Cover image of the article: Evaluation of Plasmid Mediated Colistin Resistance in Colistin Resistant Gram-negative Bacilli

Image Credit:J Kermanshah Univ Med Sci

Evaluation of Plasmid Mediated Colistin Resistance in Colistin Resistant Gram-negative Bacilli

Authors

Yeliz Tanriverdi CayciYeliz Tanriverdi Cayci ORCID1,*, Kubra Hacieminoglu UlkerKubra Hacieminoglu Ulker ORCID1, Demet Gur VuralDemet Gur Vural ORCID1, Kemal BilginKemal Bilgin ORCID1, Asuman BirinciAsuman Birinci ORCID1
1Department of Medical Microbiology, Ondokuz Mayıs University, Samsun, Turkey
*Corresponding Author: Department of Medical Microbiology, Ondokuz Mayıs University, P. O. Box: 55200, Samsun, Turkey. Email: [email protected]

Journal of Kermanshah University of Medical Sciences:Vol. 26, issue 4; e132351
Published online:Feb 17, 2023
Article type:Research Article
Received:Oct 25, 2022
Accepted:Jan 31, 2023
How to Cite:Tanriverdi Cayci Y, Hacieminoglu Ulker K, Gur Vural D, Bilgin K, Birinci A. Evaluation of Plasmid Mediated Colistin Resistance in Colistin Resistant Gram-negative Bacilli. J Kermanshah Univ Med Sci. 2023;26(4):e132351. doi: https://doi.org/10.5812/jkums-132351

Abstract

Background:

Infections caused by carbapenem-resistant gram-negative bacteria are treated with colonistin as a last resort. However, the increased resistance in recent years is significant for treating multiple drug-resistant infections.

Objectives:

This study aimed to determine the resistance genes mobile colistin resistance (mcr)-1 and mcr-2 in the colistin-resistant isolates, understand the resistance mechanism, and help with treatment.

Methods:

Isolates were identified in the Vitek MS automated system. The antibiotic susceptibility was tested with the Vitek 2 Compact automated system. Enteric gram-negative bacilli isolates were stored at -20°C until the molecular study. DNA extraction of colistin-resistant isolates was performed by boiling method. Then, polymerase chain reaction (PCR) optimization was performed using the specific primers, and mcr-1 and mcr-2 genes were investigated by the multiplex PCR method.

Results:

About 170 enteric gram-negative bacilli isolate were mainly sent from internal medicine (44.7%) and neurology (13.5%) services. According to the species identification, 37.6% of the isolates were Klebsiella pneumonia, and 31.7% were Serratia marcescens. Based on PCR results, mcr-1 and mcr-2 genes were not detected in the isolates.

Conclusions:

Increased colistin resistance and the worrying discovery of mcr genes require urgent precautions, even though the study did not detect mcr-1 and mcr-2. New studies investigating mcr genes in new isolates are needed to understand the mechanism of resistance and identify resistant isolates.

1. Background

Polymyxins are antimicrobials used to treat infections caused by problematic microorganisms such as Pseudomonas aeruginosa, Acinetobacter baumannii, and carbapenemase-producing enteric bacteria that develop multi-drug resistance (1). Polymyxins were first produced in 1947 and used between the 1950s and 1980s. Later, their nephrotoxic side effects were noticed, and they were not preferred for many years, except for the treatment of cystic fibrosis. However, infections caused by resistant bacteria have been increasing in recent years. The failure of treatment with current antibiotics has led to the re-thinkable and preference of polymyxins in the treatment options (2, 3).
Polymyxins are synthesized out of ribosomes by Paenibacillus polymyxa, which chemically consists of five different compounds (polymyxin A - E). Only polymyxin B and polymyxin E (colistin) are used in the clinic (4, 5), and colistin targets the bacterial cell membrane. Colistin, a cationic peptide, binds to the anionic lipopolysaccharides found in the outer membrane of gram-negative bacteria. Displacing divalent cations (Ca2+, Mg2+) that keep lipopolysaccharide molecules together causes the death of bacteria because of the deterioration of the outer membrane and increased permeability (5-7). Besides its antibacterial properties, colistin inhibits endotoxin production by binding to the lipid A portion of lipopolysaccharides. The sensitivity of bacteria to colistin is related to the amount of phospholipid contained in the cell membrane and the level of divalent cations in the medium (5). Colistin is an antibiotic used as a last option in treating gram-negative bacteria with multi-drug and carbapenem resistance in recent years (8). Increased colistin resistance has been observed due to excessive and inappropriate use. The polymyxin resistance mechanism reported until the end of 2015 is chromosomally derived and generally causes mutations in genes encoding specific two-component regulatory systems (9).
However, in 2015, plasmid-mediated colistin resistance and the mobile colistin resistance (mcr) gene mcr-1 were reported for the first time, which caused colistin resistance by adding phosphoethanolamine to the lipid A region of the membrane (10). In July 2016, the plasmid-mediated colistin resistance gene mcr-2 was detected in Belgium’s Escherichia coli isolates, mainly isolated from pigs (11). The mcr-2 is a phosphoethanolamine transferase that probably modifies the limb of lipopolysaccharide. The amino acid identity of mcr-2 is 80.6%, like that of mcr-1 (12). Following the initial findings, many recent studies have identified different variants of mcr-1 and eight new mcr genes (from mcr-3 to mcr-10) (13-23). Detection of plasmid-mediated colistin resistance genes is essential for understanding colistin resistance mechanisms.

2. Objectives

This study aimed to evaluate the presence of plasmid-mediated colistin-resistance genes mcr-1 and mcr-2 in colistin-resistant enteric gram-negative bacilli obtained from various patient samples.

3. Methods

3.1. Bacterial Isolates, Identification, and Susceptibility Testing

Enterobacterales isolated from various samples sent to Ondokuz Mayıs University Faculty of Medicine Microbiology Laboratory in 2016 were included. Vitek MS (bioMeriux, France) was used for bacterial identification, and Vitek 2 Compact (bioMeriux, France) automated system was used to determine colistin resistance. Colistin resistance was confirmed by the broth microdilution method. The isolates were stored at -20°C until molecular analysis.

3.2. Molecular Analysis

DNA of colistin-resistant isolates was extracted by boiling method. The 309 bp fragment of the mcr-1 gene and 567 bp fragment of the mcr-2 gene was amplified with specific primers in all colistin-resistant Enterobacterales isolates to detect the plasmid-mediated colistin resistance genes (Table 1). The used primers were determined after a literature search (14, 15). Multiplex polymerase chain reaction (PCR) was performed under the following conditions: Heat denaturation for 15 minutes at 94°C, 25 cycles of the 30s at 94°C, 90s at 59°C, and 1 min at 72°C, and a final extension step of 10 min at 72°C. The PCR products were applied to a 2% agarose gel. Subsequently, the DNA bands of the isolates were compared with 100 bp DNA markers and examined on the imaging instrument.
Table 1.
Colistin Resistance Genes Primers
GenesPrimers Sequences (5’-3’)Amplicon Size (bp)
mcr-1309
CLR5-FCGGTCAGTCCGTTTGTTC
CLR5-RCTTGGTCGGTCTGTAGGG
mcr-2567
mcr-2-FTGTTGCTTGTGCCGATTGGA
mcr-2-RAGATGGTATTGTTGGTTGCTG

4. Results

The most frequently isolated bacteria were Klebsiella pneumoniae (37.6%) and Serratia marcescens (31.7%) in colistin-resistant 170 Enterobacterales isolates obtained from clinical samples. Table 2 shows the distribution of isolated bacteria by species. The isolates were most frequently isolated from the samples sent from internal medicine (44.7%) and neurology (13.5%) clinics. Table 3 presents the distribution of samples based on clinics, the most frequent of which are blood samples (30%). Table 4 indicates the distribution of the models.
Table 2.
Distribution of Enterobacterales Isolates Based on Species
Bacteria SpeciesNo. (%)
Klebsiella pneumoniae64 (37.6)
Serratia marcescens54 (31.7)
Proteus mirabilis23 (13.5)
Morganella morganii13 (7.6)
Providencia rettgeri10 (6)
Proteus vulgaris2 (1.2)
Escherichia coli2 (1.2)
Providencia stuartii1 (0.6)
Serratia liquefaciens1 (0.6)
Table 3.
Distribution of Clinics
ClinicsNo. (%)
Internal medicine76 (44.7)
Neurology23 (13.5)
Surgical services15 (8.9)
Pediatrics12 (7)
Infection12 (7)
Chest diseases9 (5.3)
Emergency and first aid6 (3.5)
Orthopedics and traumatology6 (3.5)
Urology4 (2.4)
Dermatology4 (2.4)
Otolaryngology1 (0.6)
Gynecology and obstetrics1 (0.6)
Cardiology1 (0.6)
Table 4.
Distribution of Samples
SamplesNo. (%)
Blood51 (30)
Exuda43 (25.3)
Tracheal aspirate 33 (19.4)
Sterile body fluid16 (9.4)
Urine14 (8.2)
Sputum11 (6.5)
Cerebrospinal fluid2 (1.2)
As a result of the molecular process, an isolate forming a band in the 309 bp region was determined to be mcr-1 suspected positive. The PCR gel image of this isolate is given in Figure 1. No band-forming isolate was found in the 567 bp region for the mcr-2 gene. Sequence analysis was applied to the PCR products of the mcr-1 suspected positive strain, and the suspected isolate was determined to be mcr-1 negative at the end of the sequence analysis.
The polymerase chain reaction (PCR) gel image of mobile colistin resistance (<i>mcr</i>)-1 suspected isolate
Figure 1.
The polymerase chain reaction (PCR) gel image of mobile colistin resistance (mcr)-1 suspected isolate

5. Discussion

Colistin is a polymyxin group antibiotic used as a last resort in treating gram-negative bacteria, especially carbapenem-resistant Enterobacterales (5, 24). Colistin has been reported by the World Health Organization (WHO) as one of the ‘highest priority critically important antimicrobials’ (25). The increasing prevalence of CRE worldwide has led to the widespread use of colistin and increased colistin resistance, especially in countries where CRE is endemic, such as Italy and Greece (26-30).
Colistin resistance mechanisms are mostly chromosomal and usually cause mutations in genes encoding specific bicomponent regulatory systems. The mcr-1 gene, which caused plasmid-mediated colistin resistance, was first identified in 2015 in E. coli isolates, and the identification of the mcr-2 gene followed it in 2016 (10, 11). The rapid spread of plasmid-mediated resistance mechanisms between species by horizontal gene transfer makes this resistance feature significant clinically and epidemiologically due to the rapid increase in the frequency of colistin-resistant isolates and the potential of these isolates to spread and cause epidemics (8, 31).
In studies performed with colistin-resistant isolates, most of the isolates were K. pneumonia (8, 32). Similarly, the most frequently isolated species in the present research was Klebsiella spp. (37.6 %) among colistin-resistant Enterobacterales isolates. After the first report for mcr-1, microbiologists have reported the presence of mcr-1 in Enterobacterales isolates from chicken meat, E. coli isolates from clinical samples and animals, and ESBL-producing K. pneumoniae isolated from clinical samples in different countries (33-35).
mcr-1 was first reported by Kurekci et al. in chicken meat in Turkey (36). Subsequently, studies in which mcr-1 was detected in clinical isolates have been reported (37-39).
The number of studies investigating the mcr-2 gene is less than the mcr-1 gene. Xavier et al. reported that they first detected the mcr-2 gene in colistin-resistant E. coli isolates isolated from pigs and cattle in Belgium (11). Liassine et al. detected the mcr-2 gene for the first time in colistin-resistant Enterobacterales isolated from a clinical sample (12). As far as we know, mcr-2 has not yet been detected in Turkey.
In this study, mcr-1 and mcr-2 genes were not detected. Similar to the present research, Sari et al. and Hosbul et al. could not detect mcr-1 and mcr-2 genes in clinical isolates (8, 40).

5.1. Conclusions

Since 2014, the colistin resistance level has increased, and the worrying discovery of mcr genes requires urgent precautions, even though this study did not detect mcr-1 and mcr-2. Our isolates date back to 2016, which is one of the study’s limitations. New studies investigating mcr genes in new isolates are needed to understand the mechanism of resistance and identify resistant isolates.

Footnotes

  • Authors' Contribution: Study concept and design: Y. T. C., D. G. V. and K. B.; study supervision: Y. T. C.; acquisition of data: Y. T. C. and K. H. U.; analysis and interpretation of data: Y. T. C. and K. H. U.; drafting of the manuscript: Y. T. C. and K. H. U.; critical revision of the manuscript for important intellectual content: Y. T. C.; administrative, technical, and material support: Y. T. C., D. G. V., K. B. and A. B.

  • Conflict of Interests: The authors declare no conflict of interests.

  • Data Reproducibility: The analyzed data are available and can be provided by the corresponding author upon request.

  • Funding/Support: This study was supported by the Ondokuz Mayıs University Scientific Project Office. The project number is PYO.TIP.1901.17.001.

References

  • 1.
    Kolistin ÖO. [Endikasyon ve klinik kullanımı]. Ankem Derg. 2012;26(2):12-8. Turkish.
  • 2.
    Kwa A, Kasiakou SK, Tam VH, Falagas ME. Polymyxin B: similarities to and differences from colistin (polymyxin E). Expert Rev Anti Infect Ther. 2007;5(5):811-21. [PubMed ID: 17914915]. https://doi.org/10.1586/14787210.5.5.811.
  • 3.
    Li J, Nation RL, Milne RW, Turnidge JD, Coulthard K. Evaluation of colistin as an agent against multi-resistant Gram-negative bacteria. Int J Antimicrob Agents. 2005;25(1):11-25. [PubMed ID: 15620821]. https://doi.org/10.1016/j.ijantimicag.2004.10.001.
  • 4.
    Storm DR, Rosenthal KS, Swanson PE. Polymyxin and related peptide antibiotics. Annu Rev Biochem. 1977;46:723-63. [PubMed ID: 197881]. https://doi.org/10.1146/annurev.bi.46.070177.003451.
  • 5.
    Falagas ME, Kasiakou SK. Colistin: the revival of polymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clin Infect Dis. 2005;40(9):1333-41. [PubMed ID: 15825037]. https://doi.org/10.1086/429323.
  • 6.
    Li J, Turnidge J, Milne R, Nation RL, Coulthard K. In vitro pharmacodynamic properties of colistin and colistin methanesulfonate against Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Antimicrob Agents Chemother. 2001;45(3):781-5. [PubMed ID: 11181360]. [PubMed Central ID: PMC90373]. https://doi.org/10.1128/AAC.45.3.781-785.2001.
  • 7.
    Lim LM, Ly N, Anderson D, Yang JC, Macander L, Jarkowski A3, et al. Resurgence of colistin: a review of resistance, toxicity, pharmacodynamics, and dosing. Pharmacotherapy. 2010;30(12):1279-91. [PubMed ID: 21114395]. [PubMed Central ID: PMC4410713]. https://doi.org/10.1592/phco.30.12.1279.
  • 8.
    Sari AN, Suzuk S, Karatuna O, Ogunc D, Karakoc AE, Cizmeci Z, et al. [Results of a multicenter study investigating plasmid mediated colistin resistance genes (mcr-1 and mcr-2) in clinical Enterobacteriaceae isolates from Turkey]. Mikrobiyol Bul. 2017;51(3):299-303. [PubMed ID: 28929967]. https://doi.org/10.5578/mb.57515.
  • 9.
    Miller AK, Brannon MK, Stevens L, Johansen HK, Selgrade SE, Miller SI, et al. PhoQ mutations promote lipid A modification and polymyxin resistance of Pseudomonas aeruginosa found in colistin-treated cystic fibrosis patients. Antimicrob Agents Chemother. 2011;55(12):5761-9. [PubMed ID: 21968359]. [PubMed Central ID: PMC3232818]. https://doi.org/10.1128/AAC.05391-11.
  • 10.
    Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161-8. [PubMed ID: 26603172]. https://doi.org/10.1016/S1473-3099(15)00424-7.
  • 11.
    Xavier BB, Lammens C, Ruhal R, Kumar-Singh S, Butaye P, Goossens H, et al. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Euro Surveill. 2016;21(27). [PubMed ID: 27416987]. https://doi.org/10.2807/1560-7917.ES.2016.21.27.30280.
  • 12.
    Liassine N, Assouvie L, Descombes MC, Tendon VD, Kieffer N, Poirel L, et al. Very low prevalence of MCR-1/MCR-2 plasmid-mediated colistin resistance in urinary tract Enterobacteriaceae in Switzerland. Int J Infect Dis. 2016;51:4-5. [PubMed ID: 27544715]. https://doi.org/10.1016/j.ijid.2016.08.008.
  • 13.
    Di Pilato V, Arena F, Tascini C, Cannatelli A, Henrici De Angelis L, Fortunato S, et al. mcr-1.2, a New mcr Variant Carried on a Transferable Plasmid from a Colistin-Resistant KPC Carbapenemase-Producing Klebsiella pneumoniae Strain of Sequence Type 512. Antimicrob Agents Chemother. 2016;60(9):5612-5. [PubMed ID: 27401575]. [PubMed Central ID: PMC4997870]. https://doi.org/10.1128/AAC.01075-16.
  • 14.
    Yang YQ, Li YX, Song T, Yang YX, Jiang W, Zhang AY, et al. Colistin Resistance Gene mcr-1 and Its Variant in Escherichia coli Isolates from Chickens in China. Antimicrob Agents Chemother. 2017;61(5). [PubMed ID: 28242671]. [PubMed Central ID: PMC5404584]. https://doi.org/10.1128/AAC.01204-16.
  • 15.
    Zhao F, Feng Y, Lu X, McNally A, Zong Z. Remarkable Diversity of Escherichia coli Carrying mcr-1 from Hospital Sewage with the Identification of Two New mcr-1 Variants. Front Microbiol. 2017;8:2094. [PubMed ID: 29118748]. [PubMed Central ID: PMC5660977]. https://doi.org/10.3389/fmicb.2017.02094.
  • 16.
    AbuOun M, Stubberfield EJ, Duggett NA, Kirchner M, Dormer L, Nunez-Garcia J, et al. mcr-1 and mcr-2 variant genes identified in Moraxella species isolated from pigs in Great Britain from 2014 to 2015. J Antimicrob Chemother. 2017;72(10):2745-9. [PubMed ID: 29091227]. [PubMed Central ID: PMC5890717]. https://doi.org/10.1093/jac/dkx286.
  • 17.
    Partridge SR, Di Pilato V, Doi Y, Feldgarden M, Haft DH, Klimke W, et al. Proposal for assignment of allele numbers for mobile colistin resistance (mcr) genes. J Antimicrob Chemother. 2018;73(10):2625-30. [PubMed ID: 30053115]. [PubMed Central ID: PMC6148208]. https://doi.org/10.1093/jac/dky262.
  • 18.
    Yin W, Li H, Shen Y, Liu Z, Wang S, Shen Z, et al. Novel Plasmid-Mediated Colistin Resistance Gene mcr-3 in Escherichia coli. mBio. 2017;8(3). [PubMed ID: 28655818]. [PubMed Central ID: PMC5487729]. https://doi.org/10.1128/mBio.00543-17.
  • 19.
    Carattoli A, Villa L, Feudi C, Curcio L, Orsini S, Luppi A, et al. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. Euro Surveill. 2017;22(31). [PubMed ID: 28797329]. [PubMed Central ID: PMC5553062]. https://doi.org/10.2807/1560-7917.ES.2017.22.31.30589.
  • 20.
    Borowiak M, Fischer J, Hammerl JA, Hendriksen RS, Szabo I, Malorny B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi B. J Antimicrob Chemother. 2017;72(12):3317-24. [PubMed ID: 28962028]. https://doi.org/10.1093/jac/dkx327.
  • 21.
    Wang X, Wang Y, Zhou Y, Li J, Yin W, Wang S, et al. Emergence of a novel mobile colistin resistance gene, mcr-8, in NDM-producing Klebsiella pneumoniae. Emerg Microbes Infect. 2018;7(1):122. [PubMed ID: 29970891]. [PubMed Central ID: PMC6030107]. https://doi.org/10.1038/s41426-018-0124-z.
  • 22.
    Carroll LM, Gaballa A, Guldimann C, Sullivan G, Henderson LO, Wiedmann M. Identification of Novel Mobilized Colistin Resistance Gene mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella enterica Serotype Typhimurium Isolate. mBio. 2019;10(3). [PubMed ID: 31064835]. [PubMed Central ID: PMC6509194]. https://doi.org/10.1128/mBio.00853-19.
  • 23.
    Wang C, Feng Y, Liu L, Wei L, Kang M, Zong Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg Microbes Infect. 2020;9(1):508-16. [PubMed ID: 32116151]. [PubMed Central ID: PMC7067168]. https://doi.org/10.1080/22221751.2020.1732231.
  • 24.
    Huang H, Dong N, Shu L, Lu J, Sun Q, Chan EW, et al. Colistin-resistance gene mcr in clinical carbapenem-resistant Enterobacteriaceae strains in China, 2014-2019. Emerg Microbes Infect. 2020;9(1):237-45. [PubMed ID: 31996107]. [PubMed Central ID: PMC7034111]. https://doi.org/10.1080/22221751.2020.1717380.
  • 25.
    World Health Organization. Critically Important Antimicrobials for Human Medicine. Geneva, Switzerland: World Health Organization; 2018.
  • 26.
    Kontopidou F, Giamarellou H, Katerelos P, Maragos A, Kioumis I, Trikka-Graphakos E, et al. Infections caused by carbapenem-resistant Klebsiella pneumoniae among patients in intensive care units in Greece: a multi-centre study on clinical outcome and therapeutic options. Clin Microbiol Infect. 2014;20(2):O117-23. [PubMed ID: 23992130]. https://doi.org/10.1111/1469-0691.12341.
  • 27.
    Kontopidou F, Plachouras D, Papadomichelakis E, Koukos G, Galani I, Poulakou G, et al. Colonization and infection by colistin-resistant Gram-negative bacteria in a cohort of critically ill patients. Clin Microbiol Infect. 2011;17(11):E9-E11. [PubMed ID: 21939468]. https://doi.org/10.1111/j.1469-0691.2011.03649.x.
  • 28.
    Neonakis IK, Samonis G, Messaritakis H, Baritaki S, Georgiladakis A, Maraki S, et al. Resistance status and evolution trends of Klebsiella pneumoniae isolates in a university hospital in Greece: ineffectiveness of carbapenems and increasing resistance to colistin. Chemotherapy. 2010;56(6):448-52. [PubMed ID: 21088396]. https://doi.org/10.1159/000320943.
  • 29.
    Rojas LJ, Salim M, Cober E, Richter SS, Perez F, Salata RA, et al. Colistin Resistance in Carbapenem-Resistant Klebsiella pneumoniae: Laboratory Detection and Impact on Mortality. Clin Infect Dis. 2017;64(6):711-8. [PubMed ID: 27940944]. [PubMed Central ID: PMC5850634]. https://doi.org/10.1093/cid/ciw805.
  • 30.
    Venditti C, Nisii C, D'Arezzo S, Vulcano A, Di Caro A. Letter to the Editor: Surveillance of mcr-1 and mcr-2 genes in Carbapenem-resistant Klebsiella pneumoniae strains from an Italian Hospital. Euro Surveill. 2017;22(35). [PubMed ID: 28877845]. [PubMed Central ID: PMC5587897]. https://doi.org/10.2807/1560-7917.ES.2017.22.35.30604.
  • 31.
    Falagas ME, Rafailidis PI, Ioannidou E, Alexiou VG, Matthaiou DK, Karageorgopoulos DE, et al. Colistin therapy for microbiologically documented multidrug-resistant Gram-negative bacterial infections: a retrospective cohort study of 258 patients. Int J Antimicrob Agents. 2010;35(2):194-9. [PubMed ID: 20006471]. https://doi.org/10.1016/j.ijantimicag.2009.10.005.
  • 32.
    Garcia-Fernandez S, Garcia-Castillo M, Ruiz-Garbajosa P, Morosini MI, Bala Y, Zambardi G, et al. Performance of CHROMID(R) Colistin R agar, a new chromogenic medium for screening of colistin-resistant Enterobacterales. Diagn Microbiol Infect Dis. 2019;93(1):1-4. [PubMed ID: 30097296]. https://doi.org/10.1016/j.diagmicrobio.2018.07.008.
  • 33.
    Kluytmans-van den Bergh MF, Huizinga P, Bonten MJ, Bos M, De Bruyne K, Friedrich AW, et al. Presence of mcr-1-positive Enterobacteriaceae in retail chicken meat but not in humans in the Netherlands since 2009. Euro Surveill. 2016;21(9):30149. [PubMed ID: 26967540]. https://doi.org/10.2807/1560-7917.ES.2016.21.9.30149.
  • 34.
    Falgenhauer L, Waezsada SE, Yao Y, Imirzalioglu C, Kasbohrer A, Roesler U, et al. Colistin resistance gene mcr-1 in extended-spectrum beta-lactamase-producing and carbapenemase-producing Gram-negative bacteria in Germany. Lancet Infect Dis. 2016;16(3):282-3. [PubMed ID: 26774242]. https://doi.org/10.1016/S1473-3099(16)00009-8.
  • 35.
    Caspar Y, Maillet M, Pavese P, Francony G, Brion JP, Mallaret MR, et al. mcr-1 Colistin Resistance in ESBL-Producing Klebsiella pneumoniae, France. Emerg Infect Dis. 2017;23(5):874-6. [PubMed ID: 28418313]. [PubMed Central ID: PMC5403025]. https://doi.org/10.3201/eid2305.161942.
  • 36.
    Kurekci C, Aydin M, Nalbantoglu OU, Gundogdu A. First report of Escherichia coli carrying the mobile colistin resistance gene mcr-1 in Turkey. J Glob Antimicrob Resist. 2018;15:169-70. [PubMed ID: 30267924]. https://doi.org/10.1016/j.jgar.2018.09.013.
  • 37.
    Hazirolan G, Karagoz A. Emergence of carbapenemase-producing and colistin resistant Klebsiella pneumoniae ST101 high-risk clone in Turkey. Acta Microbiol Immunol Hung. 2020;67(4):216-21. [PubMed ID: 33174866]. https://doi.org/10.1556/030.2020.01275.
  • 38.
    Kansak N, Aksaray S, Aslan M, Adaleti R, Gonullu N. Detection of colistin resistance among multidrug-resistant Klebsiella pneumoniae and Escherichia coli clinical isolates in Turkey. Acta Microbiol Immunol Hung. 2021;68(2):99-106. [PubMed ID: 33512332]. https://doi.org/10.1556/030.2021.01328.
  • 39.
    Arabaci C, Dal T, Basyigit T, Genisel N, Durmaz R. Investigation of carbapenemase and mcr-1 genes in carbapenem-resistant Klebsiella pneumoniae isolates. J Infect Dev Ctries. 2019;13(6):504-9. [PubMed ID: 32058985]. https://doi.org/10.3855/jidc.11048.
  • 40.
    Hosbul T, Guney-Kaya K, Guney M, Sakarya S, Bozdogan B, Oryasin E. Carbapenem and Colistin Resistant Klebsiella Pneumoniae ST14 and ST2096 Dominated in Two Hospitals in Turkey. Clin Lab. 2021;67(9). [PubMed ID: 34542958]. https://doi.org/10.7754/Clin.Lab.2021.201226.

Copyright

Copyright © 2023, Journal of Kermanshah University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

1
Jan
2025
Determination of MCR-1 Gene and Antibiotic-Resistant Escherichia coli Isolates from Clinical and Non-clinical Samples

Determination of MCR-1 Gene and Antibiotic-Resistant Escherichia coli Isolates from Clinical and Non-clinical Samples

Hosein Effatpanah,
Nasim Safari,
Abdolmotaleb Seid Mohammadi

Effatpanah H, Safari N, Seid Mohammadi A. Determination of MCR-1 Gene and Antibiotic-Resistant Escherichia coli Isolates from Clinical and Non-clinical Samples. Arch Clin Infect Dis. 2025;20(2):e154587. doi: https://doi.org/10.5812/archcid-154587

12
Jun
2016

Global Dissemination of the mcr-1 gene

Soroor Erfanimanesh,
Ali Hashemi

Erfanimanesh S, Hashemi A. Global Dissemination of the mcr-1 gene. Arch Pediatr Infect Dis. 2016;4(3):e38581. doi: https://doi.org/10.5812/pedinfect.38581

2
Dec
2024
Prevalence of Mobile Colistin Resistance (mcr) Genes in Acinetobacter baumannii: Isolates of Clinical Infection from an Iranian University Hospital

Prevalence of Mobile Colistin Resistance (mcr) Genes in Acinetobacter baumannii: Isolates of Clinical Infection from an Iranian University Hospital

Mehrzad Sadredinamin,
Neda Yousefi Nojookambari,
Iman Pouladi,
Faranak Rezaei,
Somayeh Delfani

Sadredinamin M, Yousefi Nojookambari N, Pouladi I, Rezaei F, Delfani S. Prevalence of Mobile Colistin Resistance (mcr) Genes in Acinetobacter baumannii: Isolates of Clinical Infection from an Iranian University Hospital. Arch Clin Infect Dis. 2024;19(6):e148880. doi: https://doi.org/10.5812/archcid-148880

10
Jul
2024
Genomic Characterization and Antimicrobial Resistance of Four Mcr-1 Escherichia coli Strains Isolated from Human and Environment Sources, Hainan Province, Tropical China

Genomic Characterization and Antimicrobial Resistance of Four Mcr-1 Escherichia coli Strains Isolated from Human and Environment Sources, Hainan Province, Tropical China

Tianjiao Li,
Yi Gao,
Yu Zhang,
Xiaojie Peng,
Haimei Ye,
Wenfang Long

Li T, Gao Y, Zhang Y, Peng X, Ye H, et al. Genomic Characterization and Antimicrobial Resistance of Four Mcr-1 Escherichia coli Strains Isolated from Human and Environment Sources, Hainan Province, Tropical China. Jundishapur J Microbiol. 2024;17(5):e144735. doi: https://doi.org/10.5812/jjm-144735

28
Jan
2018
Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem

Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem

Prasanth Manohar,
Thamaraiselvan Shanthini,
Pandey Ekta,
Mahesan J B,
Kodiveri Muthukaliannan Gothandam,
Bulent Bozdogan
,et al.

Manohar P, Shanthini T, Ekta P, J B M, Muthukaliannan Gothandam K, et al. Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem. Arch Clin Infect Dis. 2018;13(1):e55099. doi: https://doi.org/10.5812/archcid.55099

More by these authors

Yeliz Tanriverdi CayciPubMedScholar
Kubra Hacieminoglu UlkerPubMedScholar
Demet Gur VuralPubMedScholar
Kemal BilginPubMedScholar
Asuman BirinciPubMedScholar
Share
Cited by
Metrics