Logo
Jundishapur Journal of Microbiology

Image Credit:Jundishapur Journal of Microbiology

Molecular Characterization of Co-Existence of MCR-1 and NDM-1 in Extended-Spectrum β-Lactamase-Producing Escherichia coli ST648 Isolated from a Colonized Patient in China

Author(s):
Sandip  PatilSandip Patil1, 2, 3, Jiang  MinJiang Min4, Wen FeiqiuWen Feiqiu1, 2,*
1Department of Haematology and Oncology, Shenzhen Children’s Hospital, Shenzhen, China
2Paediatric Research Institute, Shenzhen Children’s Hospital, Shenzhen, China
3Shenzhen Institute of Advanced Technology, Chinese Academy of Science, Shenzhen, China
4Centre for Disease Control and Prevention, Shenzhen, China


Jundishapur Journal of Microbiology:Vol. 12, issue 7; e91272
Published online:Aug 06, 2019
Article type:Letter
Received:Mar 05, 2019
Accepted:Jul 19, 2019
How to Cite:Sandip PatilJiang MinWen FeiqiuMolecular Characterization of Co-Existence of MCR-1 and NDM-1 in Extended-Spectrum β-Lactamase-Producing Escherichia coli ST648 Isolated from a Colonized Patient in China.Jundishapur J Microbiol.12(7):e91272.https://doi.org/10.5812/jjm.91272.

1. Introduction

Polymyxin B (colistin) has been used in agriculture and veterinary medicine since the 1960s. The recent discovery of the plasmid-mediated colistin-resistance gene mcr-1 in China (1) has grabbed the attention of medical science. Colistin is the last available drug to treat infections caused by multidrug-resistant bacteria, particularly carbapenem-resistant Enterobacteriaceae (2). Since 2015, more than 10 distinct alleles of mcr-1 have been reported in Escherichia coli (E. coli), Klebsiella, and Salmonella globally (3). The incidence and spread of the plasmid-mediated colistin-resistance gene mcr-1 in E. coli pose a global concern to the community. Of our particular concern is the dissemination of mcr-1 into carbapenemase-producing or extended-spectrum β-lactamases (ESBLs)-producing E. coli, which results in highly resistant strains, e.g., pandrug-resistant strains that are potentially untreatable (4). Reports are still infrequent on E. coli isolates co-harboring mcr-1 and blaNDM-1 from clinical cases. We report the first case of E. coli pandemic clone sequence type 648 co-harboring colistin-resistance-encoding mcr-1, carbapenemase-encoding blaNDM-1, and ESBLs-encoding blaCTX-M-15 from a clinical case in Shenzhen, China.

2. Method

An 83-year-old male presented to the Medicine Department of Shenzhen hospital with the main complaint of diarrhea in 2015. Initially, Enterobacter species from fecal samples were cultivated on a Columbia blood agar plate. The acquired bacteria were routinely subjected to biochemical tests as well as API 20 system (BioMerieux, Marcy l’Etoile, France) with and further confirmed by using 16S rDNA PCR and sequences. Extended-spectrum -lactamases production was confirmed using the combination disc diffusion method and carbapenemase production was confirmed using a carbapenem inactivation method (CIM), followed by antimicrobial susceptibility testing. The antibiotic susceptibility testing was performed with 22 routinely used antimicrobial agents using the VITEK2 compact system (Ref. No. 27530/275660) according to the Clinical and Laboratory Standard Institute guidelines (CLSI guidelines, 2010).

The standard PCR method was performed to detect the presence of ESBLs-producing genes; blaTEM, blaSHV, blaCTX-M, blaGES, and blaVEB using specific primers as previously described. Additionally, carbapenemase genes (blaKPC and blaNDM-1) and colistin-resistance mcr-1 were determined in ESBL-producing E. coli by the PCR assay and sequencing. The specific primers were used as described in our previous study (Table 1). The purified PCR products were sequenced commercially (Sangon Biotech-Shanghai, China). DNA sequences were analyzed by the NCBI-BLAST program. Multi-locus sequence typing (MLST) was determined by amplifying the internal portions of seven housekeeping genes of E. coli (adk, fumC, gyrB, icd, mdh, purA, and recA) with specific primers as described in the E. coli MLST database (http://mlst.ucc.ie/mlst/dbs/Ecoli). The phylogenetic group was determined by multiplex PCR assays, using a combination of three DNA marker genes (chuA, yjaA, and TspE4.C2) as described by Clermont et al. (2000).

Table 1.Primers Used in This Study
Resistance GenesPrimer Pair SequencesAmplicon Size, bpAnnealing Temperature, ºC
mcr-1ATGATGCAGCATACTTCTGTG162656
TCAGCGGATGAATGCGGTG
blaNDMTGCGGGGTTTTTAATGCTG78553
TGGCTCATCACGATCATGC
blaKPCATGTCACTGTATCGCCGTC88354
TTACTGCCCGTTAACGCC
blaTEMAGGAAGAGTATGATTCAACA53157
CTCGTCGTTTGGTATGGC
blaSHVGGTTATGCGTTATATTCGCC86657
TTAGCTTTGCCAGTGCTC
blaOXA48TTGGTGGCATCGATTATCGG74555
GAGCACTTCTTTTGTGATGGC
blaSMEAACGGCTTCATTTTTGTTTAG83155
GCTTCCGCAATAGTTTTATCA
blaCMYCTGACAGCCTCTTTCTCCA50456
GCCAAACAGACCAATGCT
blaVIMGTTAAAAGTTATTAGTAGTTTATTG79960
CTACTCGGCGACTGAGC
blaIMPATGAGCAAGTTATCTGTATTC74160
TTAGTTGCTTGGTTTTGATGG
blaGESATGCGCTTCATTCACGCAC86457
CTATTTGTCCGTGCTCAGG
blaCARBAAAGCAGATCTTGTGACCTATTC58856
TCAGCGCGACTGTGATGTATAAAC
blaPERAGTCAGCGGCTTAGATA97856
CGTATGAAAAGGACAATC
blaVEBGCGGTAATTTAACCAGA96157
GCCTATGAGCCAGTGTT
blaCTX-MTTTGCGATGTGCAGTACCAGTAA54457
CGATATCGTTGGTGGTGCCATA

Primers Used in This Study

Conjugation experiments were performed to analyze the horizontal gene transfer of blaCTX-M, blaNDM-1, and mcr-1 using streptomycin-resistant E. coli C600 as the recipient strain. We used the liquid mating assay as described in our earlier study. Transconjugants were selected on Luria Bertani agar containing streptomycin 2000 (μg/mL) and cefotaxime (32 μg/mL). The transconjugants were further tested by the PCR assay, followed by sequencing. PCR-based replicon typing was performed to detect the plasmid type using 18 pairs of primers that are recognized as Inc (incompatibility) replicon types: FIA, FIB, FIC, HI1, HI2, I1-Ic, L/M, N, P, W, T, A/C, K, B/O, X, Y, F, and FIIA. Moreover, IncX typing was determined as reported by Timothy J. et al. (2007).

3. Results and Discussion

We confirmed the E. coli SP-17 isolate in the stool sample of a diarrhea patient by biochemical tests. The API 20 system (BioMerieux, Marcy l’Etoile, France) further confirmed 16S rDNA sequences. The antibiotic susceptibility test results showed that the E. coli SP-17 isolate was most resistant to colistin [minimum inhibitory concentrations (MICs) = 8 mg/mL)], followed by ampicillin, ceftazidime, cefepime, aztreonam, ciprofloxacin, levofloxacin, doxycycline, minocycline, ceftriaxone, gentamicin, nitrofurantoin, trimethoprim, and ertapenem but sensitive to piperacillin, cefotetan, imipenem, amikacin, and tigecycline (Table 2). Escherichia coli SP17 showed a pandrug-resistant phenotype known as “superbug”. Based on the PCR assay and sequencing, we confirmed E. coli SP 17 co-harboring mcr-1, blaNDM-1, and blaCTX-M-15. In addition, blaSHV, blaTEM, blaaac, mphA, strA, and dfrA were detected in the same isolate. We did not find other β-lactamase genes including blaGES and blaVEB. The housekeeping gene sequences and phylogenetic group analysis showed that the E. coli SP17 isolate belonged to the ST648 type group A (Table 3).

Table 2.Antibiotic Susceptibility of Escherichia coli Strain SP-15-17 and Its Transconjugants
AntibioticsMinimum Inhibitory Concentrations, mg/L
Isolates
SP-E-15-17SP-M-1517C600ATCC2599
Colistin86< 0.25< 0.25
Ampicillin> 32> 32< 2< 2
Ampicillin Sulbactam> 32> 32< 2< 2
Piperacillin/Tazobactam< 4< 4< 4< 4
Cefazolin> 64> 64< 4< 4
Cefotetan< 4< 4< 4< 4
Ceftazidime> 64> 64< 1< 1
Ceftriaxone> 64> 64< 1< 1
Cefepime168< 1< 1
Aztreonam> 64> 64< 1< 1
Ertapenem< 0.5< 0.5< 0.5< 0.5
Imipenem< 1< 1< 1< 1
Tobramycin8< 4< 1< 1
Amikacin< 2< 2< 2< 2
Gentamicin> 16< 1< 1< 1
Ciprofloxacin> 4< 0.5< 0.25< 0.25
Levofloxacin> 8< .05< 0.25< 0.25
Nitrofurantoin< 16< 16< 16< 16
Trimethoprim< 20< 20< 20< 20
Doxycycline> 16< 4< 4< 4
Minocycline> 16< 4< 4< 4
Tigecycline< 0.5< 0.5< 0.5< 0.05

Antibiotic Susceptibility of Escherichia coli Strain SP-15-17 and Its Transconjugants

Table 3.Details of MLST and Phylogenetic Analysis
IsolateHousekeeping GenesSTSTCLPXPhylogenic Group
adkfumcgyrbicdmdhpurArecA
SP-E-15-17924879670582ST648ST648A

Details of MLST and Phylogenetic Analysis

Carbapenem and colistin-resistant C600 transconjugants were successfully obtained from this isolate. The PCR-based replicon type assay showed that plasmids carrying mcr-1 and blaNDM-1 belonged to IncX3, the size of which was confirmed in 0.7% agarose gel electrophoresis. The co-existence of blaNDM-1 and mcr-1 has been reported in the specimen of cases with bloodstream infection and urinary tract infection (5). To the best of our knowledge, this is the first study from Shenzen, China, that reports such an occurrence in the fecal specimen of a colonized individual. The MLST and phylogenic group results showed that the E. coli SP17 isolate belonged to ST648 type group A, which is the most pandemic clone combining multidrug resistance and virulence (6). The E. coli ST648 clone has been observed globally in humans, companion animals, livestock, and wild birds and is commonly allied with various β-lactamases, including ESBLs, NDM, and KPC (7, 8).

Conjugation experiments showed that the plasmids harboring the mcr-1 and blaNDM-1 genes were successfully transferred to E. coli EC600, indicating that mcr-1 and blaNDM-1 were located on conjugative plasmids but blaCTX-M-15 was located on another plasmid. Similar results have been reported globally. The PCR-based replicon typing indicated that the resistance determinants were located on the commonly reported IncX3 plasmid. One limitation of this study is the lack of performing S1-PFGE, followed by Southern blotting to determine the location of the gene or even the whole genome sequencing.

4. Conclusions

Overall, to the best of our knowledge, this is the first report of co-harboring mcr-1 and blaNDM-1, and blaCTX-M-15 in E. coli ST648 isolated from a diarrhea patient in Shenzhen, China. The occurrence of the multidrug-resistance enzyme-encoding genes in E. coli ST648 (group A) pandemic clone is quite alarming to society. The constant surveillance of the field strains is essentially required.

Footnotes

References

  • 1.
    Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161-8. [PubMed ID: 26603172]. https://doi.org/10.1016/S1473-3099(15)00424-7.
  • 2.
    Morrill HJ, Pogue JM, Kaye KS, LaPlante KL. Treatment options for carbapenem-resistant enterobacteriaceae infections. Open Forum Infect Dis. 2015;2(2):ofv050. [PubMed ID: 26125030]. [PubMed Central ID: PMC4462593]. https://doi.org/10.1093/ofid/ofv050.
  • 3.
    Wang R, van Dorp L, Shaw LP, Bradley P, Wang Q, Wang X, et al. The global distribution and spread of the mobilized colistin resistance gene mcr-1. Nat Commun. 2018;9(1):1179. [PubMed ID: 29563494]. [PubMed Central ID: PMC5862964]. https://doi.org/10.1038/s41467-018-03205-z.
  • 4.
    Dandachi I, Chabou S, Daoud Z, Rolain JM. Prevalence and emergence of extended-spectrum cephalosporin-, carbapenem- and colistin-resistant gram negative bacteria of animal origin in the mediterranean basin. Front Microbiol. 2018;9:2299. [PubMed ID: 30323797]. [PubMed Central ID: PMC6172473]. https://doi.org/10.3389/fmicb.2018.02299.
  • 5.
    Li X, Mu X, Zhang P, Zhao D, Ji J, Quan J, et al. Detection and characterization of a clinical Escherichia coli ST3204 strain coproducing NDM-16 and MCR-1. Infect Drug Resist. 2018;11:1189-95. [PubMed ID: 30147347]. [PubMed Central ID: PMC6101002]. https://doi.org/10.2147/IDR.S175041.
  • 6.
    Ewers C, Bethe A, Stamm I, Grobbel M, Kopp PA, Guerra B, et al. CTX-M-15-D-ST648 Escherichia coli from companion animals and horses: another pandemic clone combining multiresistance and extraintestinal virulence? J Antimicrob Chemother. 2014;69(5):1224-30. [PubMed ID: 24398338]. https://doi.org/10.1093/jac/dkt516.
  • 7.
    Gao R, Li Y, Lin J, Tan C, Feng Y. Unexpected complexity of multidrug resistance in the mcr-1-harbouring Escherichia coli. Sci China Life Sci. 2016;59(7):732-4. [PubMed ID: 27178474]. https://doi.org/10.1007/s11427-016-5070-1.
  • 8.
    Chakraborty A, Saralaya V, Adhikari P, Shenoy S, Baliga S, Hegde A. Characterization of Escherichia coli phylogenetic groups associated with extraintestinal infections in south Indian population. Ann Med Health Sci Res. 2015;5(4):241-6. [PubMed ID: 26229711]. [PubMed Central ID: PMC4512115]. https://doi.org/10.4103/2141-9248.160192.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.