Logo
Middle East J Rehabil Health Stud

Image Credit:Middle East J Rehabil Health Stud

Detection of Legionella Pneumophila MIP and 16srRNA Genes in Kidney Transplant and Dialysis Wards by Polymerase Chain Reaction

Author(s):
Mehrdad EbrahimiMehrdad Ebrahimi1, Eghlim NematiEghlim Nemati2, Davoud EsmaeiliDavoud EsmaeiliDavoud Esmaeili ORCID3,*
1Department of Microbiology, Science and Research Branch, Islamic Azad University, Tehran, Iran
2Nephrology and Urology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran
3Department of Microbiology and Applied Virology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran


Middle East Journal of Rehabilitation and Health Studies:Vol. 9, issue 2; e123006
Published online:May 18, 2022
Article type:Research Article
Received:Feb 05, 2022
Accepted:Apr 22, 2022
How to Cite:Mehrdad EbrahimiEghlim NematiDavoud EsmaeiliDetection of Legionella Pneumophila MIP and 16srRNA Genes in Kidney Transplant and Dialysis Wards by Polymerase Chain Reaction.Middle East J Rehabil Health Stud.9(2):e123006.https://doi.org/10.5812/mejrh-123006.

Abstract

Background:

Legionella is a fastidious Gram-negative bacterium that is responsible for Legionnaires’ disease. Legionella is a ubiquitous aquatic bacterium, especially in cooling systems. Several studies have investigated Legionella contamination in natural and man-made water resources. Legionella is resistant to chlorine and other disinfectants; thus, it is important to consider it in places where people with immunodeficiency are kept.

Objectives:

The aim of this study was to detect the Legionella pneumophila mip gene in clinical samples, kidney transplants, and dialysis wards by the polymerase chain reaction (PCR) method.

Methods:

In this study, 156 samples were taken from the kidney transplant and dialysis wards. DNA extraction was done. After confirmation of primers, PCR was performed to amplify 16srRNA and mip genes. The PCR product was electrophoresed on agarose gel 1%.

Results:

Among the samples, 23 samples were infected with Legionella (14.7%), of which 7 samples were identified for the mip gene (4.5%) and 16 samples for 16srRNA (10.2%). The confirmation of the presence of these genes was done by sequencing. In serum, tissue, urine, hot water, and cold water samples were positive for the 16srRNA gene (7.5%, 26.66%, 7.14%, 20%, and 6.66%, respectively). Among these samples, 50% of tissue samples, 25% of urine, and 33.33% of hot water were positive for the mip gene.

Conclusions:

The presence of L. pneumophila in aqueous samples of transplant and dialysis wards is important. Therefore, rapid detection of this bacterium or the mip gene by a molecular method can play an important role in reducing infection and transplant rejection.

1. Background

Legionella is a ubiquitous aquatic bacterium like ventilation systems (1, 2). It causes sporadic and epidemic community-acquired pneumonia (CAP) or hospitalization in healthy and immunocompromised individuals (3, 4). Legionella strains cause 2 types of independent clinical diseases, including Legionnaires’ disease and Pontiac fever, which is a self-limiting type (5, 6). According to the Centers for Disease Control (CDC), the prevalence of legionellosis in hospital settings ranges between 25% and 45% (7), and the mortality rate is 30% (8); in some hospital settings and sources, more than 40% have also been reported (9). The prevalence of Legionella in Iran is also 30 - 40%. (10). In Iran, the frequency of this bacterium has been studied in water samples of different parts of the hospital, and the technique used has been the culture and molecular method (10).

Aging, gender, smoking, alcohol use, underlying diseases (such as chronic lung disease, heart and kidney failure, and type 2 diabetes), inadequate antibiotic treatment, immunodeficiency, prolonged hospitalization, and kidney transplant are exacerbating factors (11).

The mip gene encodes a 24-kDa protein of MIP, inhibits phagolysosome integration into macrophage cells, and promotes intracellular survival of the bacterium (10, 12).

Also, the MIP protein can bind to FK506, which may also be effective in graft rejection (12). Various methods are currently being studied to control Legionella in the aquatic environments of the hospital. For this purpose, for the first time in this study, the identification of the mip gene DNA in urine is investigated that can rapidly and easily detect Legionella in the body. Rapid and accurate detection of Legionella pneumophila is very valuable in transplant patients. In this study, kidney transplant and urine samples were used to identify the L. pneumophila mip gene, which is an interesting topic (12).

It should be noted that the BAL sample is also difficult and time-consuming and has a low sensitivity due to its polymerase chain reaction (PCR) inhibitors. Since there is a potential risk of L. pneumophila in transplanted patients with a low immune system, rapid detection of this bacterium or the mip gene by a molecular method can play an important role in preventing and reducing infection (13, 14).

2. Objectives

This study investigated the identification of the L. pneumophila mip gene in clinical and water samples of renal transplantation and dialysis wards of the selected hospital in Tehran by PCR.

3. Methods

3.1. Sampling

In this study, the kidney transplantation and dialysis wards of Baqiyatallah Hospital in Tehran were sampled. Hot and cold water faucets were collected as environmental samples (samples were collected in sterilized containers; we attempted to collect water with sediment). Clinical samples also included urine, a biopsy of kidney tissue, and blood.

3.2. Sample Preparation

The environmental samples were immediately transferred to the laboratory and centrifuged. Ten milliliters of environmental samples were poured into a 50-mL centrifuge tube and centrifuged at 12000 rpm for 15 minutes. After centrifugation, 9 mL of the supernatant of the 50-mL centrifuge tube was transferred into a glass, and 1 mL of the 50-mL centrifuge tube bottom with precipitates was used for DNA extraction.

Serum blood samples were separated by centrifugation at 3200 rpm for 10 minutes. Urine and kidney biopsy specimens were also centrifuged at 12000 rpm, and residual sediment and precipitated tissue were used for DNA extraction.

3.3. PCR

First, sequences for the mip gene and 16srRNA gene of L. pneumophila were obtained from the NCBI site, and then primers were designed for the sequences analyzed by Gene Script online software. The sequences of these primers include F-mip: 5´- CAATGGCTGCAACCGATGCC -3´, R-mip: 5´- CCAATAGGTCCGCCAACGCT -3´ with Tm = 60 oc and Amplicon size 592 bp, F-16srRNA: 5´- AGGGTTGATAGGTTAAGAGC -3´, R-16srRNA: 5´- CCAACAGCTAGTTGACATCG -3´ with Tm=57 oc and Amplicon size 386 bp.

3.4. DNA Extraction

Nucleic acid was extracted according to the CinnaGen kit protocol (CinnaGen Company, Iran). PCR was performed as follows: PCR Master Mix 12.5 µL (1x), forward and reverse primer 1 µL (10 µmol), and template DNA 2 µL (50 ng) In the final volume of 25 µL.

PCR temperature program for mip and 16srRNA genes in Corbett thermocycler was performed as follows: Initial denaturation at 94°C for one minute, Secondary denaturation at 94°C for 30 seconds, Annealing temperature at 58°C for 30 seconds, Extension temperature at 72°C for one minute, Final extension temperature at 72°C for five minutes with 35 cycles., and at the end of the reaction, the PCR product was electrophoresed on agarose gel 1% (15).

3.5. PCR Product Sequencing

Gene sequencing was performed by Fanavaran Gene Company. Sequencing was performed by the ABI Capillary System (Macrogen Research, Seoul, Korea), and the results of the open sequencing were monitored by Chromas software. Their BLASTs were performed in the EMBL/GenBank database (www.NCBI.nlm.NIH.gov/BLAST/).

3.6. PCR Sensitivity and Specificity

PCR sensitivity was performed with different dilutions of the genome. First, gene extraction was performed from the samples and then from this dilution: 10-1 to 10-8 dilutions were prepared as serial dilution. PCR was performed with all dilutions, and the last dilution was PCR.

PCR was performed on the primers of genomes other than L. pneumophila, such as Pseudomonas aeruginosa, Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumonia.

3.7. Statistical Analysis

The final analysis was performed using Excel software, and relevant charts were drawn. Bacterial sequences were also blasted at the NCBI site to confirm the identification of L. pneumophila strains.

4. Results

4.1. Specimen Analysis

In the present study, samples were collected from serum, tissue, urine, and environmental samples, whose specifications are given in Table 1.

Table 1.The Total Percentage of Samples by Location and Type of the Sample a
Serum SampleTissue SampleUrine SampleEnvironmental Sample (Cold Water)Environmental Sample (Hot Water)Total Sample Number
40 (71.4)30 (19.2)56 (16.6)30 (19.2)30 (19.2)156

The Total Percentage of Samples by Location and Type of the Sample a

4.2. PCR Results

The PCR results showed that out of 156 samples, 23 Legionella samples (14.7%) were identified, of which 7 samples were identified for the mip gene (4.5%) and 16 samples for 16srRNA (10.2%).

The PCR results showed the frequency of Legionella based on 16srRNA and mip gene by the type of the sample in 23 Legionella samples. Results of PCR for 16srRNA gene in serum, tissue and urine samples were 7.5%, 26.66%, and 7.14% respectively and in hot water and cold water samples were 20%, and 6.66%, respectively. The result of PCR showed that the fifty percent isolates from the tissue sample, 25% urine, and 33.33% isolates of warm water were positive for the mip gene. The mip gene was not detected in serum and cold water samples.

4.3. Results of Sequencing 16srRNA and mip Genes

The results of mip gene sequencing showed 84% identity to the original genome.

4.4. Results of Sensitivity and Specificity

The dilution minimum that amplified DNA was 10-4, and concentration was determined with an absorption spectrophotometer at 260 nm. The 1 pg/mol concentration was a dilution obtained as PCR sensitivity.

Specificity of PCR indicated that reaction was positive only for L. pneumophila and was negative for DNA of P. aeruginosa, A. baumannii, E. coli, and K. pneumonia.

5. Discussion

Legionella is a cause of acute and deadly pneumonia and can contaminate thousands of meters through aerosols and cause pneumonia (16, 17). The most common cause of death in patients is immunodeficiency (18).

Molecular methods make a reliable and rapid diagnosis of Legionnaires’ disease (19, 20); in this regard, PCR is of great importance (21, 22). Several studies have reported that the sensitivity of this method is 100% (23). According to the fact that the MIP protein leads to intracellular survival of the bacterium, the mip gene was used for PCR. The mip gene was detected in 50% of tissue samples, while it was lower in urine (15%), hot water (33.33%), cold water (0%), and serum (0%).

Since the mip gene is a housekeeping gene, its expression is not affected by stress, disinfectant, or drug; thus, its presence is always with greater pathogenicity and inhibition of phagolysosome integration (12, 13).

In the present study, the 16srRNA gene of L. pneumophila was detected in 6.6% of cold water samples and 20% of hot water samples. The mip gene was not found in cold water but was 33.33% more than in hot water.

Borella et al. in a study of 119 hot water samples from Italian hotels showed that Legionella was present in 85% of the samples (24). In the present study, the prevalence of Legionella contamination in water and clinical samples was 14.7%.

In the study by Eslami et al., in the water supply system of Taleghani Hospital in Tehran, 34% of the samples were positive for L. pneumophila (25).

Moosavian and Dashti conducted a study on 150 water samples isolated from fish breeding pools, swimming pools, and cooling towers in Ahwaz, showing that 7.3% by culture were positive for L. pneumophila (26). In the present study, 20% and 6.66% of samples were positive for Legionella in hot and cold water, respectively. Detection with culture is time-consuming, but molecular methods are rapid.

Mirmohammadlo et al. conducted a study on 150 samples of water from 3 military hospitals in Tehran; Legionella frequency was reported in 37.3% of samples. The disparity in results between Mirmohammadlo et al. and the current study (14.7%) might be due to differences in sample size (27).

The mip gene has been used to diagnose L. pneumophila in clinical and environmental samples by various researchers (13, 28). In 1992, for the first time, L. pneumophila and L. micdadei were identified in bronchoalveolar lavage (BLA) samples by PCR (29). Therefore, among a total of 23 samples containing L. pneumophila, 7 samples (30.43%) were positive for the mip gene.

Hosseinidoost et al. investigated the presence of Legionella at Ekbatan Hospital in Hamadan. In this study, the mip gene and the PCR method were used for detection (30). In 2008, Mirkalantari et al. (31) detected Legionella isolates from BAL samples by culture and PCR in Iran. 4.2% of BAL specimens were positive by culture, and 6 (8.4%) were positive by PCR.

The results of studies with PCR indicated that this technique is suitable for detecting L. pneumophila (31-33).

In 2003, Wilson et al. used quantified PCR to detect the L. pneumophila mip gene (12).

In a study carried out in Iran by Bagheri et al., 50 environmental samples and 50 clinical samples (20 urine samples, 20 serum samples, and 10 tissue samples were analyzed). Fifty-four samples were positive for the mip gene. In total, 34 samples were positive for the 16srRNA gene. Also, from 10 positive clinical samples, 2 urine, 2 kidney tissue and 6 serum samples were infected with Legionella pneumophila. In the present study, 14.4% of samples were positive for the 16srRNA gene. The most positive samples were tissue samples and then hot water samples with a frequency of 26.6% and 20%, respectively. Cold water, serum, and urine had a frequency of 6.6%, 7.14%, and 7.5%, respectively (32).

Among the 16srRNA positive samples, the mip gene was found in 30.43% of samples. There were differences in the frequency of the two studies, which may be due to differences in the number and type of samples studied.

The results showed that molecular methods could rapidly and accurately detect L. pneumophila. In dialysis and transplant wards, due to the presence of patients with immunodeficiency, the presence of Legionella is important for these patients.

In this study, the presence of the mip gene of this bacterium in the urine sample was identified, which is an interesting result.

5.1. Conclusions

It can be concluded that molecular methods play an important role in detecting mip and 16srRNA genes in patients with immunodeficiency, especially in kidney transplantation and dialysis wards.

5.2. Limitations

One of the limitations of the research is the collection of kidney tissue samples, as well as the lack of financial support and high research costs.

Footnotes

References

  • 1.
    Fuchslin HP, Kotzsch S, Keserue HA, Egli T. Rapid and quantitative detection of Legionella pneumophila applying immunomagnetic separation and flow cytometry. Cytometry A. 2010;77(3):264-74. [PubMed ID: 20099248]. https://doi.org/10.1002/cyto.a.20858.
  • 2.
    Allegra S, Grattard F, Girardot F, Riffard S, Pozzetto B, Berthelot P. Longitudinal evaluation of the efficacy of heat treatment procedures against Legionella spp. in hospital water systems by using a flow cytometric assay. Appl Environ Microbiol. 2011;77(4):1268-75. [PubMed ID: 21183641]. [PubMed Central ID: PMC3067238]. https://doi.org/10.1128/AEM.02225-10.
  • 3.
    Fields BS, Benson RF, Besser RE. Legionella and Legionnaires' disease: 25 years of investigation. Clin Microbiol Rev. 2002;15(3):506-26. [PubMed ID: 12097254]. [PubMed Central ID: PMC118082]. https://doi.org/10.1128/CMR.15.3.506-526.2002.
  • 4.
    Carratala J, Garcia-Vidal C. An update on Legionella. Curr Opin Infect Dis. 2010;23(2):152-7. [PubMed ID: 20051846]. https://doi.org/10.1097/QCO.0b013e328336835b.
  • 5.
    Nazarian EJ, Bopp DJ, Saylors A, Limberger RJ, Musser KA. Design and implementation of a protocol for the detection of Legionella in clinical and environmental samples. Diagn Microbiol Infect Dis. 2008;62(2):125-32. [PubMed ID: 18621500]. https://doi.org/10.1016/j.diagmicrobio.2008.05.004.
  • 6.
    Allen JG, Myatt TA, Macintosh DL, Ludwig JF, Minegishi T, Stewart JH, et al. Assessing risk of health care-acquired Legionnaires' disease from environmental sampling: the limits of using a strict percent positivity approach. Am J Infect Control. 2012;40(10):917-21. [PubMed ID: 22633439]. https://doi.org/10.1016/j.ajic.2012.01.013.
  • 7.
    Kim BR, Anderson JE, Mueller SA, Gaines WA, Kendall AM. Literature review--efficacy of various disinfectants against Legionella in water systems. Water Res. 2002;36(18):4433-44. [PubMed ID: 12418646]. https://doi.org/10.1016/s0043-1354(02)00188-4.
  • 8.
    Zhang Z, McCann Deceased C, Hanrahan J, Jencson A, Joyce D, Fyffe S, et al. Legionellacontrol by chlorine dioxide in hospital water systems. Journal - American Water Works Association. 2009;101(5):117-27. https://doi.org/10.1002/j.1551-8833.2009.tb09894.x.
  • 9.
    Tai J, Nabil Benchekroun M, Mustapha Ennaji M, Mekkour M, Cohen N. Nosocomial Legionnaires’ Disease: Risque and Prevention. Frontiers in Science. 2012;2(4):62-75. https://doi.org/10.5923/j.fs.20120204.03.
  • 10.
    Doust R, Mobarez A, Esmailli D. Detection of Legionella in Hospital Water Supply using Mip Based Primers. Journal of Biological Sciences. 2008;8(5):930-4. https://doi.org/10.3923/jbs.2008.930.934.
  • 11.
    Farnham A, Alleyne L, Cimini D, Balter S. Legionnaires' disease incidence and risk factors, New York, New York, USA, 2002-2011. Emerg Infect Dis. 2014;20(11):1795-802. [PubMed ID: 25513657]. [PubMed Central ID: PMC4214295]. https://doi.org/10.3201/eid2011.131872.
  • 12.
    Wilson DA, Yen-Lieberman B, Reischl U, Gordon SM, Procop GW. Detection of Legionella pneumophila by real-time PCR for the mip gene. J Clin Microbiol. 2003;41(7):3327-30. [PubMed ID: 12843084]. [PubMed Central ID: PMC165371]. https://doi.org/10.1128/JCM.41.7.3327-3330.2003.
  • 13.
    Cianciotto NP, Bangsborg JM, Eisenstein BI, Engleberg NC. Identification of mip-like genes in the genus Legionella. Infect Immun. 1990;58(9):2912-8. [PubMed ID: 2387627]. [PubMed Central ID: PMC313586]. https://doi.org/10.1128/iai.58.9.2912-2918.1990.
  • 14.
    Lindsay DS, Abraham WH, Fallon RJ. Detection of mip gene by PCR for diagnosis of Legionnaires' disease. J Clin Microbiol. 1994;32(12):3068-9. [PubMed ID: 7883904]. [PubMed Central ID: PMC264231]. https://doi.org/10.1128/jcm.32.12.3068-3069.1994.
  • 15.
    Innis MA, Gelfand DH, Sninsky JJ, White TJ. PCR protocols: a guide to methods and applications. Academic Press; 2012.
  • 16.
    Declerck P. Biofilms: the environmental playground of Legionella pneumophila. Environ Microbiol. 2010;12(3):557-66. [PubMed ID: 19678829]. https://doi.org/10.1111/j.1462-2920.2009.02025.x.
  • 17.
    Newton HJ, Ang DK, van Driel IR, Hartland EL. Molecular pathogenesis of infections caused by Legionella pneumophila. Clin Microbiol Rev. 2010;23(2):274-98. [PubMed ID: 20375353]. [PubMed Central ID: PMC2863363]. https://doi.org/10.1128/CMR.00052-09.
  • 18.
    Stout JE, Yu VL, Best MG. Ecology of Legionella pneumophila within water distribution systems. Appl Environ Microbiol. 1985;49(1):221-8. [PubMed ID: 3977311]. [PubMed Central ID: PMC238374]. https://doi.org/10.1128/aem.49.1.221-228.1985.
  • 19.
    Darelid J, Lofgren S, Malmvall BE. Control of nosocomial Legionnaires' disease by keeping the circulating hot water temperature above 55 degrees C: experience from a 10-year surveillance programme in a district general hospital. J Hosp Infect. 2002;50(3):213-9. [PubMed ID: 11886198]. https://doi.org/10.1053/jhin.2002.1185.
  • 20.
    Morio F, Corvec S, Caroff N, Le Gallou F, Drugeon H, Reynaud A. Real-time PCR assay for the detection and quantification of Legionella pneumophila in environmental water samples: utility for daily practice. Int J Hyg Environ Health. 2008;211(3-4):403-11. [PubMed ID: 17720622]. https://doi.org/10.1016/j.ijheh.2007.06.002.
  • 21.
    Kahrstrom CT. Bacterial pathogenesis: Legionella makes its mark on histones. Nat Rev Microbiol. 2013;11(6):359. [PubMed ID: 23652326]. https://doi.org/10.1038/nrmicro3034.
  • 22.
    Diederen BMW, de Jong CMA, Kluytmans J, van der Zee A, Peeters MF. Detection and quantification of Legionella pneumophila DNA in serum: case reports and review of the literature. J Med Microbiol. 2006;55(Pt 5):639-42. [PubMed ID: 16585654]. https://doi.org/10.1099/jmm.0.46453-0.
  • 23.
    Bargellini A, Marchesi I, Righi E, Ferrari A, Cencetti S, Borella P, et al. Parameters predictive of Legionella contamination in hot water systems: association with trace elements and heterotrophic plate counts. Water Res. 2011;45(6):2315-21. [PubMed ID: 21316728]. https://doi.org/10.1016/j.watres.2011.01.009.
  • 24.
    Borella P, Montagna MT, Stampi S, Stancanelli G, Romano-Spica V, Triassi M, et al. Legionella contamination in hot water of Italian hotels. Appl Environ Microbiol. 2005;71(10):5805-13. [PubMed ID: 16204491]. [PubMed Central ID: PMC1265926]. https://doi.org/10.1128/AEM.71.10.5805-5813.2005.
  • 25.
    Eslami A, Momayyezi MH, Esmaili D, Joshani GH. [Presence of Legionella Pneumophila and environmental factors affecting its growth, in the water distribution system in Taleghani hospital, Tehran]. Pajoohande. 2012;17(1):32-7. Persian.
  • 26.
    Moosavian M, Dashti A. Isolation and identification of legionellosis agents from fishponds, swimming pools, and cooling towers in Khuzestan province, Iran. Jundishapur J Microbiol. 2011;4(4):209-15.
  • 27.
    Mirmohammadlo A, Ghanizadeh G, Esmaeili D, Sepandi M, Avakh P. Legionelle pneumophila water contamination in three military hospitals of Tehran in 2013. J Kermanshah Univ Med Sci. 2014;18(7).
  • 28.
    Mahbubani MH, Bej AK, Miller R, Haff L, DiCesare J, Atlas RM. Detection of Legionella with polymerase chain reaction and gene probe methods. Mol Cell Probes. 1990;4(3):175-87. [PubMed ID: 1696356]. https://doi.org/10.1016/0890-8508(90)90051-z.
  • 29.
    Jaulhac B, Nowicki M, Bornstein N, Meunier O, Prevost G, Piemont Y, et al. Detection of Legionella spp. in bronchoalveolar lavage fluids by DNA amplification. J Clin Microbiol. 1992;30(4):920-4. [PubMed ID: 1572978]. [PubMed Central ID: PMC265186]. https://doi.org/10.1128/jcm.30.4.920-924.1992.
  • 30.
    Hosseinidoust SR, Mohabati Mobarez A, Hajia M. Molecular detection of legionella pneumoohila within culture-negative samples. Yakhteh Med J. 2003;4(16):219-23.
  • 31.
    Mirkalantari S, Mohabati Mobarez A, Hoseini Dost SR, Aslani J. [Isolation of Legionella from BAL samples of Legionella pneumonia patients, by PCR and Culture Methods]. Pathobiol Res. 2008;10:75-83. Persian.
  • 32.
    Bagheri H, Khaledi A, Ghanizadeh G, Esmaeili D. Efficacy of PCR Analysis of Mip, Doth and Gspd Genes with Culture in Detection of Legionella pneumophila. Iran J Public Health. 2021;50(5):1079-81. [PubMed ID: 34183971]. [PubMed Central ID: PMC8223580]. https://doi.org/10.18502/ijph.v50i5.6130.
  • 33.
    Khaledi A, Bahrami A, Nabizadeh E, Amini Y, Esmaeili D. Prevalence of Legionella Species in Water Resources of Iran: A Systematic Review and Meta-Analysis. Iran J Med Sci. 2018;43(6):571-80. [PubMed ID: 30510333]. [PubMed Central ID: PMC6230937].
comments

Leave a comment here

Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles