Jundishapur Journal of Microbiology

Image Credit:Jundishapur Journal of Microbiology

Transmission Rates of Chlamydia trachomatis and Neisseria gonorrhoeae Infections from Pregnant Women to Newborns, Tehran, Iran

Author(s):
Abdoulreza EsteghamatiAbdoulreza EsteghamatiAbdoulreza Esteghamati ORCID1, Ali MazouriAli MazouriAli Mazouri ORCID2, Shirin SayyahfarShirin SayyahfarShirin Sayyahfar ORCID1, Khadijeh KhanalihaKhadijeh KhanalihaKhadijeh Khanaliha ORCID1, Faezeh HaghighiFaezeh HaghighiFaezeh Haghighi ORCID3, Mahmood FaramarziMahmood FaramarziMahmood Faramarzi ORCID1, Morteza Haghighi HasanabadMorteza Haghighi HasanabadMorteza Haghighi Hasanabad ORCID1,*
1Research Center of Pediatric Infectious Diseases, Institute of Immunology and Infectious Diseases, Iran University of Medical Sciences, Tehran, Iran
2Shahid Akbarabadi Clinical Research Development Unit, Iran University of Medical Sciences, Tehran, Iran
3Cellular and Molecular Research Center, Sabzevar University of Medical Sciences, Sabzevar, Iran

Jundishapur Journal of Microbiology:Vol. 13, issue 3; e92549
Published online:Apr 12, 2020
Article type:Research Article
Received:Apr 23, 2019
Accepted:Mar 04, 2020
How to Cite:Esteghamati A, Mazouri A, Sayyahfar S, Khanaliha K, Haghighi F, et al. Transmission Rates of Chlamydia trachomatis and Neisseria gonorrhoeae Infections from Pregnant Women to Newborns, Tehran, Iran. Jundishapur J Microbiol. 2020;13(3):e92549. doi: https://doi.org/10.5812/jjm.92549

Abstract

Background:

Pregnant women with Chlamydia trachomatis and Neisseria gonorrhoeae infections can vertically transmit these microorganisms to their newborns through the birth canal and cause neonatal conjunctivitis secondary to sexually transmitted infections.

Objectives:

In this cross-sectional study, we aimed to evaluate the prevalence of C. trachomatis and N. gonorrhoeae infections among pregnant women attending a hospital in Tehran, and also determine the vertical transmission rate of these two organisms to the eyes of newborns after vaginal delivery.

Methods:

Endocervical and conjunctival swabs were collected from pregnant women and their newborns within 24 hours after birth. Demographic and clinical data of participants were obtained using a questionnaire and from the hospital records. Then, DNA was extracted and tested by a multiplex PCR assay to detect C. trachomatis and N. gonorrhoeae in specimens.

Results:

Genital infections of C. trachomatis and N. gonorrhoeae were detected in 9.6% (11 of 125) and 1.6% (2 of 125) of pregnant women, respectively. Among newborns, ocular infection with C. trachomatis was detected in 2 (1.6%), and no case of N. gonorrhoeae infection was found. Both infected infants were born from asymptomatic infected women. Therefore, the vertical transmission rate of C. trachomatis infection was calculated as 18.1%. Our results also revealed that ocular C. trachomatis infection in neonates is significantly in association with genital C. trachomatis infection in pregnant women (OR = 0.16, 95% CI = 0.03 - 0.7, P = 0.002).

Conclusions:

Pregnant women with asymptomatic infection of C. trachomatis have a key role in the distribution of chlamydial conjunctivitis in newborns. Since ocular prophylaxis in neonates is not effective for chlamydial conjunctivitis, therefore education and screening of pregnant women, as well as treatment of infected cases, remain as the best approach for controlling the disease.

1. Background

According to the WHO, annually, more than 330 million new cases of curable sexually transmitted infections (STIs) occur worldwide, which equals to about one million new infections every day (1). Chlamydia trachomatis and Neisseria gonorrhoeae are leading bacterial causes of the STIs with same symptoms among sexually active adults (2). Although infected women carry primarily the major burden of diseases associated with C. trachomatis and N. gonorrhoeae such as mucopurulent cervicitis (MPC), gonococcal or non-gonococcal urethritis (GU or NGU), and pelvic inflammatory disease (PID) with an increased risk of infertility; they are also of concern as potential sources of neonatal conjunctivitis secondary to STIs (3, 4). According to evidence, pregnant women with active, untreated infections of C. trachomatis and N. gonorrhoeae can transmit these bacteria to their neonates during parturition with the risk of about 10 - 50% (5).
Chlamydia trachomatis is the leading cause of vertically transmitted neonatal conjunctivitis with a peak of incidence during the spring and summer months (6). It is estimated that 20 to 50% of neonates with proven exposure to C. trachomatis will develop conjunctivitis after birth (7, 8). The clinical presentations of chlamydial conjunctivitis differ from mild symptoms to severe mucopurulent discharge with inflammation and swelling eyelids (9). Nowadays, less than 1% of all neonatal conjunctivitis is attributed to N. gonorrhoeae. However, ocular infection of newborns with N. gonorrhoeae is associated with a high risk of corneal perforation and might result in blindness if not treated properly (10). Iranian neonates may be at a higher risk of ophthalmia neonatorum (ON) as the result of lacking an ocular prophylaxis program in the country (11). Currently, neonatal ocular prophylaxis and prenatal STIs screening are not carried out routinely in Iran, and only those with clinical symptoms of infections are tested. A previous study has reported that the frequency of ophthalmia neonatorum among hospitalized neonates of 2 hospitals in Tehran is about 4.9% (12).

2. Objectives

The vertical transmission rate of C. trachomatis and N. gonorrhoeae infections in Iran has not been well documented, and currently, there is no data from our region (Tehran, Iran). To address this gap, we aimed for the present study to firstly evaluate the prevalence of C. trachomatis and N. gonorrhoeae infections among pregnant women and secondly determine the vertical transmission rate of these two organisms in the eyes of their newborns after vaginal delivery.

3. Methods

3.1. Population Study

From November 2017 to January 2018, pregnant women attending the delivery room of Shahid Akbarabadi Hospital in Tehran, Iran. Their infants within 24 hours after vaginal delivery were included in this cross-sectional study. The maternity unit of this public hospital provides comprehensive care to referrals from the middle and low socioeconomic statuses and covers more than 70% of all the deliveries in the southern region of the city (8802 annual live births), which equals to approximately 5 - 10% of the annual birth cohort in the city. Exclusion criteria were cesarean section (C/S) PROM, genitourinary symptoms, and prior antibiotic use. None of the neonates born received prophylactic eye drops. Participation in this study was voluntary, and informed consent was obtained from women for taking part in the study. Demographic and clinical data on the pregnant women were collected by interview, and the main characteristic data of infants were obtained from the medical records.

3.2. Sample Collection

At first, a gynecologist examined the pregnant women who had the inclusion criteria of the study. Subsequently, a cervical specimen was obtained from each female via inserting and rotating a sterile Dacron swab into the endocervical canal. A pediatrician examined newborns of enrolled women after vaginal delivery and obtained ocular samples by sterile cotton swabs via gentle scraping of each conjunctiva. Obtained swabs were placed separately into the collection tubes containing 1 mL of sterile PBS (Phosphate Buffer Salin, pH: 7.3), mixed well, and transported on ice to the Research Laboratory at the Institute of Immunology and Infectious Diseases (Hazrate Rasool University Hospital) within 24 - 48 hours. On receipt in the laboratory, specimens were vortexed briefly (1 - 3 seconds) and centrifuged for 20 minutes at 4000 × rpm. Subsequently, 100 μL of samples were transferred to a 1.5 mL tube and stored at -70°C until processed.

3.3. DNA Extraction

DNA was extracted from specimens by using a DNPTM kit (Cat No. EX6071, Sinaclon, Iran) according to the manufacturer’s instructions. Eluted DNA in 50 μL TE buffer (Tris-EDTA, pH: 7.5) was stored at -20°C until PCR analysis.

3.4. PCR Assay

A multiplex PCR (primary m-PCR) with primers KL-1/ KL-2 (targeting 241 bp fragment of the cryptic plasmid in C. trachomatis) and HO1/ HO3 (targeting 390 bp fragment of the cppB gene in N. gonorrhoeae) was performed to detect both organisms in one reaction tube, as described previously (13). Prior to testing of clinical specimens, PCR conditions were optimized as uniplex PCR using the DNA extracts from standard reference strains of C. trachomatis (serovar L2 type strain 434/Bu, ATCC VR-902B) and N. gonorrhoeae (ATCC 11688). Then, m-PCR assay was established with optimized conditions (reaction volumes and annealing temperatures) of uniplex PCR for testing specimens. Briefly, the 50 μL Duplex PCR reaction mixture consisted of 3 μL from each extracted DNA, 25 μL of the master mix solution (Cinnagen Ltd Co., Iran), 1.5 μL of each specific oligonucleotide primer and 13 μL distilled water. In addition, the reaction involved one cycle at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 35 seconds, annealing at 55.6°C for 40 seconds, and extension at 72°C for 1 minute followed by a last cycle extension at 72°C for 10 minutes. The amplification reactions were performed on a Labcycler PCR system (SensoQuest). Amplified products were analyzed on 1.5% agarose gel through 0.5% TBE buffer and were visualized by DNA safe stain (Cinnagen Ltd Co., Iran) under a UV transilluminator.
The primers and PCR product sizes are listed in Table 1. The electrophoresis pattern of amplified products is shown in Figure 1.
Table 1.The Sequence of Primers Used in This Study
PCROrganismPrimer PairsPrimer Sequences (5′-3′)Amplicon SizeReferences No.
m-PCRNeisseria gonorrhoeaeHO1GCTACGCATACCCGCGTTGC39013
HO3CGAAGACG1TCGAGCAGACA
Chlamydia trachomatisKL-1TCCGGAGCGAGTTACGAAGA241
KL-2AATCAATGCCCGGGATTGGT
Confirmatory PCRN. gonorrhoeaeORF1CAACTATTCCCGATTGCGA28314
ORF2GTTATACAGCTTCGCCTGAA
The electrophoresis pattern of amplified products. Uniplex PCR (lane 9: 390 bp band of <i>Neisseria gonorrhoeae</i>, lane 10: 241 bp band of <i>Chlamydia trachomatis</i>); m-PCR (lanes 3, 4, 5, and 7: 241 bp and 390 bp bands of <i>C. trachomatis</i> and <i>N. gonorrhoeae</i>); confirmatory PCR (lane 8: 283 bp band of <i>N. gonorrhoeae</i>), lanes 2 and 6: negative controls, lanes 1 and 11: 100 bp DNA ladder.
Figure 1.

The electrophoresis pattern of amplified products. Uniplex PCR (lane 9: 390 bp band of Neisseria gonorrhoeae, lane 10: 241 bp band of Chlamydia trachomatis); m-PCR (lanes 3, 4, 5, and 7: 241 bp and 390 bp bands of C. trachomatis and N. gonorrhoeae); confirmatory PCR (lane 8: 283 bp band of N. gonorrhoeae), lanes 2 and 6: negative controls, lanes 1 and 11: 100 bp DNA ladder.

3.5. Quality Control

To prevent false-positive results due to non-gonococcal strains, N. gonorrhoea positive samples of m-PCR were retested by confirmatory PCR using alternate primers and targeting a 283 bp fragment of the orf gene in N. gonorrhoea (14).

3.6. Statistical Analysis

The possible association of background variables with infection in each group was examined using logistic regression, and a common odds ratio (95% CI) was used for significantly associated factors. The prevalence of C. trachomatis and N. gonorrhoeae infections were determined using MedCalc Statistical Software version 15.8 (MedCalc Software bvba, Ostend, Belgium; https://www.medcalc.org; 2015). The statistical significance was set at P < 0.05.

4. Results

4.1. Subjects

A total of 390 endocervical and conjunctival swabs were collected from 130 pregnant women and 130 newborns (≥ 10% of eligible subjects during the study period), of which ten were excluded from the study (5 women and five newborns) because of missing samples, technical problems and/or insufficient data. Among the pregnant women with the mean age of 27.8 years (range: 16 - 45 years), 26.4% and 20.8% had a history of STIs and abortion, respectively. Additionally, a high proportion of studied women had ≥ 1 child (73.6%). Of newborns, 73 were male, and 52 were female. The mean gestational age and mean birth weight were recorded as 38.2 weeks (SD = ± 2.02) and 3201 g (SD = ± 499), respectively. Symptoms suspicious for conjunctivitis were observed in 4 infants (3.2%).

4.2. Diagnosis of Chlamydia trachomatis and Neisseria gonorrhoeae Infections

In total, C. trachomatis and N. gonorrhoeae DNA was detected in 10.4% (13/125, 95% confidence intervals (CI): 0.5 - 17.7) of endocervical samples, and no dual infection was found. According to results of m-PCR, genital infections of C. trachomatis and N. gonorrhoeae were diagnosed in 8.8% (11/125, 95%CI: 4.3 - 15.7) and 1.6% (2/125, 95%CI: 0.1 - 5.7) of pregnant women, respectively. There was no association between C. trachomatis and N. gonorrhoeae infections and background variables in pregnant women. Of 125 newborns evaluated by PCR assay, C. trachomatis infection was identified in 2 infants, yielding a chlamydial infection incidence of 1.6% (95%CI: 0.1 - 5.7), which is approximately 16 cases per 1000 live births. In addition, no case of gonococcal infection was found in our study. Both infected infants were male, infected unilaterally, and born from mothers who had a C. trachomatis positive test.
Clinical symptoms attributable to conjunctivitis were observed in one case (eye discharge and redness). The vertical transmission rate of C. trachomatis from pregnant women to infants was calculated as 18.1% (95%CI: 2.2 - 65.6). Additionally, ocular C. trachomatis infection in newborns was significantly in association with genital C. trachomatis infection in pregnant women (OR= 0.16, 95%CI= 0.03 - 0.7, P = 0.002). Positive PCR results were communicated to the infants' parents, and infected infants underwent further examinations by a neonatologist and ophthalmologist.

5. Discussion

Screening for STIs is a public health priority, specifically in the context of pregnant women (15). Several studies have been conducted in our country to investigate the prevalence estimate of C. trachomatis and N. gonorrhoeae infections among pregnant women; however, there are limited data regarding the vertical transmission rate of these two organisms. To our knowledge, this is the first time that vertical transmission rate of C. trachomatis and N. gonorrhoeae infections have been estimated in the capital city, Tehran, Iran. Even though it is important to note some limitations of our study, which should be considered in interpreting our results.
Firstly, the prevalence of C. trachomatis and N. gonorrhoeae infections was assessed at a single site. Secondly, the study site was located in the southern region, and finally, the study sample size was relatively small. Therefore, the findings of our study may not be generalizable to the other regions and the whole population of Tehran.Our finding of an 8.8% C. trachomatis infection rate in the present study is consistent with results from studies conducted within the past two decades across Iran. In a meta-analysis on reports of C. trachomatis infection rate among pregnant Iranian women, the overall prevalence of C. trachomatis infection has been reported to be 8.74% (95%CI: 5.40 - 13.84) (16). However, the prevalence estimate of C. trachomatis infection that we report in this study is moderate in comparison to those reported previously in this region (2.2% and 3.3% by Khezerdoust et al., 11.1% by Rashidi et al., and 11.2% by Chamani et al.) (17-19).
Differences in the socioeconomic status of studied populations and sensitivities of laboratory methods may account for some of these reported variations. In the current study, we found an incidence rate of about 1.6% for C. trachomatis infection in the ocular specimens of neonates. The association between neonatal conjunctivitis and genital infections in pregnant women has been known for over two decades (20). Consistently, our data in this study revealed that ocular infection of newborns with C. trachomatis is significantly in association with chlamydial infection in their mothers (OR = 0.16, 95%CI = 0.03-0.7, P = 0.002). The vertical transmission rate of C. trachomatis that we have estimated in newborns of Tehran (18.1%), is significantly lower than that reported in a similar study from the city of Shiraz, in the southern region of Iran (28 of 37 (75.6%), P = 0.003) (21). Differences in the prevalence rate of C. trachomatis infection in various geographical regions of Iran may justify some part of these variations.
The prevalence estimate of genital N. gonorrhoeae infection in the present study (1.6%) was comparable to the recently reported prevalence of 1.3% and 1.2% among pregnant women of Shiraz and Sabzevar (North-East of Iran) cities (21, 22). However, no neonates with ocular N. gonorrhoeae infection were identified in this study. The relatively low rate of gonococcal infections in pregnant women may justify the absence of ocular N. gonorrhoeae infection in our study. Given the total number of vaginal deliveries recorded during the three months of the study period (n = 1242), we would expect an additional 20 infants with ocular C. trachomatis infection, in keeping with the current study. However, as mentioned earlier, this study was performed at a single site, and participants may not be representative of the whole population in our region.

5.1. Conclusions

In the present study, the incidence of ocular C. trachomatis infection among neonates was calculated as 16 cases per 1000 live births. More importantly, both infected infants in this study were born from mothers who were asymptomatically infected with C. trachomatis. Since pregnant women with asymptomatic infection of C. trachomatis have a key role in the distribution of disease, prenatal screening tests that do identify pregnant women at higher risk for developing sequels, as well as education and treatment of infected cases are recommended as the best approach for controlling the disease. Finally, further studies with larger sample sizes and more focused on different causative agents of neonatal conjunctivitis in different parts of our country, Iran is suggested for the future.

Acknowledgments

Footnotes

References

  • 1.
    Newman L, Rowley J, Vander Hoorn S, Wijesooriya NS, Unemo M, Low N, et al. Global estimates of the prevalence and incidence of four curable sexually transmitted infections in 2012 based on systematic review and global reporting. PLoS One. 2015;10(12). e0143304. [PubMed ID: 26646541]. [PubMed Central ID: PMC4672879]. https://doi.org/10.1371/journal.pone.0143304.
  • 2.
    Malhotra M, Sood S, Mukherjee A, Muralidhar S, Bala M. Genital Chlamydia trachomatis: An update. Indian J Med Res. 2013;138(3):303-16. [PubMed ID: 24135174]. [PubMed Central ID: PMC3818592].
  • 3.
    Haggerty CL, Gottlieb SL, Taylor BD, Low N, Xu F, Ness RB. Risk of sequelae after Chlamydia trachomatis genital infection in women. J Infect Dis. 2010;201 Suppl 2:S134-55. [PubMed ID: 20470050]. https://doi.org/10.1086/652395.
  • 4.
    Fatholahzadeh B, Bahador A, Haghighi Hasanabad M, Bazarjani F, Haghighi F. Comparative screening of Chlamydia trachomatis infection in women population in Tehran, Iran. Iran Red Crescent Med J. 2012;14(5):289-93. [PubMed ID: 22829988]. [PubMed Central ID: PMC3398636].
  • 5.
    Zuppa AA, D'Andrea V, Catenazzi P, Scorrano A, Romagnoli C. Ophthalmia neonatorum: what kind of prophylaxis? J Matern Fetal Neonatal Med. 2011;24(6):769-73. [PubMed ID: 21534852]. https://doi.org/10.3109/14767058.2010.531326.
  • 6.
    Hammerschlag MR. Chlamydial and gonococcal infections in infants and children. Clin Infect Dis. 2011;53 Suppl 3:S99-102. [PubMed ID: 22080275]. https://doi.org/10.1093/cid/cir699.
  • 7.
    Pickering LK, Baker CJ, Long SS, McMillan JA. Red Book: 2006 Report of the Committee on Infectious Diseases. 27th ed. Elk Grove Village; 2006.
  • 8.
    Fathollahzadeh B, Bahador A, Majnooni A, Kamalimanesh B, Moshkani S, Haghighi Hasanabad M. Screening of Chlamydia trachomatis infection in men, is it necessary in Iran? Jundishapur J Microbiol. 2013;6(10). e7782. https://doi.org/10.5812/jjm.7782.
  • 9.
    Azari AA, Barney NP. Conjunctivitis: A systematic review of diagnosis and treatment. JAMA. 2013;310(16):1721-9. [PubMed ID: 24150468]. [PubMed Central ID: PMC4049531]. https://doi.org/10.1001/jama.2013.280318.
  • 10.
    Tarabishy AB, Jeng BH. Bacterial conjunctivitis: A review for internists. Cleve Clin J Med. 2008;75(7):507-12. [PubMed ID: 18646586]. https://doi.org/10.3949/ccjm.75.7.507.
  • 11.
    Teoh DL, Reynolds S. Diagnosis and management of pediatric conjunctivitis. Pediatr Emerg Care. 2003;19(1):48-55. [PubMed ID: 12592117]. https://doi.org/10.1097/00006565-200302000-00014.
  • 12.
    Amini E, Ghasemi M, Daneshjou K. A five-year study in Iran of ophthalmia neonatorum: Prevalence and etiology. Med Sci Monit. 2008;14(2):CR90-6. [PubMed ID: 18227767].
  • 13.
    Mahony JB, Luinstra KE, Tyndall M, Sellors JW, Krepel J, Chernesky M. Multiplex PCR for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Genitourinary specimens. J Clin Microbiol. 1995;33(11):3049-53. [PubMed ID: 8576375]. [PubMed Central ID: PMC228636].
  • 14.
    Chaudhry U, Saluja D. Detection of Neisseria gonorrhoeae by PCR using orf1 gene as target. Sex Transm Infect. 2002;78(1):72. [PubMed ID: 11872872]. [PubMed Central ID: PMC1763686]. https://doi.org/10.1136/sti.78.1.72.
  • 15.
    Justel M, Alexandre I, Martinez P, Sanz I, Rodriguez-Fernandez A, Fernandez I, et al. Vertical transmission of bacterial eye infections, Angola, 2011-2012. Emerg Infect Dis. 2015;21(3):471-3. [PubMed ID: 25695394]. [PubMed Central ID: PMC4344257]. https://doi.org/10.3201/eid2103.140312.
  • 16.
    Azami M, Badfar GH, Mansouri A, Yekta Kooshali MH, Kooti W, Tardeh Z, et al. Prevalence of Chlamydia trachomatis in pregnant Iranian women: A systematic review and meta-analysis. Int J Fertil Steril. 2018;12(3):191-9. [PubMed ID: 29935063]. [PubMed Central ID: PMC6018173]. https://doi.org/10.22074/ijfs.2018.5191.
  • 17.
    Khezerdoust S, Haghollahi F, Roostaie S, Badami N, Naghizadeh MM, Jafarabadi M. [Chlamydia trachomatis infection in pregnant women]. J Reprod Infertil. 2009;10(2):121-9. Persian.
  • 18.
    Rashidi BH, Chamani TL, Haghollahi F, Ramezanzadeh F, Shariat M, Foroushani AR, et al. [Prevalence of Chlamydia trachomatis infection in fertile and infertile women: A molecular and serological study]. J Reprod Infertil. 2009;10(1):32-42. Persian.
  • 19.
    Chamani TL, Jeddi TM, Mosavi JA, Zeraati H, Ghasemi J, Asgari S, et al. [The prevalence of Chlamydia trachomatis infection by molecular analysis of urine samples in women attending OB & GYN clinics in Tehran]. J Reprod Infertil. 2006;7(3):234-42. Persian.
  • 20.
    Matejcek A, Goldman RD. Treatment and prevention of ophthalmia neonatorum. Can Fam Physician. 2013;59(11):1187-90. [PubMed ID: 24235191]. [PubMed Central ID: PMC3828094].
  • 21.
    Pourabbas B, Rezaei Z, Mardaneh J, Shahian M, Alborzi A. Prevalence of Chlamydia trachomatis and Neisseria gonorrhoeae infections among pregnant women and eye colonization of their neonates at birth time, Shiraz, Southern Iran. BMC Infect Dis. 2018;18(1):477. [PubMed ID: 30249196]. [PubMed Central ID: PMC6154405]. https://doi.org/10.1186/s12879-018-3382-4.
  • 22.
    Haghighi Hasanabad M, Bahador A, Mohammadzadeh M, Haghighi F. P3.272 Prevalence of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum in pregnant women of Sabzevar - Iran. Sexually Transmitted Infections. 2013;89(Suppl 1):A233.3-A234. https://doi.org/10.1136/sextrans-2013-051184.0728.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles