Arch Pediatr Infect Dis

Image Credit:Arch Pediatr Infect Dis

Evaluation of Multiplex Real-time PCR and WHO Criteria for Diagnosing Childhood Bacterial Meningitis in a Tertiary Referral Hospital in Iran

Author(s):
Gholamreza PouladfarGholamreza PouladfarGholamreza Pouladfar ORCID1, Anahita Sanaei DashtiAnahita Sanaei DashtiAnahita Sanaei Dashti ORCID1, Mohammad Rahim KadivarMohammad Rahim Kadivar1, Maedeh JafariMaedeh Jafari1, 2,*, Bahman PourabbasBahman PourabbasBahman Pourabbas ORCID1,**, Marzieh JamalidoustMarzieh JamalidoustMarzieh Jamalidoust ORCID1, Sadaf AsaeiSadaf AsaeiSadaf Asaei ORCID1
1Professor Alborzi Clinical Microbiology Research Center, Nemazee Hospital, Shiraz University of Medical Sciences, Shiraz, Iran
2Department of Pediatrics, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran
Corresponding Authors:

Archives of Pediatric Infectious Diseases:Vol. 10, issue 3; e101822
Published online:Jan 11, 2022
Article type:Research Article
Received:Feb 29, 2020
Accepted:Dec 01, 2021
How to Cite:Pouladfar G, Sanaei Dashti A, Kadivar MR, Jafari M, Pourabbas B, et al. Evaluation of Multiplex Real-time PCR and WHO Criteria for Diagnosing Childhood Bacterial Meningitis in a Tertiary Referral Hospital in Iran. Arch Pediatr Infect Dis. 2022;10(3):e101822. doi: https://doi.org/10.5812/pedinfect.101822

Abstract

Background:

Childhood bacterial meningitis (BM) requires prompt and precise diagnosis to provide proper treatment and decline mortality and morbidity.

Objectives:

We aimed to evaluate the World Health Organization (WHO) criteria and polymerase chain reaction (PCR) for diagnosing BM in children admitted to a tertiary referral hospital in Shiraz, southern Iran.

Materials:

We included all 492 children aged one month to 17 years suspected of meningitis who had cerebrospinal fluid (CSF) leukocytosis admitted to Nemazi Hospital from August 2016 to September 2017. The CSF specimens were examined for routine analysis, Gram staining, and culture. A multiplex real-time PCR was used to identify Streptococcus pneumoniae, Haemophilus influenzae type b (Hib), and Neisseria meningitidis in the CSF samples. Seven viruses were also investigated using real-time PCR. The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated using the WHO criteria and the multiplex real-time PCR results.

Results:

Seventy-four CSF samples had leukocytosis. Nineteen (22.9%) patients had BM caused by S. pneumoniae (n = 14), Hib (n = 2), Salmonella enterica (n = 2), and N. meningitidis (n = 1). The PCR test detected all cases, except for two with Salmonella meningitis (sensitivity 89.4%, specificity 100%, PPV 100%, and NPV 96%). The WHO criteria detected all cases, except three who received antibiotics at least four days before performing lumbar puncture (sensitivity 84.2%, specificity 98.2%, PPV 94.1%, and NPV 94.7%). Enterovirus was the most common viral etiology (6.75%).

Conclusions:

The WHO criteria and the multiplex real-time PCR had high accuracy in our setting, and their use could decrease the antibiotic over-prescription in febrile children suspected of meningitis.

1. Background

Bacterial meningitis (BM) is one of the most severe infectious diseases that affect children, with a high mortality and morbidity rate. The most prevalent causes of community-acquired BM in children are Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae type b (Hib) (1-4). Other bacterial etiologies such as Salmonella enterica are uncommon causes of BM in children beyond the neonatal period (5, 6).
Rapid and accurate diagnosis of BM is crucial to start effective treatment and reduce its complications, sequels, and mortality (3, 4). The World Health Organization (WHO) has defined some criteria for BM diagnosis and surveillance, which are frequently applied, particularly in developing countries (7, 8). A probable case is defined as having clinical findings suggestive of BM, such as the sudden onset of fever or headache, stiff neck, or consciousness changes, as well as one of the following signs: neck stiffness, altered consciousness, or other meningeal signs, besides microscopic and chemical analysis of cerebrospinal fluid (CSF). The CSF examination should show at least one of the following: turbidity or leukocytosis (> 100 cells/mm3), leukocytosis (10 - 100 cells/mm3), and either an increased protein (> 100 mg/dL) or decreased glucose (< 40 mg/dL) (9, 10). The BM diagnosis should be confirmed by isolating a bacterial pathogen from an ordinarily sterile clinical specimen such as CSF or blood using the culture method, detecting a bacterial antigen in normally sterile fluids (i.e., CSF or blood), or Gram staining (11, 12).
The CSF culture is a gold standard laboratory method to confirm BM and a valuable test to target empirical therapy. However, it has some critical limitations (13). Culture results take at least 48 - 72 hours to be reported (14). Obtaining CSF samples after commencing antibiotics, poor techniques in collecting and handling samples to a laboratory, and poor testing techniques in the laboratory, especially in developing countries, may reduce CSF culture's sensitivity to only 30% (15). In recent years, it has been demonstrated that molecular amplification methods, particularly PCR, have a high sensitivity and specificity in BM diagnosis (16, 17).

2. Objectives

We aimed to determine the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of WHO criteria and multiplex real-time PCR for diagnosing childhood BM in a tertiary referral hospital in Shiraz, southern Iran. A blood or CSF culture or multiplex real-time PCR for identifying S. pneumoniae, N. meningitidis, and Hib confirmed the BM diagnosis. Patients’ CSF was also investigated for seven common causes of viral meningitis by real-time PCR.

3. Materials

Totally, 492 CSF samples were collected from children (aged one month to 17 years) who were clinically suspected of BM and admitted to the pediatric wards of Nemazi Teaching Hospital affiliated to Shiraz University of Medical Sciences in Shiraz, southern Iran, between August 2016 and September 2017. The CSF samples of these patients were sent to the Professor Alborzi Clinical Microbiology Research Center. All patients with more than five white blood cells (WBC) per microliter in CSF were included. We used a questionnaire to collect demographic, clinical, and laboratory data from patients’ medical records retrospectively. The study was approved by the Ethics Committee of Shiraz University of Medical Sciences, and informed consent was obtained from parents or legal guardians of children who participated in the study.
The clinical findings in favor of meningitis included the acute onset of fever (> 38.5°C rectal or 38.0°C axillary), seizure, photophobia, neck stiffness, and altered consciousness. In our center, the child’s father or legal guardian needs to give written consent for performing a lumbar puncture (LP). We excluded immunocompromised children, developed meningitis after head trauma or surgery on the central nervous system and ventriculoperitoneal shunts. Bacterial meningitis was assigned to patients with clinical and laboratory evidence of meningeal inflammation with positive Gram staining, routine bacterial culture, or bacterial PCR test results. Aseptic meningitis was assigned to patients with clinical and laboratory evidence of meningeal inflammation with negative Gram staining, routine bacterial culture, and bacterial PCR test results. Based on the WHO criteria, BM refers to patients with clinical findings in favor of BM and at least one of the following: (1) leukocytosis in CSF (> 100 cells/mm3), (2) leukocytosis (10 - 100 cells/mm3) and either an elevated protein (> 100 mg/dL), decreased glucose in CSF (< 40 mg/dL), or isolation of a bacterial pathogen from blood culture, and (3) identification of a bacterium in the CSF by Gram staining or isolation of a bacterial pathogen in CSF culture (10, 11).
All patients were routinely investigated and treated by attending physicians. The usual empirical antibiotics for treating BM in our center included the combination of vancomycin and ceftriaxone. In addition, dexamethasone was routinely prescribed intravenously (0.15 mg/kg every six hours for two days) in BM children (17). The microscopic examination of CSF was done, including total white blood cell (WBC) count with differential. Laboratory tests were performed according to the standard laboratory methods, including CSF/serum glucose levels, CSF protein levels, serum C-reactive protein (CRP), ESR, Gram staining, and culture. We stored 0.5 milliliters of the CSF sample at -20°C to perform PCR tests.
For DNA extraction from CSF, 200 µL of the specimen was added to 100 µL of Tris-EDTA buffer containing 0.04 g/mL lysozyme and 75 U/mL mutanolysin (Sigma Chemical Co.) and incubated for one hour at 37°C. Then, DNA extraction was performed following the proteinase K phenol-chloroform protocols. Taqman Multiplex real-time PCRs for detecting N. meningitidis, Hib, and S. pneumoniae were used in species-specific assays for ctrA, hpd, and lytA genes, respectively (Table 1) (18). The PCR assembly and cycling conditions were as follows: 5 µL of DNA, 1 µL of primers/probes, 12.5 µL of Invitrogen-Platinum Quantitative PCR SuperMix-UDG master mix, 1.5 µL of MgCl2 (50 nM), and water for a 25 µL final volume, run for 40 cycles at 95°C for 15 s and 60°C for one minute on a Rotor gene Q instrument (Kiagene Co.), as described previously. Positive results were verified by monoplex real-time PCR, and negative controls were included in all clinical samples' extraction processes. All negative samples were examined twice. A specimen was considered positive for all PCR assays if its CT value was ≤ 35 and negative if its CT value was > 40. If a CT value was > 35 and ≤ 40, the specimen was diluted 10 folds and retested (18).
Table 1.Primers and Probes Used for Detection of Bacterial Meningitis Pathogens
TargetPrimer or Probe NameReal-time Primer and Probe Nucleotide Sequence (5’to 3’)Working Stock Conc. (µM)Final Conc. (nM)Suggested Probe Modifications
Neisseria meningitidis
ctrAF753TGTGTTCCGCTATACGCCATT3.75300
R846GCCATATTCACACGATATACC11.25900
Pb20iAACCTTGAGCAA”T”CCATTTATCCTGACGCGTTCT1.251005’FAM,BHQ 1 on ”T”, 3’SpC6
sodCF351GCACACTTAGGTGATTTACCTGCAT3.75300
R478CCACCCGTGTGGATCATAATAGA7.5600
Pb896iCATGATGGCACAGCAACAAATCCTGTTT1.251005’ FAM,BHQ 1
Haemophilus influenza
HpdHpdF822GGTTAAATATGCCGATGGTGTTG1.25100
hpdR952TGCATCTTTACGCACGGT|GTA3.75300
Pb896i1.251005’FAM,BHQ 1 on ”T”, 3’SpC6
Streptococcus pneumonia
lytAF373ACGCAATCTAGCAGATGAAGCA2.5200
R424TCGTGCGTTTTAATTCCAGCT2.5200
Pb400iTGCCGAAAACGC”T”TGATACAGGGAG2.52005’FAM,BHQ 1 on” T”, 3’SpC6
The viral RNA and DNA were extracted from 140 µL of each sample with a high pure viral nucleic acid kit containing proteinase K (Roche, Germany), according to the manufacturer’s instructions. Seven viruses, including non-polio human enteroviruses, mumps virus, Human Simplex virus (HSV), Varicella-Zoster virus (VZV), human cytomegalovirus (HCMV), human simplex virus type 6 (HHV-6), and Epstein-Barr virus (EBV), were tested using commercially purchased TaqMan real-time PCR assays from Genesig (Primerdesign, UK) on an ABI Step One Plus™ (Applied Biosystems, U.S.A) real-time PCR system according to the manufacturer’s instructions.

3.1. Statistical Analysis

Data were analyzed using the chi-square test, Fisher exact test, and independent t-test. The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated for BM diagnosis based on the WHO criteria and the multiplex real-time PCR test results. A P value of < 0.05 was considered statistically significant. Statistical analysis was performed with SPSS Version 21.0.

4. Results

Totally, 78 out of 492 samples had more than five WBC counts per microliter in the CSF. Four patients with ventriculoperitoneal shunt were excluded from the study. Among 74 patients, there were 43 boys (58.1%) and girls (41.9%) with a mean age of 27 months.
Nineteen patients had BM, including 17 patients diagnosed just by the multiplex real-time PCR for detection of S. pneumoniae (14 patients), Hib type b (two patients), and N. meningitidis (one patient), one by PCR for detection of Hib and positive Gram staining, and two by isolation of Salmonella typhi in CSF and/or blood cultures. We identified 55 patients with aseptic meningitis. Demographic, clinical, and laboratory characteristics of 74 children with bacterial and aseptic meningitis are shown in Table 2.
Table 2.Demographic, Clinical, and Laboratory Characteristics of 74 Children with Bacterial and Aseptic Meningitis a, b, c
VariablesBacterial Meningitis (N = 19)Aseptic Meningitis (N = 55)P Value
Age (mo)27.2 ± 41.970.6 ±70.50.002
Sex, number of males (%)13 (68.4)30 (54.4)0.291
Vomiting15 (78.9)26 (47.3)0.015
Decreased LOC11 (57.9)30 (54.4)0.800
Meningeal signs6 (31.6)24 (43.6)0.405
Convulsion3 (15.8)10 (18.2)0.560
Respiratory symptom3 (15.8)4 (8.9)0.342
Hospital stay, days16 ± 89 ± 60.003
Antibiotic therapy for 7 days or more19 (100)35 (63)0.001
Duration of antibiotic therapy, days15 ± 88 ± 60.002
Death0 (0)0 (0)-
Time of performing LP regarding the start of antibiotic therapy, number of patients (%)< 0.001
Same day 7 (38)16 (30)
On the 2nd day4 (22)10 (19)
On the 3rd day3 (16)11 (21)
On the 4th day or later4 (22)15 (19)
WBC, cell/mm313575 ± 72011178 ± 4813< 0.001
ESR, mm/h44 ± 3531 ± 20< 0.001
CRP, mg/L55 ± 5436 ± 47< 0.001
Neutrophil (%)56 ± 2651 ± 25< 0.001
Platelet count, cell/mm3325684 ± 133557346458 ± 191501< 0.001
CSF WBC, cell/mm3541 ± 141111 ± 8< 0.001
CSF neutrophil (%)30 ± 378 ± 160.024
CSF protein, mg/dL138 ± 19350 ± 270.063
CSF glucose, mg/dL35 ± 1760 ± 21< 0.001

Abbreviations: SD, standard deviation; N, number; LP, lumber puncture; LOC, level of consciousness; WBC, white blood cell; ESR, erythrocyte sedimentation rate; CRP, C-reactive protein; CSF, cerebrospinal fluid.

aValues are expressed as No. (%) and mean ± SD.

bLaboratory results are related to admission time or the first-time during hospital course.

cData were missed in four patients, one from the BM group and three from the aseptic meningitis group.

Based on the PCR test, 17 patients were diagnosed with BM, including 14 cases with S. pneumonia, two with Hib, and one with N. meningitides. Based on the WHO criteria, 17 patients had BM, including six by CSF leukocytosis more than 100, eight with leukocytosis between 10 and 100 and low glucose concentration or high protein concentration, one with positive Gram staining, and two with positive results of blood and/or CSF cultures. Demographic, clinical, and laboratory findings of BM children who were not diagnosed by the multiplex-PCR method or WHO criteria are shown in Table 3.
Table 3.Demographic, Clinical, and Laboratory Findings of Children with Bacterial Meningitis not Diagnosed by Multiplex Real-time PCR or WHO Criteria
No.Age (m)CPPCR Test ResultBlood CultureCSF CultureCSF AnalysisTOL (Day)HS (Day)
WBC (cell/mm3)PMN (%)Protein (mg/dL)Glucose (mg/dL)
114F, V, CNSalmonellaSalmonella6100952403240
21.5F, VNSalmonellaN1590100202121
315F, MSNN80159570414
424FNN5101058414
518F, MS824552510

Abbreviations: CP, clinical presentation; F, fever; V, vomiting; C, convulsion; MS, meningeal sign; N, negative; CSF, cerebrospinal fluid; P, protein; S, sugar; TOL, the timing of lumbar puncture; HS, hospital stay.

The sensitivities of the multiplex-PCR method and WHO criteria for diagnosing BM in our study were 89.4% and 84.2%, respectively, with specificities of 100% and 98.2%, positive predictive values of 100% and 94.1%, and negative predictive values of 96.5% and 94.1%, respectively (Tables 3 and 4).
Table 4.Comparison of Multiplex Real-time PCR and WHO Criteria for Diagnosis of Bacterial Meningitis in 19 Patients with Confirmed Bacterial Meningitis and 55 Patients with Aseptic Meningitis
GroupsWHO Criteria PositiveWHO Criteria Negative
Confirmed bacterial meningitis
PCR positive143
PCR negative20
Aseptic meningitis
PCR positive00
PCR negative154
Considering the time of performing LP relative to when commencing antibiotic therapy, we found that LP was requested on the day of starting empirical treatment for meningitis in all patients, but it was performed on the day of starting empirical treatment only in 23 patients (32.8%). In about half of the patients, LP was done on the third day of starting antibiotic therapy or later (Table 2).
All BM patients received antibiotics for a mean duration of 15 days (Table 2). Thirty-eight (69%) out of 55 patients with aseptic meningitis received antibiotic regimens for at least seven days. Thirty (86.8%) out of 38 patients received vancomycin in their antibiotic regimens.
Viral meningitis was diagnosed in 10 patients, including five enterovirus cases (6.75%), two HSV cases (2.7%), one CMV case (1.4%), one EBV case (1.4%), and one HHV-6 case (1.4%). No patients had VZV meningitis. According to the PCR result, one patient with a positive PCR result for HSV was a case of pneumococcal meningitis. This patient was a four-year-old girl who presented with fever and vomiting for five days. The CSF analysis reported 70 WBC/mm3, 100% lymphocytes, 40 mg/dL glucose, and 20 mg/dL protein. The CSF Gram staining and culture had negative results. She was treated with vancomycin and ceftriaxone for 10 days but did not receive acyclovir.

5. Discussion

Bacterial meningitis in children is an emerging infectious disease that can cause death or transient, persistent complications (19, 20). Rapid diagnosis and initiation of appropriate treatment can effectively reduce mortality and complications (21). Differentiation of BM from other causes of meningitis, especially viral meningitis, is crucial for the appropriate prescription of antibiotics in BM patients (22). In this study, 63% of the patients with aseptic meningitis received antibiotics for at least seven days. Overprescribing antibiotics could increase drugs' adverse effects, health care costs, and antibiotic resistance rate due to antibiotic selection pressure (23).
In this study, the sensitivity and specificity of WHO criteria for diagnosing BM and the multiplex RT-PCR for detecting common bacteria causing BM in children were high in a tertiary center in a developing country, consistent with previous ones (24). The PCR failed to detect only two BM cases caused by Salmonella enterica (Table 3). This pathogen is an uncommon cause of BM in infants and children and needs a prolonged course of antibiotic therapy (5, 6). Our patients aged 1.5 and 14 months received 21 and 40 days of antibiotic therapy, respectively. The WHO criteria in three patients without elevated white blood cells and protein levels did not detect BM. It seems to be due to delayed LP after starting antibiotic therapy. Besides, LP was performed at least four days after starting antibiotic therapy in these patients (Table 3). The significant effect of antibiotic administration before performing an LP on CSF profiles in BM children has been shown in previous studies. The study reported significant alterations in all CSF parameters associated with Hib meningitis detected after 48 hours of effective parenteral antibiotic therapy (25). In another study, an antibiotic administered within 72 hours before LP was associated with higher CSF glucose levels and lower CSF protein levels (26).
The PCR assay has a higher sensitivity and specificity than Gram staining and CSF and blood culture (21, 22). There are a few cases of BM confirmed by CSF culture in Iran and other developing countries. Some factors could be related to the low yield of CSF culture in these countries, including using antibiotics in febrile children before hospitalization, the delay in performing LP, the delay in transferring samples from the department to the laboratory, and inappropriate laboratory procedures for the isolation of meningitis pathogens. The use of antibiotics in febrile children before hospitalization is common in developing countries. In a nationwide study in Iran, antibiotics were utilized by 62.6% of children with acute respiratory tract infection (27). We observed a delay in performing LP in our center. Parents' refusal to give consent to LP for their children is a common cause of delay in performing LP in children suspected of meningitis in our center. The same problem was reported from other centers, especially in the Middle East (28, 29). The main reasons are the lacked knowledge and a misconception that LP is a harmful procedure that will result in the paralysis of the child, infertility, especially in the male gender, urine incontinence, and/or the aggravated course of the disease. The delay in transferring samples from the department to the laboratory could be another cause of the low yield of CSF culture in BM patients in our center. According to the recommendation of the Centers for Disease Control and Prevention (CDC), CSF should be processed in a microbiology laboratory within one hour after collection or inoculated into the Trans-Isolate (T-I) medium before transport to the laboratory if processing within one hour is not feasible (29). Inappropriate laboratory procedures for the isolation of meningitis pathogens may be the other cause.
In this study, enterovirus was the most common viral etiology in children with meningitis, consistent with other studies and a previous study in our center (30, 31). A patient with pneumococcal BM had a positive PCR test result for HSV in the CSF. Coinfection of enteroviral meningitis and BM has been reported (32, 33). Research has shown that the association of either herpes virus, CNS, or EBV with bacterial meningitis in adult patients increases mortality. Most of these individuals had been infected with the human immunodeficiency virus (34). Our patient was a four-year-old girl treated empirically with vancomycin and ceftriaxone, with complete improvement.
This study has some limitations. This is a single-center study performed retrospectively. Otherwise, the number of patients was sufficient to evaluate the accuracy of the diagnostic methods in our center.
In conclusion, the WHO criteria and multiplex real-time PCR had high accuracy in diagnosing the three most common causes of childhood BM. Performing LP before starting antibiotics could increase the sensitivity of WHO criteria. The presence of uncommon etiology of BM in children was a significant limitation of the PCR to detect common bacterial etiologies of BM. Using the WHO criteria, the multiplex real-time PCR test, and blood and CSF cultures to decide on stopping or changing antibiotics prescribed empirically in febrile children suspected of BM could help avoid the antibiotics overprescription while avoiding mortality and morbidity of BM.

Footnotes

References

  • 1.
    Mohammed I, Iliyasu G, Habib AG. Emergence and control of epidemic meningococcal meningitis in sub-Saharan Africa. Pathog Glob Health. 2017;111(1):1-6. [PubMed ID: 28081671]. [PubMed Central ID: PMC5375607]. https://doi.org/10.1080/20477724.2016.1274068.
  • 2.
    Jafari M, Mohammadzadeh Jahani P, Choopanizadeh M, Jamalidoost M, Pourabbas B, Pouladfar G, et al. Investigating the role of T helper related cytokines in cerebrospinal fluid for the differential diagnosis of bacterial meningitis in pre-treated paediatric patients. Biomarkers. 2020;25(2):171-8. [PubMed ID: 31916867]. https://doi.org/10.1080/1354750X.2020.1714737.
  • 3.
    Houri H, Pormohammad A, Riahi SM, Nasiri MJ, Fallah F, Dabiri H, et al. Acute bacterial meningitis in Iran: Systematic review and meta-analysis. PLoS One. 2017;12(2). e0169617. [PubMed ID: 28170400]. [PubMed Central ID: PMC5295700]. https://doi.org/10.1371/journal.pone.0169617.
  • 4.
    Kloek AT, Brouwer MC, van de Beek D. Host genetic variability and pneumococcal disease: a systematic review and meta-analysis. BMC Med Genomics. 2019;12(1):130. [PubMed ID: 31519222]. [PubMed Central ID: PMC6743160]. https://doi.org/10.1186/s12920-019-0572-x.
  • 5.
    Anvarinejad M, Pouladfar GR, Pourabbas B, Amin Shahidi M, Rafaatpour N, Dehyadegari MA, et al. Detection of Salmonella spp. with the BACTEC 9240 Automated Blood Culture System in 2008 - 2014 in Southern Iran (Shiraz): Biogrouping, MIC, and Antimicrobial Susceptibility Profiles of Isolates. Jundishapur J Microbiol. 2016;9(4). e26505. [PubMed ID: 27284396]. [PubMed Central ID: PMC4897598]. https://doi.org/10.5812/jjm.26505.
  • 6.
    Anne RP, Vaidya PC, Ray P, Singhi PD. Salmonella typhimurium Meningitis in an Infant Presenting with Recurrent Meningitis. Indian J Pediatr. 2018;85(7):560-2. [PubMed ID: 29238942]. https://doi.org/10.1007/s12098-017-2562-3.
  • 7.
    Soysal A, Toprak DG, Turkoglu S, Bakir M. Evaluation of the line probe assay for the rapid detection of bacterial meningitis pathogens in cerebrospinal fluid samples from children. BMC Microbiol. 2017;17(1):14. [PubMed ID: 28077083]. [PubMed Central ID: PMC5228108]. https://doi.org/10.1186/s12866-016-0834-0.
  • 8.
    Rees CA, Cruz AT, Freedman SB, Mahajan P, Uspal NG, Okada P, et al. Application of the Bacterial Meningitis Score for Infants Aged 0 to 60 Days. J Pediatric Infect Dis Soc. 2019;8(6):559-62. [PubMed ID: 30535235]. https://doi.org/10.1093/jpids/piy126.
  • 9.
    Sanaei Dashti A, Alizadeh S, Karimi A, Khalifeh M, Shoja SA. Diagnostic value of lactate, procalcitonin, ferritin, serum-C-reactive protein, and other biomarkers in bacterial and viral meningitis: A cross-sectional study. Medicine (Baltimore). 2017;96(35). e7637. [PubMed ID: 28858084]. [PubMed Central ID: PMC5585478]. https://doi.org/10.1097/MD.0000000000007637.
  • 10.
    Okike IO, Ladhani SN, Johnson AP, Henderson KL, Blackburn RM, Muller-Pebody B, et al. Clinical Characteristics and Risk Factors for Poor Outcome in Infants Less Than 90 Days of Age With Bacterial Meningitis in the United Kingdom and Ireland. Pediatr Infect Dis J. 2018;37(9):837-43. [PubMed ID: 29384979]. https://doi.org/10.1097/INF.0000000000001917.
  • 11.
    Azzari C, Nieddu F, Moriondo M, Indolfi G, Canessa C, Ricci S, et al. Underestimation of Invasive Meningococcal Disease in Italy. Emerg Infect Dis. 2016;22(3):469-75. [PubMed ID: 26890305]. [PubMed Central ID: PMC4766889]. https://doi.org/10.3201/eid2203.150928.
  • 12.
    Azevedo J, Dos Anjos ES, Cordeiro SM, Dos Santos MS, Escobar EC, Lobo PR, et al. Genetic profiles and antimicrobial resistance of Streptococcus pneumoniae non-PCV10 serotype isolates recovered from meningitis cases in Salvador, Brazil. J Med Microbiol. 2016;65(10):1164-70. [PubMed ID: 27599851]. https://doi.org/10.1099/jmm.0.000346.
  • 13.
    Amare AT, Kebede ZT, Welch HD. Epidemiology of bacterial meningitis in children admitted to Gondar University Hospital in the post pneumococcal vaccine era. Pan Afr Med J. 2018;31:193. [PubMed ID: 31086637]. [PubMed Central ID: PMC6488968]. https://doi.org/10.11604/pamj.2018.31.193.10254.
  • 14.
    Albuquerque RC, Moreno ACR, Dos Santos SR, Ragazzi SLB, Martinez MB. Multiplex-PCR for diagnosis of bacterial meningitis. Braz J Microbiol. 2019;50(2):435-43. [PubMed ID: 30796713]. [PubMed Central ID: PMC6863191]. https://doi.org/10.1007/s42770-019-00055-9.
  • 15.
    Amin M, Ghaderpanah M, Navidifar T. Detection of Haemophilus influenzae type b, Streptococcus agalactiae, Streptococcus pneumoniae and Neisseria meningitidis in CSF specimens of children suspicious of Meningitis in Ahvaz, Iran. Kaohsiung J Med Sci. 2016;32(10):501-6. [PubMed ID: 27742033]. https://doi.org/10.1016/j.kjms.2016.08.009.
  • 16.
    Ramya SR, Devi C, Perumal A, Asir J, Kanungo R. Detection of bacterial DNA in infected body fluids using 16S rRNA gene sequencing: Evaluation as a rapid diagnostic tool. J Acad Clin Microbiol. 2018;20(2). https://doi.org/10.4103/jacm.jacm_19_18.
  • 17.
    Ali A, Zanguina J, Sousso A, Moumouni A, Sani O. First report of Salmonella meningitis in children during 2011-2015 meningitis surveillance in Niger. Int J Microbiol Mycol. 2017;5(6):1-6.
  • 18.
    Fukasawa LO, Goncalves MG, Higa FT, Castilho EA, Ibarz-Pavon AB, Sacchi CT. Use of cerebrospinal fluid and serum samples impregnated on FTATM Elute filter paper for the diagnosis of infections caused by Neisseria meningitidis, Streptococcus pneumoniae and Haemophilus influenzae. PLoS One. 2017;12(2). e0172794. [PubMed ID: 28235065]. [PubMed Central ID: PMC5325563]. https://doi.org/10.1371/journal.pone.0172794.
  • 19.
    Okike IO, Ladhani SN, Anthony M, Ninis N, Heath PT. Assessment of healthcare delivery in the early management of bacterial meningitis in UK young infants: an observational study. BMJ Open. 2017;7(8). e015700. [PubMed ID: 28827241]. [PubMed Central ID: PMC5724087]. https://doi.org/10.1136/bmjopen-2016-015700.
  • 20.
    Millar BC, Banks L, Bourke TW, Cunningham M, Dooley JS, Elshibly S, et al. Meningococcal Disease Section 3: Diagnosis and Management: MeningoNI Forum (see page 87(2) 83 for full list of authors). Ulster Med J. 2018;87(2):94-8. [PubMed ID: 29867262]. [PubMed Central ID: PMC5974663].
  • 21.
    Ramalingam RK, Chakraborty D. Retrospective analysis of multiplex polymerase chain reaction-based molecular diagnostics (SES) in 70 patients with suspected central nervous system infections: A single-center study. Ann Indian Acad Neurol. 2016;19(4):482-90. [PubMed ID: 27994358]. [PubMed Central ID: PMC5144470]. https://doi.org/10.4103/0972-2327.192483.
  • 22.
    Collins S, Vickers A, Ladhani SN, Flynn S, Platt S, Ramsay ME, et al. Clinical and Molecular Epidemiology of Childhood Invasive Nontypeable Haemophilus influenzae Disease in England and Wales. Pediatr Infect Dis J. 2016;35(3):e76-84. [PubMed ID: 26569188]. https://doi.org/10.1097/INF.0000000000000996.
  • 23.
    Pouladfar G, Jafarpour Z, Hosseini SA, Janghorban P, Roozbeh J. Antibiotic selective pressure and development of bacterial resistance detected in bacteriuria following kidney transplantation. Transplant Proc. 2015;47(4):1131-5. [PubMed ID: 26036537]. https://doi.org/10.1016/j.transproceed.2014.11.062.
  • 24.
    Khumalo J, Nicol M, Hardie D, Muloiwa R, Mteshana P, Bamford C. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting. PLoS One. 2017;12(3). e0173948. [PubMed ID: 28346504]. [PubMed Central ID: PMC5367690]. https://doi.org/10.1371/journal.pone.0173948.
  • 25.
    Leazer R, Erickson N, Paulson J, Zipkin R, Stemmle M, Schroeder AR, et al. Epidemiology of Cerebrospinal Fluid Cultures and Time to Detection in Term Infants. Pediatrics. 2017;139(5). [PubMed ID: 28557739]. https://doi.org/10.1542/peds.2016-3268.
  • 26.
    Rogers T, Sok K, Erickson T, Aguilera E, Wootton SH, Murray KO, et al. Impact of Antibiotic Therapy in the Microbiological Yield of Healthcare-Associated Ventriculitis and Meningitis. Open Forum Infect Dis. 2019;6(3):ofz050. [PubMed ID: 30899767]. [PubMed Central ID: PMC6422431]. https://doi.org/10.1093/ofid/ofz050.
  • 27.
    Mostafavi N, Rashidian A, Karimi-Shahanjarini A, Khosravi A, Kelishadi R. The rate of antibiotic utilization in Iranian under 5-year-old children with acute respiratory tract illness: A nationwide community-based study. J Res Med Sci. 2015;20(5):429-33. [PubMed ID: 26487870]. [PubMed Central ID: PMC4590196]. https://doi.org/10.4103/1735-1995.163952.
  • 28.
    Alnajim SA, Sulaiman ZM, Sulaiman SM, Otaibi FA, Alsahfy HO, Alawami SS. Common Misconceptions of Lumbar Puncture Complications among Parents in the Eastern Region of the Kingdom of Saudi Arabia. Int J Adv Res. 2017;5(12):1257-64. https://doi.org/10.21474/ijar01/6082.
  • 29.
    Al-Hajjiah NN, Al-Shamsi MM, Al-Shami MM. The rate of parental refusal lumbar puncture in the Maternity and Children Teaching Hospital in Diwaniyah, Iraq. J Pharm Sci Res. 2018;10(10):2680-1.
  • 30.
    Hosseininasab A, Alborzi A, Ziyaeyan M, Jamalidoust M, Moeini M, Pouladfar G, et al. Viral etiology of aseptic meningitis among children in southern Iran. J Med Virol. 2011;83(5):884-8. [PubMed ID: 21412795]. https://doi.org/10.1002/jmv.22056.
  • 31.
    Vincent JJ, Zandotti C, Baron S, Kandil C, Levy PY, Drancourt M, et al. Point-of-care multiplexed diagnosis of meningitis using the FilmArray(R) ME panel technology. Eur J Clin Microbiol Infect Dis. 2020;39(8):1573-80. [PubMed ID: 32358740]. https://doi.org/10.1007/s10096-020-03859-y.
  • 32.
    Izadi A, Rahbarimanesh AA, Mojtahedi Y, Mojtahedi SY. Prevalence of enterovirus meningitis in children: Report from a tertiary center. Maedica (Bucur). 2018;13(3):213. [PubMed ID: 30568741]. [PubMed Central ID: PMC6290187]. https://doi.org/10.26574/maedica.2018.13.3.213.
  • 33.
    Basmaci R, Mariani P, Delacroix G, Azib S, Faye A, Taha MK, et al. Enteroviral meningitis does not exclude concurrent bacterial meningitis. J Clin Microbiol. 2011;49(9):3442-3. [PubMed ID: 21878585]. [PubMed Central ID: PMC3165612]. https://doi.org/10.1128/JCM.01015-11.
  • 34.
    Ben Abid F, Abukhattab M, Ghazouani H, Khalil O, Gohar A, Al Soub H, et al. Epidemiology and clinical outcomes of viral central nervous system infections. Int J Infect Dis. 2018;73:85-90. [PubMed ID: 29913285]. https://doi.org/10.1016/j.ijid.2018.06.008.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles