Cover image of the article: Detection of Common Respiratory Viruses in Patients with Acute Respiratory Infections Using Multiplex Real-Time RT-PCR

Image Credit:Jundishapur Journal of Microbiology

Detection of Common Respiratory Viruses in Patients with Acute Respiratory Infections Using Multiplex Real-Time RT-PCR

Authors

Niloofar Neisi1, 2, Samaneh AbbasiSamaneh Abbasi ORCID3, Manoochehr MakvandiManoochehr Makvandi ORCID1, 2,*, Shokrollah Salmanzadeh1, Somayeh Biparva4, Rahil Nahidsamiei1, 2, Mehran Varnaseri Ghandali5, Mojtaba RastiMojtaba Rasti ORCID1, 2, Kambiz Ahmadi AngaliKambiz  Ahmadi Angali ORCID6
1Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2Virology Department, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
3Abadan Faculty of Medical Sciences, Abadan, Iran
4Department of General Courses, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
5Deputy of Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
6Biostatistics Department, School of Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
*Corresponding Author: Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 12, issue 11; e96513
Published online:Dec 31, 2019
Article type:Research Article
Received:Jul 21, 2019
Accepted:Dec 19, 2019
How to Cite:Neisi N, Abbasi S, Makvandi M, Salmanzadeh S, Biparva S, et al. Detection of Common Respiratory Viruses in Patients with Acute Respiratory Infections Using Multiplex Real-Time RT-PCR. Jundishapur J Microbiol. 2019;12(11):e96513. doi: https://doi.org/10.5812/jjm.96513

Abstract

Background:

Acute respiratory infection (ARI) is caused by human metapneumovirus (HMPV), respiratory syncytial virus type A and B (RSV-A, RSV-B), human parainfluenza viruses 1, 2, and 3 (HPIV-1, HPIV-2, and HPIV-3), influenza viruses A and B (IfV-A, IfV-B), and human coronaviruses (OC43/HKU1, NL63, 229E) worldwide.

Objectives:

This study was conducted to assess the causative agents of viral ARI among hospitalized adults by real-time PCR.

Methods:

Clinical nasopharyngeal swabs of 112 patients including 55 (49.1%) males and 57 (50.89%) females with ARI were analyzed using multiplex real-time RT-PCR.

Results:

Out of 112 specimens, 61 (54.46%) were positive including 10 (8.9%) for influenza H3N2, one (0.89%) for influenza B, 28 (25%) for RSV-A, 18 (16.07%) for HMPV-A, two (1.78%) for HPIV-1, and three (2.67%) for HPIV-3. Two (1.78%) specimens were positive for two agents, RSV-A/HMPV-A and RSV-A/HPIV-3. The distribution of viral infections was 30 among males (26.78%) and 31 (27.67%) among females (P = 0.862). High frequency of RSV-A infection (25%) and the low frequency of influenza B virus infection (0.89%) were detected among patients. The remaining 51 (45.53%) samples were negative for RSV-B, HMPV-B, IfV-A, HPIV2-4A-4B, and HCoVs (OC43/HKU1, NL63, 229E).

Conclusions:

The role of other viruses such as human adenoviruses rhinovirus/enterovirus (RV/EV), human bocavirus (HBoV), and human parechovirus (HpeV) was not investigated. Multiplex PCR can be used as a rapid test for the diagnosis of viruses causing acute respiratory infection, which results in decreased length of hospitalization.

1. Background

Human metapneumovirus (HMPV), human parainfluenza viruses (HPIV-1, HPIV-2, HPIV-3, and HPIV-4), respiratory syncytial virus type A (RSV-A, RSV-B), influenza A and B viruses and HCoVs (OC43/HKU1, NL63, 229E) are common viruses to cause acute respiratory infection (ARI) worldwide (1). Human metapneumoviruses (HMPVs) are the members of the genus Metapneumovirus and family Pneumoviridae (2). Human metapneumoviruses are causative agents of ARI worldwide (3, 4). Human metapneumovirus is classified into two distinct groups A and B. Based on nucleotide sequence variations, each group is further divided into two subgroups (A1 and A2 in group A and B1 and B2 in group B). In addition, subgroup A2 is further classified into two distinct clades A2a and A2b (5).
Human respiratory syncytial virus (HRSV) types A and B belong to genus Orthopneumovirus and family Pneumoviridae (2). The human respiratory syncytial virus is responsible for bronchiolitis and pneumonia in infants and young children (6, 7). Human respiratory syncytial virus group A is subdivided into 11 genotypes such as GA1-GA7, ON1, SAA1, NA1, and NA and HRSV group B is categorized into genotypes GB1-GB4, SAB1-SAB3, SAB4, URU1, URU2, BA1-BA12, and THB (8, 9). Human parainfluenza virus (HPIV) 1-4 are belong to family Paramyxoviridae HPIV-1 and HPIV-3 belong to genus Respirovirus, and HPIV-2 and HPIV-4 to genus Rubulavirus (10). Human parainfluenza viruses are considered common causes of acute upper and lower respiratory infections among children and adult populations worldwide (11). Parainfluenza viruses (HPIVs) are associated with clinical illnesses such as otitis media, pharyngitis, conjunctivitis, croup, tracheobronchitis, and pneumonia based on genetic and antigenic variations (polymerase, matrix, and nucleoprotein). Human parainfluenza viruses are classified into four types HPIV-1 to HPIV-4, among which HPIV-4 is regarded as less important (11).
There are four types of influenza viruses A, B, C, and D. Human influenza A (H1N1, H3N2) and B viruses can cause seasonal epidemics of diseases including ARI among all age-groups in different regions of the world (12, 13). Four types of HCoVs (HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1) have been associated with a wide range of respiratory illnesses, including the common cold, pneumonia, and bronchiolitis (14). Concerning clinical manifestations of ARI, it is difficult to distinguish between RSV, HMPV, influenza virus (A, B), HPIVs (1-4) and HCoVs (OC43/HKU1, NL63, 229E) infections. Therefore, the primary diagnosis is important to ease the early management and control of ARIs (15).
To date, the standard detection of viral ARI has been achieved through the application of molecular methods. Among them, the real-time PCR technique provides a productive solution for early diagnosis of specific respiratory DNA or RNA viruses (16). To compare real-time PCR with traditional virus culture and immunofluorescence detection methods, real-time PCR has advantages of highly sensitive, rapid, and simultaneous detection of multiple pathogens. Multiplex real-time PCR allows detecting multiple pathogens simultaneously in a single reaction as a cost-effective method (17).

2. Objectives

This study was conducted to evaluate the detection of HMPV, RSV-A, RSV-B, HPIV-1, HPIV-2, HPIV-3, HPIV-4, influenza A and B viruses, and HCoVs (OC43/HKU1, NL63, 229E) in hospitalized patients using multiplex real-time PCR.

3. Methods

3.1. Study Design and Sample Collection

The samples for this cross-sectional study included throat swabs received from hospitals of Ahvaz city, Iran, from September 2015 to December 2016. The target population comprised adults above 40 years of age who referred to the hospitals with clinical ARI. Most patients had symptoms, including congestion, runny nose, coughs, sore throat, body aches, fatigue, fevers over 39°C, chills, difficulty in breathing, dizziness, loss of consciousness, bronchitis, pneumonia, and bronchiolitis. Throat swabs were obtained from patients, put in viral transport medium with ice packs, and transferred to a Virology Department. They were kept at -80°C before RNA extraction.

3.2. RNA Extraction and cDNA Synthesis

Viral RNA was extracted from 112 throat swabs using a high-pure nucleic acid extraction kit (Roche Diagnostic, Manheim, Germany) following the manufacturer’s instructions. The cDNA was synthesized from the extracted RNA samples using a thermos-scientific cDNA synthesis kit following the manufacturer’s instructions.

3.3. Primers and Real-Time PCR

Based on TaqMan technology, real-time PCR was used to detect viruses associated with ARI. Table 1 shows primers and probes used for different viral respiratory infections including influenza A (IfA) H1N1 and H3N2 and influenza B (IfB) viruses, parainfluenza viruses (HPIV-1, HPIV-2, HPIV-3, and HPIV-4), respiratory syncytial viruses (RSVs) A and B, human coronavirus HCoVs (OC43/HKU1, NL63, 229E), and human metapneumoviruses A and B. The PCR reaction mixture contained 2X reaction buffer, 10 µM of each of forward and reverse primers, 2 µL of cDNA template, and D/W water up to 20 µL. All the samples including positive and negative controls were subjected to ABI one-step thermal cycling with the following conditions: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds and annealing at 60°C for 20 seconds.
Table 1.
Primers and Probes Used to Detect Viruses Associated with ARI
Virus (Gene Target)Amplicon Size (bp)Function (5/3 Probe Dye)Oligonucleotide Sequence
RSV polymerase94Forward, L gene, 13907 - 13934 (MH447960.1)AATACAGCCAAATCTAACCAACTTTACA
Reverse,14000 - 13980GCCAAGGAAGCATGCAATAAA
Probe A (FAM/MGB)TGCTAYTGTGCACTAAAGa
Probe B (VIC/MGB) (MK534512.1)CACTATTCCTTACTAAAGATGTC
MPV fusion (F)A = 69Forward F, 3580 - 3602, (KJ627430.1)GCCGTTAGCTTCAGTCAATTCAA
Reverse F, 3627 - 3648TCCAGCATTGTCTGAAAATTGC
Probe A (FAM/MGB)CAACATTTAGAAACCTTCT
B = 74Forward, 3597 - 3619 (KF530178.1)GCTGTCAGCTTCAGTCAATTCAA
Reverse, 3648 - 3670GTTATCCCTGCATTGTCTGAAAACT
Probe B (VIC/MGB)CGCACAACATTTAGGAATCTTCT
P1V1 (L protein)84Forward, L,12605 - 12634 (MH892404.1)ACAGATGAARTTTTCAAGTGCTACTTTAGTa
Reverse, 12660 - 12688GCCTCTTTTAATGCCATATTATCATTAGA
Probe B (FAM/BHQ) 12638 - 12658ATGGTAATAAATCGACTCGCC
PIV2 (L protein)78Forward L, 10773 - 10802 (KY674972.1)TGC ATGTTTTATAACTACTGATCT TGCTAA
Reverse, 10828 - 10850GTTCGAGCAAAATGGATTATGGT
Probe B (VIC/MGB)ACTGTCTTCAATGGAGATAT
PIV3 (matrix)66Forward M, 4172 - 4190TGCTGTTCGATGCCAACAA
Reverse, 4210 - 4237ATTTTATGCTCCTATCTAGTGGAAGACA
Probe B (FAM/MGB)TTGCTCTTGCTCCTCA
PIV4A (nucleoprotein)72Forward 4A, 365 - 389GRGCATTATTATCTCTGCTTTCCTTa
Reverse 4A, 415 - 435 (KF878965.2)GGCTCTGGCAGCAATCATAAG
Probe A (VIC/MGB), 400 - 416CACATCAATGCAGAATC
Forward 4B, 416 - 436GGAGCGTTATTATCTCTGCTTTCTTT
Reverse 4Bm, 397 - 413 (EU627591.1)GGCTCTGGCAGCAATCATAAG
Probe BCACATCAATGCAGAATC
FluA (matrix)111/112H1N1, matrix, 123 - 148. (HE584759.1, H1N1)TCTYATGGAATGGCTAAAGACAAGACa
Forward H3N2, matrix, 137 - 161 (CY202867.1, H3N2)CTYATGGAATGGCTAAAGACAAGACa
Reverse ASCGTCTACGCTGCAGTCCTCa
Probe H1N1 (VIC/MGB)CTGGGCACGGTGAGC
Probe H3N2 (FAM)ACTGGGCACGGTGAG
Flu B (matrix)76Forward B, matrix, 25 - 46, (MK676289.1)CACAATTGCCTACCTGCTTTCA
Reverse B, & 3 - 100CCAACAGTGTAATTTTTCTGCTAGTTCT
Probe B (VIC/MGB)CTTTGCCTTCTCCATCTT
C0V (polymerase)OC43/HKU1 = 96Forward 1, 15068 - 15087, OC43 (MK303625.1) HKU1, MK167038.1TGGTGGCTGGGATGATATGT
Reverse 1, 15141 - 15163GGCATAGCACGATCACACTTAGG
NL63 = 100Forward 2, NL63, (MG428707.1 )TTTATGGTGGTTGGAATAATATGTTG
Reverse 2GGCAAAGCTCTATCACATTTGG
Probe 1A (FAM/MGB)ATAATCCCAACCCATRAGa
229E = 99Forward 3, 13973 - 13992, (KF293666.1)TGGCGGGTGGGATAATATGT
Reverse 3, 14046 - 14071GAGGGCATAGCTCTATCACACTTAGG
Probe 2 (VIC/MGB)ATAGTCCCATCCCATCAA
aR = A or G, K = G or T, Y = C or T, M = A or C, and S = G or C.

3.4. Statistical Analysis

The data were analyzed using SPSS version 21.0 (SPSS Inc., Chicago, IL, USA). The chi-square test was used for the analysis of categorical variables including gender, distribution of viral infections among genders and different age groups. P values of ≤ 0.05 were considered statistically significant.

4. Results

Within 15 months, 112 ARI patients were enrolled in the study. Among them, 55 (49.1%) were males and 57 (50.89%) females. Out of 112 samples, 61 (54.46%) were positive for viruses causing respiratory infections. Among them, there were 30 (26.78%) males and 31 (27.67%) females (P = 0.862). The frequency of viruses among ARI patients was as follows: Influenza A H3N2, n = 9 (8.03%), Influenza B, n = 1 (0.89%), RSVA, n = 28 (25%), MPVA, n = 18 (16.07%), HPIV1, n = 2 (1.78%), and PIV3, n = 3 (2.67%) (Table 2). Two (1.78%) specimens were simultaneously positive for two agents: RSVA/MPVA and RSVA/PIV3. The remaining 51 (45.53%) patients were negative for RSVB, MPVB, IfV H1N1, PIV2-4A-4B, and HCoVs (OC43/HKU1, NL63, 229E). Table 2 shows the distribution of viruses causing respiratory infection among different age groups. High frequency of viruses causing respiratory infections were observed in winter 55/76 (49.1%), while low detection of viruses were observed in autumn 6/36(5.35%) (Figure 1). No virus infection was detected in spring and summer (P = 0.000). Figure 1 illustrates the distribution of positive and negative viruses causing respiratory infection in different seasons.
Table 2.
Distribution of Respiratory Virus Infections in Genders and Age Groupsa
CategoryMaleFemaleP Value
Gender30 (26.78)31 (27.67)0.862
RSV15 (13.39)13 (11.6)0.877
Influenza A25 (4.46)4 (3.57)
Influenza B-1 (0.89)
MPVA8 (7.14)10 (8.92)
HPIV11 (0.89)1 (0.89)
HPIV31 (0.89)2 (1.78)
Total30/55 (25.89)31/57 (27.68)
Age0.521
40 - 495 (4.46)6 (5.35)
50 - 599 (8.03)14 (12.5)
60 - 6912 (10.71)9 (8.03)
> 704 (3.57)2 (1.78)
aValues are expressed as No. (%).
The chart showing a high frequency of viral respiratory infections observed in winter (49.1%), followed by autumn (5.35%); no sample was observed in spring and summer (P = 0.000).
Figure 1.
The chart showing a high frequency of viral respiratory infections observed in winter (49.1%), followed by autumn (5.35%); no sample was observed in spring and summer (P = 0.000).

5. Discussion

To date, viruses causing respiratory infections have been easily detectable in clinical laboratories by multiplex PCR tests. Thus, it will be helpful to acquire epidemiological data to ameliorate patient management. In the present study, 54.46% of patients were positive for viruses causing ARI. Among them, the most frequent viruses were RSV-A (n = 28; 25%) and HMPV-A (n = 17; 15.17%). Previous studies indicated that RSVA was the most frequent etiologic agent in patients with ARI (18-20). Arjeyni et al. reported a high frequency of RSVA (81%) and RSVB (19%) in adult patients with ARI in Iran (21). Birger et al. detected 85/168 (50.6%) human rhinovirus (HRV), 65 (38.7%) coronavirus (CoV), and 18 (10.2%) other viruses (human adenovirus, human metapneumovirus, influenza virus, and parainfluenza virus) in patients with ARI in the USA (22). In our survey, the positivity of other viruses causing respiratory infections was as follows: H3N2 n = 9 (8.03%), Influenza B n = 1, (0.89%), HPIV-1 n = 2 (1.78%), and HPIV-3 n = 3 (2.67%).
Han et al. in South Korea detected high frequency of Rhinovirus (n = 17; 37%), followed by parainfluenza virus (n = 14; 30.4%), respiratory syncytial virus (n = 10; 21.7%), coronavirus (n = 4; 8.7%), human metapneumovirus (n = 3; 6.5%), adenovirus (n = 2; 4.3%), Influenza A virus (n = 1; 2.2%) while no Influenza B virus and human bocavirus were detected in patients with ARI (23). Han et al.’s findings are not consistent with our results. In our survey, 51 (45.53%) ARI patients were negative for RSVA, RSVB, Influenza A2, Influenza B, HPIV1, HPIV3, and HCoVs (OC43/HKU1, NL63, 229E). In this survey, we did not investigate the detection of human adenoviruses rhinovirus/enterovirus (RV/EV), human bocavirus (HBoV), and human parechovirus (HpeV) in patients with ARI.
In Iran, the circulation of Adenovirus (AdV) has been reported in patients with ARI. Pourakbari et al. reported that the frequency of AdV was 3.4% in patients with ARI in Tehran (24). Tabasi et al. described that the rate of the Human Boca virus was 10.7% in children with ARI in Tehran (25). In our study, HCoVs (OC43/HKU1, NL63, 229E) were not detected in ARI patients. Mehdi et al. reported that 5.5% of ARI patients were positive for Coronavirus E229 in Tehran (26). In our study, two (1.78%) patients had two mixed viral infections, RSVA/MPVA and RSVA/PIV3. Many researchers have described the co-infection of viruses causing respiratory tract infections. Yoshida et al. in Japan detected the co-infection of human rhinovirus, human metapneumovirus, and parainfluenza virus-3 in patients with ARI (27). Petrarca et al. in Italy reported the co-infection of HRSV and HRV in patients with lower respiratory tract infection (28). The distribution of viruses causing ARI were 30 (26.78%) in males and 31 (27.67%) in females (P = 0.862).
The influenza vaccination is not mandatory in Iran although high-risk groups need to receive the vaccine. In this experiment, the outbreaks of respiratory virus infections were observed in autumn and winter, which are consistent with other reports (29, 30). No virus causing respiratory infection was detected in spring and summer seasons in this region of Iran. This might be due to that the temperature exceeds 40°C in the spring and remains constant above 48°C during summer. Ribavirin and oseltamivir antiviral therapy can reduce the progression of URI to LRI and mortality rate due to RSV and influenza virus infections (31). Currently, no specific antiviral therapy is available against human rhinoviruses, human coronaviruses, human metapneumovirus, and human bocavirus. Therefore, new treatment and preventive options are required. Sensitive molecular methods like multiplex real-time PCR in clinical practice can help the rapid diagnosis of viruses causing respiratory infection and reduce improper antibiotic therapy (32). Overall, several investigations have described that multiplex real-time PCR as a non-invasive method is faster and more sensitive than other standard methods such as serology and culture (33, 34).

5.1. Conclusions

In conclusion, in this study, RSVA (n = 28, 25%) and MPVA (n = 18, 16.07%) were the most common causes of RI in adults. Considering the low diagnostic cost of clinical presentation and laboratory findings in ARI, multiplex real-time PCR as a rapid diagnostic test can be considered efficient in reducing the length of patients’ stay in hospitals. The results indicated that 49 (43.75%) patients were negative for RSVA, RSVB, Influenza A2, Influenza B, HPIV2, HPIV4, HCoVs (OC43/HKU1, NL63, 229E); however, it requires further investigation to disclose the role of human adenoviruses rhinovirus/enterovirus (RV/EV), human bocavirus (HBoV), and human parechovirus (HpeV).

Acknowledgments

Footnotes

  • Authors' Contribution: Study concept and design: Manoochehr Makvandi; collection of data: Niloofar Neisi, Manoochehr Makvandi, and Rahil Nahid Samiei; anlysis and interpretation of data: Manoochehr Makvandi and Samaneh Abbasi; drafting of manuscript: Samaneh Abbasi, Somayeh Biparva Haghighi, and Manoochehr Makvandi; critical revision of the manuscript for important intellectual concept: Niloofar Neisi and Manoochehr Makvandi; statistical analysis: Kambiz Ahmadi Angali; administrative, technical, and material support: Shokroallah Salmanzadeh and Mehran Varnaseri Ghandali; supervosion: Manoocher Makvandi and Mojtaba Rasti.

  • Conflict of Interests: No conflict of interest is declared by the authors.

  • Ethical Approval: This study with code number ajums.REC.1393.126 was approved by the Ethics Committee of Ahvaz Jundishapur University of Medical Sciences, Iran. All experiments were performed in compliance with relevant laws and institutional guidelines and in accordance with the ethical standards of the Declaration of Helsinki.

  • Funding/Support: This project, with registration number 92105, was financially supported by the Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.

  • Patient Consent: Informed consent was obtained from each patient.

References

  • 1.
    Blot M, Bonniaud-Blot P, Favrolt N, Bonniaud P, Chavanet P, Piroth L. Update on childhood and adult infectious tracheitis. Med Mal Infect. 2017;47(7):443-52. [PubMed ID: 28757125]. https://doi.org/10.1016/j.medmal.2017.06.006.
  • 2.
    Afonso CL, Amarasinghe GK, Banyai K, Bao Y, Basler CF, Bavari S, et al. Taxonomy of the order Mononegavirales: Update 2016. Arch Virol. 2016;161(8):2351-60. https://doi.org/10.1007/s00705-016-2880-1.
  • 3.
    Huck B, Scharf G, Neumann-Haefelin D, Puppe W, Weigl J, Falcone V. Novel human metapneumovirus sublineage. Emerg Infect Dis. 2006;12(1):147-50. [PubMed ID: 16494734]. [PubMed Central ID: PMC3291390]. https://doi.org/10.3201/eid1201.050772.
  • 4.
    Saikusa M, Kawakami C, Nao N, Takeda M, Usuku S, Sasao T, et al. 180-nucleotide duplication in the G gene of human metapneumovirus A2b subgroup strains circulating in Yokohama city, Japan, since 2014. Front Microbiol. 2017;8:402. [PubMed ID: 28352258]. [PubMed Central ID: PMC5348506]. https://doi.org/10.3389/fmicb.2017.00402.
  • 5.
    Falsey AR, Erdman D, Anderson LJ, Walsh EE. Human metapneumovirus infections in young and elderly adults. J Infect Dis. 2003;187(5):785-90. [PubMed ID: 12599052]. https://doi.org/10.1086/367901.
  • 6.
    Nam HH, Ison MG. Respiratory syncytial virus infection in adults. BMJ. 2019;366:l5021. [PubMed ID: 31506273]. https://doi.org/10.1136/bmj.l5021.
  • 7.
    Balmaks R, Ribakova I, Gardovska D, Kazaks A. Molecular epidemiology of human respiratory syncytial virus over three consecutive seasons in Latvia. J Med Virol. 2014;86(11):1971-82. [PubMed ID: 24301088]. https://doi.org/10.1002/jmv.23855.
  • 8.
    Eshaghi A, Duvvuri VR, Lai R, Nadarajah JT, Li A, Patel SN, et al. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: A novel genotype with a 72 nucleotide G gene duplication. PLoS One. 2012;7(3). e32807. [PubMed ID: 22470426]. [PubMed Central ID: PMC3314658]. https://doi.org/10.1371/journal.pone.0032807.
  • 9.
    Khor CS, Sam IC, Hooi PS, Chan YF. Displacement of predominant respiratory syncytial virus genotypes in Malaysia between 1989 and 2011. Infect Genet Evol. 2013;14:357-60. [PubMed ID: 23305888]. https://doi.org/10.1016/j.meegid.2012.12.017.
  • 10.
    Russell E, Ison MG. Parainfluenza virus in the hospitalized adult. Clin Infect Dis. 2017;65(9):1570-6. [PubMed ID: 28591775]. https://doi.org/10.1093/cid/cix528.
  • 11.
    Pan Y, Zhang Y, Shi W, Peng X, Cui S, Zhang D, et al. Human parainfluenza virus infection in severe acute respiratory infection cases in Beijing, 2014-2016: A molecular epidemiological study. Influenza Other Respir Viruses. 2017;11(6):564-8. [PubMed ID: 29054112]. [PubMed Central ID: PMC5705688]. https://doi.org/10.1111/irv.12514.
  • 12.
    Bailey ES, Choi JY, Fieldhouse JK, Borkenhagen LK, Zemke J, Zhang D, et al. The continual threat of influenza virus infections at the human-animal interface: What is new from a one health perspective? Evol Med Public Health. 2018;2018(1):192-8. [PubMed ID: 30210800]. [PubMed Central ID: PMC6128238]. https://doi.org/10.1093/emph/eoy013.
  • 13.
    White SK, Ma W, McDaniel CJ, Gray GC, Lednicky JA. Serologic evidence of exposure to influenza D virus among persons with occupational contact with cattle. J Clin Virol. 2016;81:31-3. [PubMed ID: 27294672]. https://doi.org/10.1016/j.jcv.2016.05.017.
  • 14.
    Matoba Y, Abiko C, Ikeda T, Aoki Y, Suzuki Y, Yahagi K, et al. Detection of the human coronavirus 229E, HKU1, NL63, and OC43 between 2010 and 2013 in Yamagata, Japan. Jpn J Infect Dis. 2015;68(2):138-41. [PubMed ID: 25420656]. https://doi.org/10.7883/yoken.JJID.2014.266.
  • 15.
    Cutrera R, Baraldi E, Indinnimeo L, Miraglia Del Giudice M, Piacentini G, Scaglione F, et al. Management of acute respiratory diseases in the pediatric population: the role of oral corticosteroids. Ital J Pediatr. 2017;43(1):31. [PubMed ID: 28335827]. [PubMed Central ID: PMC5364577]. https://doi.org/10.1186/s13052-017-0348-x.
  • 16.
    Watzinger F, Ebner K, Lion T. Detection and monitoring of virus infections by real-time PCR. Mol Aspects Med. 2006;27(2-3):254-98. [PubMed ID: 16481036]. https://doi.org/10.1016/j.mam.2005.12.001.
  • 17.
    Tsuji S, Iguchi Y, Shibata N, Teramura I, Kitagawa T, Yamanaka H. Real-time multiplex PCR for simultaneous detection of multiple species from environmental DNA: An application on two Japanese medaka species. Sci Rep. 2018;8(1):9138. [PubMed ID: 29904146]. [PubMed Central ID: PMC6002393]. https://doi.org/10.1038/s41598-018-27434-w.
  • 18.
    Belongia EA, King JP, Kieke BA, Pluta J, Al-Hilli A, Meece JK, et al. Clinical features, severity, and incidence of RSV illness during 12 consecutive seasons in a community cohort of adults ≥ 60 years old. Open Forum Infect Dis. 2018;5(12). https://doi.org/10.1093/ofid/ofy316.
  • 19.
    McCracken JP, Prill MM, Arvelo W, Lindblade KA, Lopez MR, Estevez A, et al. Respiratory syncytial virus infection in Guatemala, 2007-2012. J Infect Dis. 2013;208 Suppl 3:S197-206. [PubMed ID: 24265479]. https://doi.org/10.1093/infdis/jit517.
  • 20.
    Widmer K, Zhu Y, Williams JV, Griffin MR, Edwards KM, Talbot HK. Rates of hospitalizations for respiratory syncytial virus, human metapneumovirus, and influenza virus in older adults. J Infect Dis. 2012;206(1):56-62. [PubMed ID: 22529314]. [PubMed Central ID: PMC3415933]. https://doi.org/10.1093/infdis/jis309.
  • 21.
    Arjeyni Y, Faghihloo E, Samimi Rad K, Salimi V, Mahmoudi M, Mokhtari-Azad T. Molecular epidemiology of human respiratory syncytial virus in Iranian >/=60 years old hospitalized patients with acute respiratory symptoms. Arch Iran Med. 2017;20(6):368-75. [PubMed ID: 28646846].
  • 22.
    Birger R, Morita H, Comito D, Filip I, Galanti M, Lane B, et al. Asymptomatic shedding of respiratory virus among an ambulatory population across seasons. mSphere. 2018;3(4). [PubMed ID: 29997120]. [PubMed Central ID: PMC6041500]. https://doi.org/10.1128/mSphere.00249-18.
  • 23.
    Han SB, Shin JA, Kim S, Lee JW, Lee DG, Chung NG, et al. Respiratory viral infections in children and adolescents with hematological malignancies. Mediterr J Hematol Infect Dis. 2019;11(1). https://doi.org/10.4084/mjhid.2019.006.
  • 24.
    Pourakbari B, Mahmoudi S, Movahedi Z, Halimi S, Momeni S, Hosseinpour-Sadeghi R, et al. Viral etiology of acute lower respiratory tract infections in hospitalized young children in a children's referral hospital in Iran. Turk J Pediatr. 2014;56(4):354-9. [PubMed ID: 25818953].
  • 25.
    Tabasi M, Mokhtari-Azad T, Eshraghian MR, Shadab A, Shatizadeh S, Shafiei-Jandaghi NZ, et al. Human bocavirus infections among children less than two years old in Iran during fall and winter 2012-2013. Iran J Microbiol. 2016;8(1):80-4. [PubMed ID: 27092229]. [PubMed Central ID: PMC4833746].
  • 26.
    Madhi A, Ghalyanchilangeroudi A, Soleimani M. Evidence of human coroanvirus (229E), in patients with respiratory infection, Iran, 2015: The first report. Iran J Microbiol. 2016;8(5):316-20. [PubMed ID: 28149491]. [PubMed Central ID: PMC5277600].
  • 27.
    Yoshida LM, Suzuki M, Nguyen HA, Le MN, Dinh Vu T, Yoshino H, et al. Respiratory syncytial virus: Co-infection and paediatric lower respiratory tract infections. Eur Respir J. 2013;42(2):461-9. [PubMed ID: 23645407]. https://doi.org/10.1183/09031936.00101812.
  • 28.
    Petrarca L, Nenna R, Frassanito A, Pierangeli A, Leonardi S, Scagnolari C, et al. Acute bronchiolitis: Influence of viral co-infection in infants hospitalized over 12 consecutive epidemic seasons. J Med Virol. 2018;90(4):631-8. [PubMed ID: 29226974]. https://doi.org/10.1002/jmv.24994.
  • 29.
    Ge X, Han Z, Chen H, Cheng J, Gao M, Sun H. Characterization of acute respiratory infections among 340 infants in Wuxi, Jiangsu province. Ann Transl Med. 2015;3(18):264. [PubMed ID: 26605310]. [PubMed Central ID: PMC4630556]. https://doi.org/10.3978/j.issn.2305-5839.2015.10.23.
  • 30.
    Elliot AJ, Cross KW, Fleming DM. Acute respiratory infections and winter pressures on hospital admissions in England and Wales 1990-2005. J Public Health (Oxf). 2008;30(1):91-8. [PubMed ID: 18258786]. https://doi.org/10.1093/pubmed/fdn003.
  • 31.
    Shah DP, Ghantoji SS, Shah JN, El Taoum KK, Jiang Y, Popat U, et al. Impact of aerosolized ribavirin on mortality in 280 allogeneic haematopoietic stem cell transplant recipients with respiratory syncytial virus infections. J Antimicrob Chemother. 2013;68(8):1872-80. [PubMed ID: 23572228]. [PubMed Central ID: PMC6296322]. https://doi.org/10.1093/jac/dkt111.
  • 32.
    Brittain-Long R, Westin J, Olofsson S, Lindh M, Andersson LM. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: A randomised, controlled trial. BMC Med. 2011;9:44. [PubMed ID: 21521505]. [PubMed Central ID: PMC3108322]. https://doi.org/10.1186/1741-7015-9-44.
  • 33.
    Assih M, Feteke L, Bisseye C, Ouermi D, Djigma F, Karou SD, et al. Molecular diagnosis of the human immunodeficiency, Hepatitis B and C viruses among blood donors in Lome (Togo) by multiplex real time PCR. Pan Afr Med J. 2016;25:242. [PubMed ID: 28293358]. [PubMed Central ID: PMC5337291]. https://doi.org/10.11604/pamj.2016.25.242.7096.
  • 34.
    Yooda AP, Soubeiga ST, Nebie KY, Diarra B, Sawadogo S, Ouattara AK, et al. Impact of multiplex PCR in reducing the risk of residual transfusion-transmitted human immunodeficiency and hepatitis B and C viruses in Burkina Faso. Mediterr J Hematol Infect Dis. 2018;10(1). e2018041. [PubMed ID: 30002797]. [PubMed Central ID: PMC6039083]. https://doi.org/10.4084/MJHID.2018.041.

Copyright

Copyright © 2019, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

3
Jan
2022
Multipathogen Detection in Patients with Respiratory Tract Infection: Identification of Non-respiratory Viruses Using Multiplex Real-time Polymerase Reaction

Multipathogen Detection in Patients with Respiratory Tract Infection: Identification of Non-respiratory Viruses Using Multiplex Real-time Polymerase Reaction

Khosrow Agin,
Zahra Heydarifard,
Leila Ghalichi,
Mahmood Yaghoobi,
Hamidreza Hagh Ranjbar,
Seyed Mohammad Jazayeri
,et al.

Agin K, Heydarifard Z, Ghalichi L, Yaghoobi M, Hagh Ranjbar H, et al. Multipathogen Detection in Patients with Respiratory Tract Infection: Identification of Non-respiratory Viruses Using Multiplex Real-time Polymerase Reaction. Jundishapur J Microbiol. 2021;14(11):e120553. doi: https://doi.org/10.5812/jjm.120553

22
Aug
2016

Prevalence and Seasonal Distribution of Respiratory Viruses During the 2014 - 2015 Season in Istanbul

Safak Goktas,
Mumtaz Cem Sirin

Goktas S, Sirin MC. Prevalence and Seasonal Distribution of Respiratory Viruses During the 2014 - 2015 Season in Istanbul. Jundishapur J Microbiol. 2016;9(9):e39132. doi: https://doi.org/10.5812/jjm.39132

27
Aug
2015

Multiplex SYBR Green Real-Time PCR Assay for Detection of Respiratory Viruses

Mozhdeh Sultani,
Talat Mokhtari Azad,
Mohammadreza Eshragian,
Azadeh Shadab,
Maryam Naseri,
Owrang Eilami
,et al.

Sultani M, Mokhtari Azad T, Eshragian M, Shadab A, Naseri M, et al. Multiplex SYBR Green Real-Time PCR Assay for Detection of Respiratory Viruses. Jundishapur J Microbiol. 2015;8(8):e59885. doi: https://doi.org/10.5812/jjm.19041v2

29
Oct
2013

Detection of Respiratory Syncytial Virus in Hospitalized Children With Acute Lower Respiratory Tract Infections, Using RT PCR in Ahvaz, Iran

Roya Nikfar,
Ahmad Shamsizadeh,
Manoochehr Makvandi,
Arash Khoshghalb

Nikfar R, Shamsizadeh A, Makvandi M, Khoshghalb A. Detection of Respiratory Syncytial Virus in Hospitalized Children With Acute Lower Respiratory Tract Infections, Using RT PCR in Ahvaz, Iran. Arch Pediatr Infect Dis. 2013;1(3):118-21. doi: https://doi.org/10.5812/pedinfect.9987

15
Mar
2016

Detection of Human Metapneumovirus and Respiratory Syncytial Virus by Real-Time Polymerase Chain Reaction Among Hospitalized Young Children in Iran

Masoud Parsania,
Behzad Poopak,
Mohammad Hassan Pouriayevali,
Sama Haghighi,
Aref Amirkhani,
Alireza Nateghian

Parsania M, Poopak B, Pouriayevali MH, Haghighi S, Amirkhani A, et al. Detection of Human Metapneumovirus and Respiratory Syncytial Virus by Real-Time Polymerase Chain Reaction Among Hospitalized Young Children in Iran. Jundishapur J Microbiol. 2016;9(3):e32974. doi: https://doi.org/10.5812/jjm.32974

More by these authors

Niloofar NeisiPubMedScholar
Samaneh AbbasiPubMedScholar
Manoochehr MakvandiPubMedScholar
Shokrollah SalmanzadehPubMedScholar
Somayeh BiparvaPubMedScholar
Rahil NahidsamieiPubMedScholar
Mehran Varnaseri GhandaliPubMedScholar
Mojtaba RastiPubMedScholar
Kambiz Ahmadi AngaliPubMedScholar
Share
Cited by
Metrics