Analysis of the Potential Associations of Two Common Polymorphisms in the ABCC1 Three Prime Untranslated Region With Breast Cancer Susceptibility

Authors

Zahra Salehi1, Arshad Hosseini1,*, Mohammad Najafi2, Hussain Ahmad3, Mohammad Reza Fayazi4
1Department of Medical Biotechnology, School of Allied Medicine, Iran University of Medical Sciences, Tehran, IR Iran
2Department of Biochemistry, School of Medicine, Iran University of Medical Sciences, Tehran, IR Iran
3Department of Medical Biotechnology, School of Advanced Technologies in Medicine, International Campus, Tehran University of Medical Sciences, Tehran, IR Iran
4Department of Medical Biotechnology, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, IR Iran
*Corresponding Author: Corresponding author: Arshad Hosseini, Department of Medical Biotechnology, School of Allied Medicine, Iran University of Medical Sciences, Tehran, IR Iran. Tel: +98-2186704604, Fax: +98-2188622533, E-mail: Email: [email protected]

Thrita Journal of Neuron:Vol. 5, issue 2; e35121
Published online:May 17, 2016
Article type:Brief Report
Received:Nov 29, 2015
Accepted:Jan 11, 2016
How to Cite:Salehi Z, Hosseini A, Najafi M, Ahmad H, Fayazi MR. Analysis of the Potential Associations of Two Common Polymorphisms in the ABCC1 Three Prime Untranslated Region With Breast Cancer Susceptibility. Thrita J Neu. 2016;5(2):e35121. doi: https://doi.org/10.5812/thritaj.35121

Abstract

Background:

Multiple drug resistance in breast cancer patients is one of the most important problems when it comes to the treatment of this disease. In this regard, polymorphisms in DNA sequences play a key role in pharmacokinetics and pharmacodynamics. ABCC1 gene encodes the Multidrug Resistance-Associated Protein 1 (MRP1) protein, which transports many chemotherapy drugs or cellular physiological substances through the cell membrane. As a result, suppression, genetic variations and changes in the expression of this gene may change the drug’s distribution, cytotoxicity and clinical outcomes.

Objectives:

We performed this study to determine the prevalence of different variants of ABCC1 3’ untranslated region (UTR) single nucleotide polymorphisms (SNPs) (rs3743527 and rs129081) in breast cancer patients and healthy controls.

Materials and Methods:

We analyzed the prevalence of different alleles of these polymorphisms on DNA extracted from whole blood of 44 patients with breast cancer and 25 healthy controls. We checked C/G variants of rs129081 by performing nested-polymerase chain reaction (PCR) and allele specific-polymerase chain reaction (AS-PCR). Analysis of C/T alleles in rs3743527 was done using PCR-restriction fragment length polymorphism (RFLP). The results were then confirmed by sequencing.

Results:

No significant correlation was seen in rs3743527 and rs129081 polymorphism’s allelic and genotypic frequencies between the patient group and control individuals (P value > 0.05). The average frequencies of rs129081 G and C alleles was 40 (58%) and 29 (42%), respectively. In our sample the average frequencies of rs3743527 C and T alleles, were 41 (61%) and 28 (39%), respectively. The results of chi-square test showed strong correlations between the incidences of various genotypes in both groups (P value = 0). On average, 27%, 26% and 16% of participants had genotype CC/GG, CT/CG and TT/CC, respectively.

Conclusions:

Taken together, distribution and frequencies of rs129081 and rs3743527 variants in the patient group and control individuals may not correlate with susceptibility to breast cancer; however, more detailed studies are needed to confirm these results.

Highlights

1. Background

Ranking as the second leading cause of death worldwide, breast cancer is a major health concern (1). Over the past decades, survival rate of breast cancer patients has improved due to advancement in breast cancer early diagnosis methods and novel treatment strategies (2). However, patient’s response rate to treatment is not satisfactory as the result of developing drug resistance (3). Multidrug Resistance (MDR) is a major challenge impairing breast cancer successful chemotherapy (1, 4). Drug resistance or ineffective chemotherapy agent administration are two major reasons for unsuccessful treatment in 90% of patients with metastatic cancer (5). Different mechanisms are attributed to the multidrug resistance phenomenon such as reduction in drug-induced apoptosis, induction of drug detoxification mechanisms and active drug efflux from cancer cells by ATP-binding cassette (ABC) transporters (4, 6, 7).
The ABC transporters are membrane proteins belonging to the ABC superfamily. The ABC superfamily is classified into seven distinct subfamilies ranging from ABCA to ABCG, on the basis of sequence homology. The ABC proteins use energy produced from ATP hydrolysis to actively transport different compounds across the cell membrane and are also involved in many diseases and malignancies (4, 8, 9). Multidrug resistance-associated protein 1 (MRP1/ABCC1) was the first member of the ABCC subfamily, which is linked to MDR in many solid tumors. This 190-kDa protein is ubiquitously present in all human tissues and transports a wide spectrum of substrates ranging from xenobiotics such as doxorubicin, taxanes, methotrexate and imatinib to endobiotics including glutathione, leukotrienes and prostaglandins (10-12). Overexpression of this protein was reported in many solid and invasive tumors including breast cancer, ovarian cancer, lung cancer and neuroblastoma. It is responsible for tumor cells resistance to anthracyclines and methotrexate chemotherapy drugs (11). In addition, several independent studies have shown that miRNAs including miR-7, miR-345 (5), miR-1291 (11, 13), miR-133a and miR-326 (14) regulate ABCC1 expression and function by targeting 3’UTR of ABCC1 mRNA, directing drug distribution in cells and cell’s sensitivity to chemotherapeutic agents.
On the other hand, all patients don’t respond similarly to the same drug. In fact, inter-individual hereditary variations in genes encoding proteins, which are involved in drug transport, metabolism and excretion, may account for individual differences in drug response (15). In the human genome project many variations were identified among populations. Single nucleotide polymorphism (SNP) is one of the most abundant type of variations present in > 1% of the population. Depending on the site of SNP (i.e. in the non-coding, coding and regulatory regions of the genes) it may have different outcomes ranging from no change in the quantity and quality of encoded proteins to change in structure and amount of cell protein product (16). There are many single nucleotide polymorphisms (SNPs) identified in ABCC1 gene sequences that are involved in drug resistance and cytotoxicity, disease susceptibility, prognosis and severity (12). The non-synonymous polymorphism G2168A (rs4148356) in exon 17 is strongly associated with reduced MRP1 transport activity leading to increased response to platinum/taxane in patients with advanced ovarian cancer (17). In 2013, Vulsteke et al. reported that variants of G2012T (rs45511401) and T825C (rs246221) non-synonymous polymorphisms correlated with hematological cytotoxicity after receiving neo-adjuvant therapy in breast cancer patients (18). In another study researchers addressed the effects of ABCC1 5’UTR G1666A polymorphism (rs4148330) on hepatocellular cancer outcome in patients. They also found that mutant genotype carriers had better outcome and more disease free survival (19). Besides, 3’UTR T866A (rs212090) polymorphism was another example of non-coding SNP, which was strongly associated with chronic obstructive pulmonary disease (COPD) severity (20) and lung cancer susceptibility (21) in two different studies. In general, genetic variations, inhibition or change in ABCC1 expression may alter drug disposition, cytotoxicity and clinical outcome (11).
C543T and G810C polymorphisms are two prevalent SNPs located at ABCC1 3’UTR with minor allele frequencies (MAF) of T = 0.29 and G = 0.48 per 1000 genomes, respectively. As, only a few independent studies have been undertaken to check the possible associations of these SNPs with lung cancer susceptibility (21), COPD severity (20) and drug’s pharmacokinetics (22, 23), their potential clinical significances are rarely understood.

2. Objectives

Considering the overexpression of MRP1 in breast carcinomas, especially after receiving chemotherapeutic agents (24-26), and contribution of several miRNAs in multidrug resistance phenomenon by targeting ABCC1 mRNA 3’UTR (5, 11, 13, 14), we analyzed if these two ABCC1 3’UTR polymorphisms are connected to breast cancer development.

3. Materials and Methods

3.1. Subjects

This study was a comparative descriptive analysis on 44 patients of Emam Khomeini hospital (Tehran, Iran), diagnosed with grade two breast cancer, receiving chemotherapeutic agents, irrespective of their molecular subtypes and clinicopathological status. Furthermore, 25 non-cancerous individuals, who visited Fardis central laboratory (Alborz, Iran), were used as the control group. Participants of the control group were females older than 35 years with no history of breast cancer. Informed consent was taken from the participants of both groups and this study was approved by ethics committee of Iran University of Medical Sciences (IUMS). The number of cases and controls were determined based on the incidence of breast cancer in Iran and allelic frequencies of each SNP, based on similar studies on Asian populations available on the dbSNP (http://www.ncbi.nlm.nih.gov/SNP/) database.

3.2. DNA Extraction and Genotyping

This study was conducted at the biotechnology research laboratory and molecular and cellular research center of Iran University of Medical Sciences. Genomic DNA was extracted from whole blood samples using the Tiangene genomic DNA extraction kit (Cat number: DP304-02) and stored at -20°C. Nested-PCR was conducted with the outer F and outer R primers to amplify a 523 bp product. Next, one to ten (1:10) diluted 523 bp products were used as templates for Allele Specific-PCR (AS-PCR) to identify C and G alleles of G801C polymorphism. Tiangene master mix (cat number: KT205) was used for the PCR. The primers used for the Nested-PCR and AS-PCR were as follows:
Nested PCR:
Optimum Tm: 65°C; Product size: 523 bp.
Outer F: 5' GCTCCCATCACCTCTAACATCC 3'
Outer R: 5' AGCTGGTTGCTCACTCTCAGTC 3'.
AS-PCR:
Optimum Tm: 61°C; Product size: 339 bp.
Inner F (common primer): 5' TTCATTTCCTTGGGGCTGC 3'.
Inner R C (specific for C allele): 5' AAAAAAGGGAAAGCCTGGAATG 3'.
Inner R G (specific for G allele): 5' AAAAAAGGGAAAGCCTGGAATC 3'.
In the next step, we analyzed C and T alleles of C543T polymorphism using a specific restriction enzyme, StyI (Thermo Scientific cat number: Eco130I), which recognized and cut the 523 bp PCR product in the presence of allele C. During the final step, we checked different variants of C543T and G801C by sending the 523-bp PCR products of ten randomly selected samples for sequencing.

3.3. Statistical Analysis

All data are represented by frequencies, means and percentages. The possible association of participant’s alleles and genotypes with breast cancer was analyzed by the chi-square (X2) test using SPSS 15.1 software and P values of < 0.05 were considered significant. We used an on-line software (http://www.oege.org/software/hardy-weinberg.html) to evaluate if the observed genotypic frequencies correlated with the Hardy-Weinberg equilibrium (HWE) and P values of < 0.01 were considered as violation of HWE.

4. Results

This study was conducted on 44 patients with breast cancer (cases) and 25 healthy individuals (control). The rs3743527 (C543T) allelic frequencies of C and T alleles were 56.8% and 43.2% in cases (C > T) and 64.6% and 35.4% in controls (C > T), respectively. Analysis of rs129081 (G801C) variants showed that allelic frequencies of Guanine (G) were higher than Cytosine (C) in both groups. The allelic frequencies of G allele were 56.8% in cases and 60% in controls. The C allelic frequencies were 43.2% and 40% in cases and controls, respectively. Besides, results of sequencing confirmed the presence of polymorphic variants of rs3743527 (C543T) and rs129081 (G801C) in the DNA samples (Figures 1 and 2). However, using a multiple sequence alignment algorithm, ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/), we found another polymorphic site in ten sequenced samples. Checking the NCBI SNP database (http://www.ncbi.nlm.nih.gov/), we found that this belonged to polymorphic site rs212090 (T866A) in ABCC1 3’UTR. The allelic frequencies of Adenine (A) and Thymine (T) was seven (0.7) and three (0.3) out of ten, respectively (Figure 3).
A, Depicts the presence of C allele at the polymorphic site; B, Depicts the presence of T allele at the polymorphic site.
Figure 1.
A, Depicts the presence of C allele at the polymorphic site; B, Depicts the presence of T allele at the polymorphic site.
A, Depicts presence of G allele at the polymorphic site; B, Depicts the presence of C allele at the polymorphic site.
Figure 2.
A, Depicts presence of G allele at the polymorphic site; B, Depicts the presence of C allele at the polymorphic site.
Results of Multiple Sequence Alignment by ClustalW Algorithm, Representing a New Polymorphic Site, rs212090 (T866A), in ABCC1 3’UTR
Figure 3.
Results of Multiple Sequence Alignment by ClustalW Algorithm, Representing a New Polymorphic Site, rs212090 (T866A), in ABCC1 3’UTR
The observed C543T and G801C genotypic frequencies are shown in Table 1 didn’t deviate from expected frequencies, according to HWE in both control and case groups (P value > 0.01). Distribution of C543T and G801C genotypic frequencies didn’t significantly differ between patient and control groups, according to the X2 test analysis (P value > 0.05). The mean genotypic frequencies of G801C observed in the two groups were 20%, 37% and 43% for CC, GG and CG genotypes, respectively. Regarding the C543T genotypic frequencies, genotype CT with average frequency of 42% and genotype TT with average frequency of 19% were the highest and lowest genotypes seen in cases and controls. Yet, the results of X2 test and sequencing were indicative of a strong correlation between G801C and C543T genotypic distribution in both groups (P value = 0), i.e. on average, 27% of participants carried genotypes GG/CC, 26% genotypes CG/CT and 16% genotypes CC/TT (Figure 4).
Table 1.
Genotypic Frequencies of rs129081 (G801C) and rs3743527 (C543T) in Patients and Controlsa
Nucleotide PolymorphismGenotypesCaseControlP Value
rs129081 (G801C)0.87
CC9 (20.5)5 (20%)
CG20 (45.5)10 (40%)
GG15 (34.1)10 (40%)
Total44 (100)25 (100%)
rs3743527 (C543T)0.63
TT9 (20.5)4 (16.7%)
CT20 (45.5)9 (37.5%)
CC15 (34.1)11 (45.8%)
Total44 (100)24 (100%)
aValues are expressed as No. (%).
Genotypic Correlations of rs3743527 (C543T) and rs129081 (G801C) in the Patients and Controls by Percentage
Figure 4.
Genotypic Correlations of rs3743527 (C543T) and rs129081 (G801C) in the Patients and Controls by Percentage

5. Discussion

In this study the potential associations of ABCC1 3’UTR SNPs (rs3743527 and rs129081) with breast cancer susceptibility were investigated.
According to the results of this study, there were no significant differences in allelic and genotypic distribution of rs3743527 (C543T) and rs129081 (G801C) polymorphisms between breast cancer patients and healthy individuals. Similarly, the study undertaken by Coelho et al. in 2011 found no relationship between clinical and pharmacokinetics of telatinib with variants of rs129081 in patients with a solid tumor (23). Likewise, investigating the potential correlations of rs3743527 variants with lung cancer susceptibility in a Chinese population in 2009 (21) and virological failure in HIV+ Brazilian patients under anti-retroviral therapy in 2013 (22), revealed no significant associations. However, the variants of rs212090 (T866A), detected by sequencing in our study (A > T), significantly correlated with lung cancer susceptibility in a Chinese population (21).
It is important to note that in the present study analysis of these polymorphisms in a larger sample population was not possible due to time and budget limitations. Information of patient’s clinicopathological features was also unavailable, so that study of the potential relationships between patient’s molecular subtypes, response to chemotherapeutic agents and clinical outcomes was not feasible.
Altogether, allelic and genotypic distributions of rs3743527 and rs129081 variants are similar in cases and controls, so neither of them may be associated with the risk of breast cancer. Yet, regarding the potential miRNA/ABCC1 mRNA interactions, the ABCC1 contributions in multidrug resistance phenomenon as well as limitations of the present study, more comprehensive studies are required to investigate the potential relationships of rs3743527 and rs129081 variants in breast cancer patients.

5.1. Conclusion

This study may exclude rs3743527 and rs129081 variants of ABCC1 SNPs from the profile of genetic variations involved in breast cancer development; the profile which could aid scientists in early breast cancer detection and personalized cancer therapy in the near future.

Footnotes

  • Funding/Support:This article was funded by the research committee of Iran University of Medical Sciences (IUMS).

References

  • 1.
    Florea AM, Büsselberg D. Breast cancer and possible mechanisms of therapy resistance. J Local Global Health Sci. 2013;2:1-12.
  • 2.
    Giordano SH, Buzdar AU, Smith TL, Kau SW, Yang Y, Hortobagyi GN. Is breast cancer survival improving? Cancer. 2004;100(1):44-52. [PubMed ID: 14692023]. https://doi.org/10.1002/cncr.11859.
  • 3.
    Valero V, Holmes FA, Walters RS, Theriault RL, Esparza L, Fraschini G, et al. Phase II trial of docetaxel: a new, highly effective antineoplastic agent in the management of patients with anthracycline-resistant metastatic breast cancer. J Clin Oncol. 1995;13(12):2886-94. [PubMed ID: 8523051].
  • 4.
    Wu CP, Calcagno AM, Ambudkar SV. Reversal of ABC drug transporter-mediated multidrug resistance in cancer cells: evaluation of current strategies. Curr Mol Pharmacol. 2008;1(2):93-105. [PubMed ID: 19079736].
  • 5.
    Pogribny IP, Filkowski JN, Tryndyak VP, Golubov A, Shpyleva SI, Kovalchuk O. Alterations of microRNAs and their targets are associated with acquired resistance of MCF-7 breast cancer cells to cisplatin. Int J Cancer. 2010;127(8):1785-94. [PubMed ID: 20099276]. https://doi.org/10.1002/ijc.25191.
  • 6.
    Munoz M, Henderson M, Haber M, Norris M. Role of the MRP1/ABCC1 multidrug transporter protein in cancer. IUBMB Life. 2007;59(12):752-7. [PubMed ID: 18085475]. https://doi.org/10.1080/15216540701736285.
  • 7.
    Wang Z, Li Y, Ahmad A, Azmi AS, Kong D, Banerjee S, et al. Targeting miRNAs involved in cancer stem cell and EMT regulation: An emerging concept in overcoming drug resistance. Drug Resist Updat. 2010;13(4-5):109-18. [PubMed ID: 20692200]. https://doi.org/10.1016/j.drup.2010.07.001.
  • 8.
    Cole SP. Targeting multidrug resistance protein 1 (MRP1, ABCC1): past, present, and future. Annu Rev Pharmacol Toxicol. 2014;54:95-117. [PubMed ID: 24050699]. https://doi.org/10.1146/annurev-pharmtox-011613-135959.
  • 9.
    Gradhand U, Kim RB. Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2). Drug Metab Rev. 2008;40(2):317-54. [PubMed ID: 18464048]. https://doi.org/10.1080/03602530801952617.
  • 10.
    Cho S, Lu M, He X, Ee PL, Bhat U, Schneider E, et al. Notch1 regulates the expression of the multidrug resistance gene ABCC1/MRP1 in cultured cancer cells. Proc Natl Acad Sci U S A. 2011;108(51):20778-83. [PubMed ID: 22143792]. https://doi.org/10.1073/pnas.1019452108.
  • 11.
    Pan YZ, Zhou A, Hu Z, Yu AM. Small nucleolar RNA-derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCC1. Drug Metab Dispos. 2013;41(10):1744-51. [PubMed ID: 23686318]. https://doi.org/10.1124/dmd.113.052092.
  • 12.
    Yin J, Zhang J. Multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphism: from discovery to clinical application. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2011;36(10):927-38. [PubMed ID: 22086004]. https://doi.org/10.3969/j.issn.1672-7347.2011.10.002.
  • 13.
    Pan YZ, Yu A. A novel small nucleolar RNA-derived microRNA-1291 targets multidrug resistance-associated protein 1 (MRP1/ABCC1). FASEB J. 2011;25:1015.
  • 14.
    Ma J, Wang T, Guo R, Yang X, Yin J, Yu J, et al. Involvement of miR-133a and miR-326 in ADM resistance of HepG2 through modulating expression of ABCC1. J Drug Target. 2015;23(6):519-24. [PubMed ID: 25714665]. https://doi.org/10.3109/1061186X.2015.1015536.
  • 15.
    Monzo M, Navarro A, Ferrer G, Artells R. Pharmacogenomics: a tool for improving cancer chemotherapy. Clin Transl Oncol. 2008;10(10):628-37. [PubMed ID: 18940743].
  • 16.
    Kim S, Misra A. SNP genotyping: technologies and biomedical applications. Annu Rev Biomed Eng. 2007;9:289-320. [PubMed ID: 17391067]. https://doi.org/10.1146/annurev.bioeng.9.060906.152037.
  • 17.
    Marsh S, Paul J, King CR, Gifford G, McLeod HL, Brown R. Pharmacogenetic assessment of toxicity and outcome after platinum plus taxane chemotherapy in ovarian cancer: the Scottish Randomised Trial in Ovarian Cancer. J Clin Oncol. 2007;25(29):4528-35. [PubMed ID: 17925548]. https://doi.org/10.1200/JCO.2006.10.4752.
  • 18.
    Vulsteke C, Lambrechts D, Dieudonne A, Hatse S, Brouwers B, van Brussel T, et al. Genetic variability in the multidrug resistance associated protein-1 (ABCC1/MRP1) predicts hematological toxicity in breast cancer patients receiving (neo-)adjuvant chemotherapy with 5-fluorouracil, epirubicin and cyclophosphamide (FEC). Ann Oncol. 2013;24(6):1513-25. [PubMed ID: 23396606]. https://doi.org/10.1093/annonc/mdt008.
  • 19.
    Zhao J, Yu BY, Wang DY, Yang JE. Promoter polymorphism of MRP1 associated with reduced survival in hepatocellular carcinoma. World J Gastroenterol. 2010;16(48):6104-10. [PubMed ID: 21182225].
  • 20.
    Budulac SE, Postma DS, Hiemstra PS, Lapperre TS, Snoeck-Stroband JB, Timens W, editors. Multidrug Resistance-Associated Protein-1 (MRP1) Genetic Variants and Severity of Chronic Obstructive Pulmonary Disease (COPD). American Journal of Respiratory And Critical Care Medicine. 2009; New York. American Thoracic Society International Conference;
  • 21.
    Wang H, Jin G, Wang H, Liu G, Qian J, Jin L, et al. Genetic susceptibility of lung cancer associated with common variants in the 3' untranslated regions of the adenosine triphosphate-binding cassette B1 (ABCB1) and ABCC1 candidate transporter genes for carcinogen export. Cancer. 2009;115(3):595-607. [PubMed ID: 19107762]. https://doi.org/10.1002/cncr.24042.
  • 22.
    Steeghs N, Gelderblom H, Wessels J, Eskens FA, de Bont N, Nortier JW, et al. Pharmacogenetics of telatinib, a VEGFR-2 and VEGFR-3 tyrosine kinase inhibitor, used in patients with solid tumors. Invest New Drugs. 2011;29(1):137-43. [PubMed ID: 19924384]. https://doi.org/10.1007/s10637-009-9347-0.
  • 23.
    Coelho AV, Silva SP, de Alencar LC, Stocco G, Crovella S, Brandao LA, et al. ABCB1 and ABCC1 variants associated with virological failure of first-line protease inhibitors antiretroviral regimens in Northeast Brazil patients. J Clin Pharmacol. 2013;53(12):1286-93. [PubMed ID: 23996099]. https://doi.org/10.1002/jcph.165.
  • 24.
    Abaan OD, Mutlu PK, Baran Y, Atalay C, Gunduz U. Multidrug resistance mediated by MRP1 gene overexpression in breast cancer patients. Cancer Invest. 2009;27(2):201-5. [PubMed ID: 19235593]. https://doi.org/10.1080/07357900802173562.
  • 25.
    Filipits M, Malayeri R, Suchomel RW, Pohl G, Stranzl T, Dekan G, et al. Expression of the multidrug resistance protein (MRP1) in breast cancer. Anticancer Res. 1999;19(6B):5043-9. [PubMed ID: 10697508].
  • 26.
    Atalay C, Deliloglu Gurhan I, Irkkan C, Gunduz U. Multidrug resistance in locally advanced breast cancer. Tumour Biol. 2006;27(6):309-18. [PubMed ID: 17033200]. https://doi.org/10.1159/000096086.

Copyright

Copyright © 2016, Thrita. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

20
Nov
2009

Investigation of C3435T Polymorphism in MDR1 Gene of Breast Cancer Patients

Mohsen Taheri,
Frouzandeh Mahjoubi,
Ramesh Omranipour,
Frouzandeh Fereidouni

Taheri M, Mahjoubi F, Omranipour R, Fereidouni F. Investigation of C3435T Polymorphism in MDR1 Gene of Breast Cancer Patients. Zahedan J Res Med Sci. 2009;11(3):e94384. doi:

15
Aug
2021
An Interdependence between Estrogen Receptor 1 Gene Polymorphisms and Susceptibility to Breast Cancer

An Interdependence between Estrogen Receptor 1 Gene Polymorphisms and Susceptibility to Breast Cancer

Maryam Saneipour,
Abdolkarim Sheikhi,
Abbas Moridnia

Saneipour M, Sheikhi A, Moridnia A. An Interdependence between Estrogen Receptor 1 Gene Polymorphisms and Susceptibility to Breast Cancer. J Adv Immunopharmacol. 2021;1(3):e117221. doi: https://doi.org/10.5812/tms.117221

31
Oct
2017
ER and PR Positive, or Her2 Negative Tumor of rs2363956 and rs3803662 GWAS in Breast Cancer

ER and PR Positive, or Her2 Negative Tumor of rs2363956 and rs3803662 GWAS in Breast Cancer

Ashkan Alborzi,
Massoud Houshmand,
Mojgan Hosseini

Alborzi A, Houshmand M, Hosseini M. ER and PR Positive, or Her2 Negative Tumor of rs2363956 and rs3803662 GWAS in Breast Cancer. Gene Cell Tissue. 2017;4(4):e63407. doi: https://doi.org/10.5812/gct.63407

11
Aug
2018
Association of Genetic Variations in XRCC1 and ERCC1 Genes with Sporadic Breast Cancer

Association of Genetic Variations in XRCC1 and ERCC1 Genes with Sporadic Breast Cancer

Saeid Ghorbian,
Mansooreh Nargesian,
Sasan Talaneh,
Omid Asnaashari,
Rasol Sharifi

Ghorbian S, Nargesian M, Talaneh S, Asnaashari O, Sharifi R. Association of Genetic Variations in XRCC1 and ERCC1 Genes with Sporadic Breast Cancer. Gene Cell Tissue. 2018;5(2):e80166. doi: https://doi.org/10.5812/gct.80166

25
Feb
2017

The Effect of Polymorphisms on the Ala 119 Ser Gene Cytochrome P450 1B1*2 on the Susceptibility of Iranian Women to Develop Breast Cancer

Fereshteh Moheb Afzali,
Zahra Tahmasebi Fard,
Mohammad Esmaeil Akbari

Moheb Afzali F, Tahmasebi Fard Z, Akbari ME. The Effect of Polymorphisms on the Ala 119 Ser Gene Cytochrome P450 1B1*2 on the Susceptibility of Iranian Women to Develop Breast Cancer. Int J Cancer Manag. 2017;10(3):e4042. doi: https://doi.org/10.5812/ijcp.4042

More by these authors

Zahra SalehiPubMedScholar
Arshad HosseiniPubMedScholar
Mohammad NajafiPubMedScholar
Hussain AhmadPubMedScholar
Mohammad Reza FayaziPubMedScholar
Share
Cited by
Metrics