Middle East J Rehabil Health Stud

Image Credit:Middle East J Rehabil Health Stud

Molecular Investigation of Enterotoxigenic Staphylococcus aureus Isolates from Restaurant Staff

Author(s):
Mahsa TahaeiMahsa TahaeiMahsa Tahaei ORCID1, Leila FozouniLeila FozouniLeila Fozouni ORCID1,*, Morteza KhademiMorteza KhademiMorteza Khademi ORCID1
1Department of Microbiology, Gorgan Branch, Islamic Azad University, Gorgan, Iran

Middle East Journal of Rehabilitation and Health Studies:Vol. 9, issue 4; e129477
Published online:Sep 05, 2022
Article type:Research Article
Received:Jul 01, 2022
Accepted:Aug 21, 2022
How to Cite:Tahaei M, Fozouni L, Khademi M. Molecular Investigation of Enterotoxigenic Staphylococcus aureus Isolates from Restaurant Staff. Middle East J Rehabil Health Stud. 2022;9(4):e129477. doi: https://doi.org/10.5812/mejrh-129477

Abstract

Background:

Intoxication by heat-resistant Staphylococcus aureus enterotoxins (SEs), particularly SEA and SEE, is one of the most common causes of food poisoning in the world.

Objectives:

This study aimed to identify enterotoxin-encoding genes (see, sed, sec, seb, sea) in S. aureus isolates from different restaurant employees.

Methods:

Ninety-one samples from the hands and noses of employees of several restaurants in the Golestan Province (North of Iran) were examined for detection of S. aureus strains by the phenotypic and microbiological genotyping methods. After determining the susceptibility of the isolates to ten antibiotics by the Kirby-Bauer method, the enterotoxin-producing genes were detected using the polymerase chain reaction method.

Results:

S. aureus was detected in 29 (31.9%) samples. The frequency of S. aureus isolates was highest in waiters (65.5%) with the age range of 34 - 49 years (41.4%) and nasal samples (55.1%). The highest and lowest susceptibility rates were observed against linezolid (100%) and cefoxitin (17.24%). Of 19 methicillin-resistant S. aureus strains, 89.47% were identified as multi-drug resistant and 10.52% as extensively-drug resistant. Of 29 S. aureus isolates, 24.13% were enterotoxigenic, with the highest frequency belonging to SEA (57.1%).

Conclusions:

In this study, we isolated multi-drug resistant, enterotoxigenic S. aureus from different restaurant employees, which can have important public health implications. Therefore, it is recommended to closely monitor the health, sanitation, and hygiene of people involved in food preparation to reduce the spread of bacteria in the food chain.

1. Background

Numerous people suffer from food poisoning every year. Staphylococcus aureus is one of the most common causes of food poisoning, which imposes a significant economic burden. Food poisoning with this bacterium is caused by the enterotoxigenic strains in foodstuff (1). It is characterized by a short incubation period, typically 2 - 4 h. Nausea, vomiting, stomach cramps, retching, and prostration are the predominant symptoms; although diarrhea is also often reported, recovery is typically complete within 1 - 2 days. Staphylococcal intoxication is the second most common cause of food poisoning, which often occurs through eating out during travels, hospitalization, etc. Exposure to staphylococcal enterotoxins (SEs) usually does not result in significant mortality, but it can cause illness in 80% of cases that require medical attention and support (2-4). These enterotoxins are extracellular proteins with a molecular weight of 22 - 29 kDa that are similar in composition and biological activities but differ in antigens. They are classified based on their biological and serological characteristics. More than 95% of SEs that cause food poisoning are among the classic SEs, including SEE, SEC, SED, SEA, and SEB. These toxins are resistant to heat and have unique physical and chemical properties, maintaining their biological activity in food even after heat treatment (5-7) in individuals. It particularly resides in the nasal tract, where is found in 20 - 50% of healthy individuals. It can be isolated from hands, feces, and skin. Therefore, people who work in food preparation, processing, and distribution centers can transmit the bacteria to foodstuff in unsanitary conditions. In addition, such individuals can act as dangerous reservoirs of antibiotic-resistant strains of S. aureus, as the misuse/overuse of antimicrobials in the community has led to a significant rise in the prevalence of antibiotic-resistant, coagulase-positive staphylococci. These bacteria contain antibiotic resistance-encoding genes, which are usually on the mobile genetic elements and allow them to be transmitted horizontally to other pathogenic staphylococci and even other bacteria. The spread of resistance genes might lead to life-threatening illnesses (8, 9). Standard immunological methods can be used for the identification of SEs, but these methods have shortcomings, such as a long preparation process, cross-reactivity, and the possibility of false responses. Polymerase chain reaction (PCR) can detect enterotoxin-producing strains, especially when the enterotoxin genes are not expressed for any reason. This technique has been developed using primers directed against sequences in the S. aureus genome, including the thermostable nuclease and enterotoxins.

2. Objectives

Food handlers are frequently contaminated with SEs; even in small amounts, this can lead to severe food poisoning (10). Therefore, the present study is designed to detect enterotoxins A-E of coagulase-positive staphylococci in restaurant employees.

3. Methods

3.1. Specimen Collection and Bacterial Screening

In this experimental study, samples were taken from 91 employees working at 14 restaurants in the Golestan Province (Iran) during 2020 - 2021. The samples were collected from the anterior nares and hands (palms, wrists, fingers) (5) using a cotton swab soaked in sterile saline and then cultured in mannitol salt agar (Merck, Germany). After incubation at 37°C, mannitol-positive S. aureus strains were identified by examining colony morphology, Gram staining, hemolysis, catalase, coagulation, and DNase tests, as well as genotypic analysis. For PCR genotyping, DNA was extracted by the boiling method. For this purpose, a few colonies of S. aureus were incubated for 12 hours in 1 ml of BHI agar. After centrifuge at 3500g rpm for 10 minutes, the supernatants were completely drained, and 800 microliters of lysing buffer were added to the sample. It was incubated at 65oc for 30 minutes in Ben Mari. Specific primers for S. aureus genomic DNA (forward: 5'-AAAAACACTTGTCGATATGG-3 '; reverse: 5'-GTTTCAATACATCAACTGC-3') were designed. Finally, PCR products were electrophoresed on 1.5% agarose gel and visualized under ultraviolet light. Detection of a fragment sized 950 bp confirmed the presence of S. aureus (Figure 1).
Results of gel electrophoresis of PCR products on 1.5% agarose gel. Lanes 1, 4, 5: positive <i>Staphylococcus aureus</i> isolates
Figure 1.

Results of gel electrophoresis of PCR products on 1.5% agarose gel. Lanes 1, 4, 5: positive Staphylococcus aureus isolates

3.2. Antibiotic Susceptibility Test

Antibiotic susceptibility was assessed by the disk diffusion method (Kirby-Bauer method). For this purpose, a 24-hour bacterial suspension of S. aureus isolates with 0.5 McFarland turbidity was prepared in physiological serum and then uniformly cultured onto Mueller–Hinton agar (Merck, Germany) using a sterile swab. Antibiotic disks included cefoxitin (30 µg), teicoplanin (30 µg), vancomycin (5 µg), ciprofloxacin (10 µg), cefazolin (30 µg), clindamycin (2 µg), azithromycin (15 µg), daptomycin (2 µg), and amikacin (3 µg) were purchased from the Padten Teb Company (Iran), and linezolid (10 µg) were purchased from Mast Co. (UK). The disks were placed on the plates containing S. aureus isolates for 18 - 24 hours at 37°C. Finally, the diameter of the growth inhibition zone around each disk was measured. According to the Clinical and Laboratory Standards Institute document M100-S25 (2015), an inhibition growth zone diameter of ≤ 21 mm around 30 µg cefoxitin disk and ≤ 10 mm about 1 µg oxacillin disk indicate methicillin resistance (11). As described by Magiorakos et al., MDR is defined as non-susceptibility to ≥ 1 antimicrobial agent in ≥ 3 antimicrobial categories, and XDR is defined as non-susceptibility to ≥ 1 (9). The standard strain ATCC29213 was used as the control strain.

3.3. Detection of SEs Production Ability

To detect enterotoxin genes in S. aureus isolates, DNA was extracted using a commercial kit (Sinaclon, Iran) according to the manufacturer's instructions. The quality and quantity of the extracted DNA were evaluated by spectrophotometry and electrophoresis on 1% agarose gel, respectively. The PCR reaction was performed with specific primers (Table 1) in Mastercycler gradient thermocycler (Eppendorf, USA) under the following cycling conditions: initial denaturation at 95°C for 3 minutes, one cycle of denaturation at 95°C for 1 minute, annealing at 56 - 60°C for 1 minute, 35 cycles of extension at 72°C for 7 minutes, and one cycle of final extension at 72°C for 3 minutes. Next, the PCR products were electrophoresed on 1% agarose gel (12).
Table 1.The Sequences of the Primers Used for the Detection of Enterotoxin-Encoding Genes (12)
GeneSequence (5`>3`)Size (bp)Product Size (bp)
seaF: GGTTATCAATGTGCGGGTGG20102
R: CGCCACTTTTTTCTCTTCGG20
sebF: GGTGGTGTAACTGAGC21164
R: CAAATAGTGACGAGTTAGG20
sedF: CCAATAATAGGAGAAAATAAAAG23378
R: ATTGGTATTTTTTTTCGTTC20
seeF: AGGTTTTTTCACAGGTCATCC21209
R: CTTTTTTTTCTTCGGTCAATC21

3.4. Statistical Analysis

Data were presented using frequency charts and numerical indicators. Statistical data analysis was conducted using the chi-square test with the SPSS software (version 18). A P-value of less than 0.05 indicated a statistically significant difference.

4. Results

4.1. Results of Bacteriological Assay

Based on the bacteriological examinations, 29 isolates (31.9%) were identified as S. aureus. The frequency of S. aureus isolates was highest in the waiters (65.5%), whose ages ranged from 34 to 49 years (41.4%), and nasal samples (55.1%) (Table 2).
Table 2.Frequency of Staphylococcus aureus Isolates Based on the Demographic Characteristics of Restaurant Staff a
VariablesChefs/Master ChefsCleaning StaffServersP-Value
Gender0.06
Male9 (31)4 (13.8)6 (20.7)
Female4 (13.8)3 (10.3)3 (10.3)
Age range (y)0.10
18 - 3303 (10.3)7 (24.1)
34 - 491 (3.5)4 (13.8)7 (24.1)
50 - 652 (6.9)3 (10.3)2 (6.9)
Specimen0.03
Nasal1 (3.4)6 (20.7)9 (31)
Wrist01 (3.5)4 (13.8)
In-between the fingers1 (3.5)3 (10.3)4 (13.8)

a Values are expressed as No. (%).

4.2. Results of the Detection of SEs Gene

The presence of 120, 164, 209, and 378 bp fragments indicated the presence of the sea, seb, see and sed genes, respectively. Out of 29 S. aureus isolates, the enterotoxin-encoding genes were found in seven samples (24.1%). The most prevalent enterotoxin was SEA (57.1%), while SED and SEE were present only in two strains (28.6%) and one strain (14.3%), respectively. None of the isolates had the seb gene (Figure 2).
Results of agarose gel electrophoresis of PCR products for detecting enterotoxin encoding genes (A-E).
Figure 2.

Results of agarose gel electrophoresis of PCR products for detecting enterotoxin encoding genes (A-E).

4.3. Data on Drug-Resistance Frequency

The highest and lowest susceptibility rates were against linezolid (100%) and cefoxitin (17.24%), respectively (Table 3). Among 19 methicillin-resistant S. aureus (MRSA) isolates, 17 (89.47%) were multidrug-resistant (MDR), and two strains (10.52%) were extensively drug-resistant (XDR). The MRSA isolates were mainly susceptible to linezolid (100%) and vancomycin (48.27%). Out of the seven isolates containing the enterotoxin-encoding genes, five isolates were MDR.
Table 3.Antibacterial Susceptibility of Staphylococcus aureus Isolates from the Restaurant Staff a
Susceptibility ResultFrequency of S. aureus IsolatesChi-Squared (χ2)
Cefoxitin 9.77 b
R19 (65.51)
S10 (34.48)
Teicoplanin 11.67 b
R6 (20.68)
S14 (48.27)
Vancomycin8.32 b
R5 (17.24)
S14 (48.27)
Cefazolin8.87 b
R5 (17.24)
S15 (51.72)
Azithromycin10.98 b
R7 (24.13)
S14 (48.27)
Amikacin7.87
R11 (37.93)
S12 (41.37)
Daptomycin11.98 b
R6 (20.68)
S14 (48.27)
Ciprofloxacin9.88
R9 (31.03)
S9 (31.03)
Linezolid11.76 b
R0 (0)
S29 (100)
Clindamycin11.02 b
R13 (44.82)
S7 (24.13)
Chi-square (χ2)11.74% b

Abbreviations: R, resistant; S, sensitive..

a Values are expressed as No. (%) unless otherwise indicated.

b Statistically significant difference (P < 0.05).

5. Discussion

Staphylococcal enterotoxin-poisoning usually has a short incubation period, and the symptoms such as nausea, vomiting, muscle, abdominal pain, and diarrhea appear after ingestion. The amount of S. aureus in food is related to several factors, such as the number of bacterial carriers involved in food preparation, sanitation and hygiene of the food factories, and the transportation system (13). In the present study, out of 91 samples taken from restaurant staff, S. aureus was isolated from 29 samples (32%), while 55% of the subjects were nasal carriers of S. aureus. Previous studies in Iran in 2011 (14) and 2018 (15) reported that the frequency of S. aureus carriers was 32% and 26.8% among the hospital staff, respectively. In line with our findings, studies in the Netherlands (16) and Brazil (17) reported that 20-50% and 22.1% of adults were nasal carriers of S. aureus, respectively. In a study in 2010, S. aureus was detected in 57.3% of dairy samples (18). In Germany, a study identified S. aureus in 69 of 135 red meat samples taken during different ham production stages (19). Unlike the mentioned studies, we investigated the frequency of S. aureus isolates in people involved in food production and supply.
Staphylococcal enterotoxins are the main causes of food poisoning that are expressed and transmitted through mobile genetic elements, plasmids, chromosomes, and bacteriophages (7). In this study, among 29 S. aureus isolates, seven isolates contained enterotoxin-producing genes (enterotoxin A-E) except for seb. In addition, none of the isolates had more than one gene. In a previous study, out of 132 S. aureus isolates from dairy products, 90 isolates (68.18%) had one or more enterotoxin-encoding genes (12). In a study in northern Palestine, 37% of S. aureus isolates from dairy products contained enterotoxin-encoding genes, but none had more than one gene (20). The discrepancy in the frequency of enterotoxin-encoding genes in different studies may be due to the differences in the source of bacteria isolation, study location, bacterial detection methods, the number of samples, and the type of samples studied. Moreover, the lower frequency of enterotoxin-producing S. aureus strains in the present study could also be due to the coronavirus disease 2019 pandemic and the restaurant staff's mandatory use of facial masks. In this study, the most and the least prevalent enterotoxin genes were sea and see, respectively, which is in agreement with the results of a study in Poland (20). Similarly, a study in Turkey also reported sea as the most abundant enterotoxigenic gene in foodstuff (21). In the UK, type A is responsible for 52% of outbreaks, type D for 6%, types A and D combined for 19%, and types C and D combined for 9% (22).
In addition to tracking infectious agents and their metabolites, the investigation of bacterial drug resistance always has interested researchers. The prevalence of infections caused by S. aureus is increasing, and the bacterium's ability to acquire and spread multi-drug resistance further highlights the importance of investigating its prevalence in different communities. In recent years, vancomycin has been regarded as a highly effective antibiotic in eliminating Gram-positive bacteria. Still, its overuse has increased the rate of resistance to this antibiotic (23-25). In this regard, 48% of the S. aureus isolates in our study were resistant to vancomycin. Although S. aureus isolates were susceptible to linezolid, the high rate of resistance to commonly-used antibiotics such as teicoplanin, azithromycin, and vancomycin was relatively high. In addition, 89.47% of the isolates were identified as MDR. The frequency of MDR and MRSA isolates in our study was similar to that in other studies (26-28). Still, considering that these isolates were taken from carriers, not patients, detecting 85% of MDR strains, that 29.4% of them are enterotoxigenic, is alarming.

5.1. Conclusions

The results showed that people involved in preparing and supplying food might be a potential source of MDR, enterotoxigenic strains of S. aureus. The relatively high prevalence of enterotoxin-encoding genes, particularly sea and sed, in the isolates indicate the potential risk of food poisoning after eating at the studied restaurants. Further research is needed to screen people involved in food production and supply as main reservoirs of staphylococcal strains.

Footnotes

References

  • 1.
    Aydin A, Sudagidan M, Muratoglu K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol. 2011;148(2):99-106. [PubMed ID: 21652103]. https://doi.org/10.1016/j.ijfoodmicro.2011.05.007.
  • 2.
    Ramatla T, Mphuthi N, Gofaone K, Taioe MO, Thekisoe OM, Syakalima M. Identification of Rodent Species That Infest Poultry Houses in Mafikeng, North West Province, South Africa. Int J Zool. 2019;2019:1-8. https://doi.org/10.1155/2019/1280578.
  • 3.
    Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res. 2003;2(1):63-76. [PubMed ID: 12917803].
  • 4.
    Pu S, Wang F, Ge B. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates from Louisiana retail meats. Foodborne Pathog Dis. 2011;8(2):299-306. [PubMed ID: 21034265]. https://doi.org/10.1089/fpd.2010.0679.
  • 5.
    Agban MN, Ahmed AS. Detection and Identification of Staphylococcus Aureus Enterotoxins in Some Milk Products and their Handlers. Egypt J Med Microbiol. 2013;22(2):101-12. https://doi.org/10.12816/0004946.
  • 6.
    Tadesse HA, Gidey NB, Workelule K, Hailu H, Gidey S, Bsrat A, et al. Antimicrobial Resistance Profile of E. coli Isolated from Raw Cow Milk and Fresh Fruit Juice in Mekelle, Tigray, Ethiopia. Vet Med Int. 2018;2018:8903142. [PubMed ID: 29755727]. [PubMed Central ID: PMC5884018]. https://doi.org/10.1155/2018/8903142.
  • 7.
    Denayer S, Delbrassinne L, Nia Y, Botteldoorn N. Food-Borne Outbreak Investigation and Molecular Typing: High Diversity of Staphylococcus aureus Strains and Importance of Toxin Detection. Toxins (Basel). 2017;9(12). [PubMed ID: 29261162]. [PubMed Central ID: PMC5744127]. https://doi.org/10.3390/toxins9120407.
  • 8.
    Jang S. Multidrug efflux pumps in Staphylococcus aureus and their clinical implications. J Microbiol. 2016;54(1):1-8. [PubMed ID: 26727895]. https://doi.org/10.1007/s12275-016-5159-z.
  • 9.
    Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268-81. [PubMed ID: 21793988]. https://doi.org/10.1111/j.1469-0691.2011.03570.x.
  • 10.
    Cho SY, Chung DR. Infection Prevention Strategy in Hospitals in the Era of Community-Associated Methicillin-Resistant Staphylococcus aureus in the Asia-Pacific Region: A Review. Clin Infect Dis. 2017;64(suppl_2):S82-90. [PubMed ID: 28475795]. https://doi.org/10.1093/cid/cix133.
  • 11.
    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial 324 susceptibility testing; Twenty-Fifth Informational Supplement M100-S25. Wayne, USA: Clinical and Laboratory Standards Institute; 2015. 325 p.
  • 12.
    Chapaval L, Moon DH, Gomes JE, Duarte FR, Tsai SM. Use of Pcr to Detect Classical Enterotoxins Genes (Ent) and Toxic Shock Syndrome Toxin-1 Gene (Tst) in Staphylococcus Aureus Isolated from Crude Milk and Determination of Toxin Productivities of S. Aureus Isolates Harboring These Genes. Arq Inst Biol. 2006;73(2):165-9. https://doi.org/10.1590/1808-1657v73p1652006.
  • 13.
    Fox A, Pichon B, Wilkinson H, Doumith M, Hill RL, McLauchlin J, et al. Detection and molecular characterization of Livestock-Associated MRSA in raw meat on retail sale in North West England. Lett Appl Microbiol. 2017;64(3):239-45. [PubMed ID: 28036110]. https://doi.org/10.1111/lam.12709.
  • 14.
    Zeinali E, Moniri R, Safari M, Mousavi SGA. [Molecular characterization and SCCmec typing in meticillin-resistant Staphylococcus aureus isolated from clinical samples]. Feyz. 2011;14(4):439-46. Persian.
  • 15.
    Hajimohammad A, Fozouni L. Antibacterial Effect of Zinc Oxide Nanoparticles on Mupirocin-Resistant Staphylococcus aureus Isolated From Nasal Carriers. Int J Basic Appl Med. 2018;3(2):78-82. https://doi.org/10.15171/ijbsm.2018.14.
  • 16.
    VandenBergh MF, Yzerman EP, van Belkum A, Boelens HA, Sijmons M, Verbrugh HA. Follow-up of Staphylococcus aureus nasal carriage after 8 years: redefining the persistent carrier state. J Clin Microbiol. 1999;37(10):3133-40. [PubMed ID: 10488166]. [PubMed Central ID: PMC85511]. https://doi.org/10.1128/JCM.37.10.3133-3140.1999.
  • 17.
    Rall VL, Sforcin JM, Augustini VC, Watanabe MT, Fernandes AJ, Rall R, et al. Detection of enterotoxin genes of Staphylococcus SP isolated from nasal cavities and hands of food handlers. Braz J Microbiol. 2010;41(1):59-65. [PubMed ID: 24031464]. [PubMed Central ID: PMC3768627]. https://doi.org/10.1590/S1517-838220100001000011.
  • 18.
    Ertas N, Gonulalan Z, Yildirim Y, Kum E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. Int J Food Microbiol. 2010;142(1-2):74-7. [PubMed ID: 20573416]. https://doi.org/10.1016/j.ijfoodmicro.2010.06.002.
  • 19.
    Atanassova V, Meindl A, Ring C. Prevalence of Staphylococcus aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham--a comparison of classical culturing detection and RFLP-PCR. Int J Food Microbiol. 2001;68(1-2):105-13. [PubMed ID: 11545209]. https://doi.org/10.1016/s0168-1605(01)00479-2.
  • 20.
    Bystron J, Bania J, Zarczynska A, Korzekwa K, Molenda J, Kosek-Paszkowska K. Detection of enterotoxigenic Staphylococcus aureus strains using a commercial Elisa and multiplex-PCR. Bull Vet Inst Pulawy. 2006;50(3):329.
  • 21.
    Najera-Sanchez G, Maldonado-Rodriguez R, Ruiz Olvera P, de la Garza LM. Development of two multiplex polymerase chain reactions for the detection of enterotoxigenic strains of Staphylococcus aureus isolated from foods. J Food Prot. 2003;66(6):1055-62. [PubMed ID: 12801009]. https://doi.org/10.4315/0362-028x-66.6.1055.
  • 22.
    Adams MR, Moss MO, McClure PJ. Food Microbiology. 4th ed. Croydon, UK: CPI Group (UK) Ltd; 2016.
  • 23.
    Chuang YC, Wang JT, Lin HY, Chang SC. Daptomycin versus linezolid for treatment of vancomycin-resistant enterococcal bacteremia: systematic review and meta-analysis. BMC Infect Dis. 2014;14:687. [PubMed ID: 25495779]. [PubMed Central ID: PMC4269951]. https://doi.org/10.1186/s12879-014-0687-9.
  • 24.
    Leonard SN, Cheung CM, Rybak MJ. Activities of ceftobiprole, linezolid, vancomycin, and daptomycin against community-associated and hospital-associated methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2008;52(8):2974-6. [PubMed ID: 18519721]. [PubMed Central ID: PMC2493094]. https://doi.org/10.1128/AAC.00257-08.
  • 25.
    Britt NS, Potter EM, Patel N, Steed ME. Comparison of the Effectiveness and Safety of Linezolid and Daptomycin in Vancomycin-Resistant Enterococcal Bloodstream Infection: A National Cohort Study of Veterans Affairs Patients. Clin Infect Dis. 2015;61(6):871-8. [PubMed ID: 26063715]. [PubMed Central ID: PMC4551009]. https://doi.org/10.1093/cid/civ444.
  • 26.
    Kot B, Wierzchowska K, Piechota M, Gruzewska A. Antimicrobial Resistance Patterns in Methicillin-Resistant Staphylococcus aureus from Patients Hospitalized during 2015-2017 in Hospitals in Poland. Med Princ Pract. 2020;29(1):61-8. [PubMed ID: 31256152]. [PubMed Central ID: PMC7024858]. https://doi.org/10.1159/000501788.
  • 27.
    Kader O, Ebid S, Mostafa N, El Sayed SH, Ghazal A. Detection of community acquired methicillin resistance Staphylococcus aureus among Staphylococcus aureus isolates. Am J Sci. 2011;7(1):1109-17.
  • 28.
    Bitew A. Multi-drug resistance profile of bacteria isolated from blood stream infection at Tikur anbessa specialized hospital, Addis Ababa, Ethiopia. EC Microbiol. 2018;14:119-26.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles