-typhoid Salmonella. Int J Antimicrob Agents. 2004;23(6):547-55. [PubMed ID: 15194124]. https://doi.org/10.1016/j.ijantimicag.2004.03.006.
  • 19.
    Gniadkowski M. Evolution and epidemiology of extended-spectrum beta-lactamases (ESBLs) and ESBL-producing microorganisms. Clin Microbiol Infect. 2001;7(11):597-608. [PubMed ID: 11737084].
  • 20.
    Clinical and Laboratory Standards Institute. M100-S25 performance standards for antimicrobial susceptibility testing; twenty-fifth informational supplement. Wayne, PA: Clinical and Laboratory Standards Institute; 2015.
  • 21.
    Hartas J, Hibble M, Sriprakash KS. Simplification of a locus-specific DNA typing method (Vir typing) for Streptococcus pyogenes. J Clin Microbiol. 1998;36(5):1428-9. [PubMed ID: 9574721]. [PubMed Central ID: PMC104844].
  • 22.
    Taneja N, Appannanavar SB, Kumar A, Varma G, Kumar Y, Mohan B, et al. Serotype profile and molecular characterization of antimicrobial resistance in non-typhoidal Salmonella isolated from gastroenteritis cases over nine years. J Med Microbiol. 2014;63(Pt 1):66-73. [PubMed ID: 24149623]. https://doi.org/10.1099/jmm.0.061416-0.
  • 23.
    Harb A, O'Dea M, Hanan ZK, Abraham S, Habib I. Prevalence, risk factors and antimicrobial resistance of Salmonella diarrhoeal infection among children in Thi-Qar Governorate, Iraq. Epidemiol Infect. 2017;145(16):3486-96. [PubMed ID: 29103396]. https://doi.org/10.1017/S0950268817002400.
  • 24.
    Centers for Disease Control Prevention. Vital signs: incidence and trends of infection with pathogens transmitted commonly through food--foodborne diseases active surveillance network, 10 U.S. sites, 1996-2010. MMWR Morb Mortal Wkly Rep. 2011;60(22):749-55. [PubMed ID: 21659984].
  • 25.
    Araque M. Nontyphoid Salmonella gastroenteritis in pediatric patients from urban areas in the city of Merida, Venezuela. J Infect Dev Ctries. 2009;3(1):28-34. [PubMed ID: 19749446].
  • 26.
    Feasey NA, Dougan G, Kingsley RA, Heyderman RS, Gordon MA. Invasive non-typhoidal salmonella disease: An emerging and neglected tropical disease in Africa. Lancet. 2012;379(9835):2489-99. [PubMed ID: 22587967]. [PubMed Central ID: PMC3402672]. https://doi.org/10.1016/S0140-6736(11)61752-2.
  • 27.
    Zhang SX, Zhou YM, Tian LG, Chen JX, Tinoco-Torres R, Serrano E, et al. Antibiotic resistance and molecular characterization of diarrheagenic Escherichia coli and non-typhoidal Salmonella strains isolated from infections in Southwest China. Infect Dis Poverty. 2018;7(1):53. [PubMed ID: 29792233]. [PubMed Central ID: PMC5964730]. https://doi.org/10.1186/s40249-018-0427-2.
  • 28.
    Scallan E, Mahon BE, Hoekstra RM, Griffin PM. Estimates of illnesses, hospitalizations and deaths caused by major bacterial enteric pathogens in young children in the United States. Pediatr Infect Dis J. 2013;32(3):217-21. [PubMed ID: 23249909]. https://doi.org/10.1097/INF.0b013e31827ca763.
  • 29.
    Kumar A, Browne C, Scotland S, Krishnamurthy K, Nielsen AL. Selected enteropathogens and clinical course in children hospitalized with severe acute gastroenteritis in Barbados. Int J Health Sci (Qassim). 2014;8(4):409-17. [PubMed ID: 25780359]. [PubMed Central ID: PMC4350894].
  • 30.
    Shahunja KM, Leung DT, Ahmed T, Bardhan PK, Ahmed D, Qadri F, et al. Factors Associated with Non-typhoidal Salmonella Bacteremia versus typhoidal Salmonella Bacteremia in patients presenting for care in an urban diarrheal disease hospital in Bangladesh. PLoS Negl Trop Dis. 2015;9(9). e0004066. [PubMed ID: 26361076]. [PubMed Central ID: PMC4567379]. https://doi.org/10.1371/journal.pntd.0004066.
  • 31.
    Ikumapayi UN, Antonio M, Sonne-Hansen J, Biney E, Enwere G, Okoko B, et al. Molecular epidemiology of community-acquired invasive non-typhoidal Salmonella among children aged 2 29 months in rural Gambia and discovery of a new serovar, Salmonella enterica Dingiri. J Med Microbiol. 2007;56(Pt 11):1479-84. [PubMed ID: 17965348]. https://doi.org/10.1099/jmm.0.47416-0.
  • 32.
    Wen SC, Best E, Nourse C. Non-typhoidal Salmonella infections in children: Review of literature and recommendations for management. J Paediatr Child Health. 2017;53(10):936-41. [PubMed ID: 28556448]. https://doi.org/10.1111/jpc.13585.
  • 33.
    Lunguya O, Lejon V, Phoba MF, Bertrand S, Vanhoof R, Glupczynski Y, et al. Antimicrobial resistance in invasive non-typhoid Salmonella from the Democratic Republic of the Congo: Emergence of decreased fluoroquinolone susceptibility and extended-spectrum beta lactamases. PLoS Negl Trop Dis. 2013;7(3). e2103. [PubMed ID: 23516651]. [PubMed Central ID: PMC3597487]. https://doi.org/10.1371/journal.pntd.0002103.
  • 34.
    Eguale T, Gebreyes WA, Asrat D, Alemayehu H, Gunn JS, Engidawork E. Non-typhoidal Salmonella serotypes, antimicrobial resistance and co-infection with parasites among patients with diarrhea and other gastrointestinal complaints in Addis Ababa, Ethiopia. BMC Infect Dis. 2015;15:497. [PubMed ID: 26537951]. [PubMed Central ID: PMC4634906]. https://doi.org/10.1186/s12879-015-1235-y.
  • 35.
    Dhanoa A, Fatt QK. Non-typhoidal Salmonella bacteraemia: Epidemiology, clinical characteristics and its' association with severe immunosuppression. Ann Clin Microbiol Antimicrob. 2009;8:15. [PubMed ID: 19445730]. [PubMed Central ID: PMC2689172]. https://doi.org/10.1186/1476-0711-8-15.
  • 36.
    Jabeen K, Zafar A, Irfan S, Khan E, Mehraj V, Hasan R. Increase in isolation of extended spectrum beta lactamase producing multidrug resistant non typhoidal Salmonellae in Pakistan. BMC Infect Dis. 2010;10:101. [PubMed ID: 20409348]. [PubMed Central ID: PMC2872654]. https://doi.org/10.1186/1471-2334-10-101.
  • 37.
    Menezes GA, Khan MA, Harish BN, Parija SC, Goessens W, Vidyalakshmi K, et al. Molecular characterization of antimicrobial resistance in non-typhoidal salmonellae associated with systemic manifestations from India. J Med Microbiol. 2010;59(Pt 12):1477-83. [PubMed ID: 20813852]. https://doi.org/10.1099/jmm.0.022319-0.
  • 38.
    Uma B, Prabhakar K, Rajendran S, Lakshmi Sarayu Y. Prevalence of extended spectrum beta lactamases in Salmonella species isolated from patients with acute gastroenteritis. Indian J Gastroenterol. 2010;29(5):201-4. [PubMed ID: 20859716]. https://doi.org/10.1007/s12664-010-0044-x.

Copyright

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

21
Sep
2025
Clinical Characteristics and Antimicrobial Resistance Patterns of Salmonella typhimurium Enteritis in 81 Hospitalized Children: A Single-Center Retrospective Study

Clinical Characteristics and Antimicrobial Resistance Patterns of Salmonella typhimurium Enteritis in 81 Hospitalized Children: A Single-Center Retrospective Study

Yaqing Liu,
Lihua Xiao,
Hangyu Zhu,
Sunhe Hu,
Yan Peng

Liu Y, Xiao L, Zhu H, Hu S, Peng Y. Clinical Characteristics and Antimicrobial Resistance Patterns of Salmonella typhimurium Enteritis in 81 Hospitalized Children: A Single-Center Retrospective Study. Jundishapur J Microbiol. 2025;18(9):e164290. doi: https://doi.org/10.5812/jjm-164290

11
Aug
2018
Prevalence and Antibiotic Susceptibility Patterns of Salmonella and Shigella Species Isolated from Pediatric Diarrhea in Tehran

Prevalence and Antibiotic Susceptibility Patterns of Salmonella and Shigella Species Isolated from Pediatric Diarrhea in Tehran

Narges Nodeh Farahani,
Faramarz Masjedian Jazi,
Bahram Nikmanesh,
Parisa Asadolahi,
Behrooz Sadeghi Kalani,
Nour Amirmozafari

Nodeh Farahani N, Masjedian Jazi F, Nikmanesh B, Asadolahi P, Sadeghi Kalani B, et al. Prevalence and Antibiotic Susceptibility Patterns of Salmonella and Shigella Species Isolated from Pediatric Diarrhea in Tehran. Arch Pediatr Infect Dis. 2018;6(4):e57328. doi: https://doi.org/10.5812/pedinfect.57328

5
Nov
2021
Epidemiological Investigation of Salmonella enterica Isolates in Children with Diarrhea in Chengdu, China

Epidemiological Investigation of Salmonella enterica Isolates in Children with Diarrhea in Chengdu, China

Jun-Ying Zhang,
Xiao-Li Xie,
Wen-Juan Wang,
Lin Deng,
Li-Hong Shang,
Li-Jing Xiong
,et al.

Zhang J, Xie X, Wang W, Deng L, Shang L, et al. Epidemiological Investigation of Salmonella enterica Isolates in Children with Diarrhea in Chengdu, China. Jundishapur J Microbiol. 2021;14(8):e119034. doi: https://doi.org/10.5812/jjm.119034

1
Oct
2021
The Antibiotic Resistance Pattern and Prevalence of blaTEM, blaSHV, blaCTX-M, blaPSE-1, sipB/C, and cmlA/tetR Genes in Salmonella typhimurium Isolated from Children with Diarrhea in Tabriz, Iran

The Antibiotic Resistance Pattern and Prevalence of blaTEM, blaSHV, blaCTX-M, blaPSE-1, sipB/C, and cmlA/tetR Genes in Salmonella typhimurium Isolated from Children with Diarrhea in Tabriz, Iran

Abolfazl Jafari Sales,
Sara Naebi,
Rozita Nasiri,
Hossein Bannazadeh-Baghi

Jafari Sales A, Naebi S, Nasiri R, Bannazadeh-Baghi H. The Antibiotic Resistance Pattern and Prevalence of blaTEM, blaSHV, blaCTX-M, blaPSE-1, sipB/C, and cmlA/tetR Genes in Salmonella typhimurium Isolated from Children with Diarrhea in Tabriz, Iran. J Health Rep Technol. 2021;7(4):e118523. doi: https://doi.org/10.5812/ijhls.118523

31
Jan
2011

Nalidixic acid susceptibility status of Salmonella enterica serovar Typhi isolates from Kolkata, India

Shyamapada Mandal,
Manisha DebMandal,
Nishith Kumar Pal

Mandal S, DebMandal M, Pal N. Nalidixic acid susceptibility status of Salmonella enterica serovar Typhi isolates from Kolkata, India. Jundishapur J Microbiol. 2011;4(1):. doi:

More by these authors

Jing YangPubMedScholar
Ling MengPubMedScholar
Xinyao LiuPubMedScholar
Share
Cited by
Metrics