Arch Pediatr Infect Dis

Image Credit:Arch Pediatr Infect Dis

Phylogenetic Groups/B2 Subgroup Distributions, Serogrouping and Identification of Virulence Factors in Extended-Spectrum Cephalosporin-Resistant Escherichia coli Strains Isolated from the Stool of Healthy Children Under 10 Years Old

Author(s):
Mohammad MansouriMohammad Mansouri1, Shahin Najar PeerayehShahin Najar Peerayeh1, , Ashraf Mohabati MobarezAshraf Mohabati MobarezAshraf Mohabati Mobarez ORCID1,*, Bita BakhshiBita BakhshiBita Bakhshi ORCID1, Mohsen KarbalaeiMohsen KarbalaeiMohsen Karbalaei ORCID2, Zahra AbdolvandZahra Abdolvand1
1Department of Bactriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
2Microbiology and Virology Department, Jiroft University of Medical Sciences, Jiroft, Iran
Person has died since the article was written.

Archives of Pediatric Infectious Diseases:Vol. 10, issue 3; e118889
Published online:Apr 19, 2022
Article type:Research Article
Received:Oct 16, 2021
Accepted:Feb 19, 2022
How to Cite:Mansouri M, Najar Peerayeh S, Mohabati Mobarez A, Bakhshi B, Karbalaei M, et al. Phylogenetic Groups/B2 Subgroup Distributions, Serogrouping and Identification of Virulence Factors in Extended-Spectrum Cephalosporin-Resistant Escherichia coli Strains Isolated from the Stool of Healthy Children Under 10 Years Old. Arch Pediatr Infect Dis. 2022;10(3):e118889. doi: https://doi.org/10.5812/pedinfect-118889

Abstract

Background:

Segregation of Escherichia coli (E. coli) into the phylogenetic groups was observed in the experiments so that group B2 contained the enteropathogenic E. coli (EPEC) strains and extraintestinal pathogenic E. coli (ExPEC).

Objectives:

This study aimed to identify B2 phylogenetic groups in the extended-spectrum Cephalosporins resistant E. coli isolated from the stool of healthy children under 10 years old.

Methods:

One hundred E. coli resistant to broad-spectrum Cephalosporins were collected from the feces of healthy children under 10. Subsequently, we grouped phylogenetic via PCR based on the genes yjaA, chuA, arpA, as well, as TspE4.C2. Then, according to Clermont et al.’s study, we used two individual multiplex PCRs for identifying B2 sub-groups (I-X subgroups). Serogroup typing with the 12 O-antigen was analyzed via PCR, and finally, 10 virulence genes (cnf1, papG, ibeA, malX, usp, cdt, eae, bfp, and afa-Dr) were identified with PCR.

Results:

The age range of the healthy children was between 1 and 10 years. The B2 and unknown phylogroups were the most common strains in this study. The most common B2 subgroups were I (2%), IX (1%), V (8%), IV, V, VII (1%), IX, V (3%), IX, V, III, I (1%), IX, V, III, VII, I (%1), V, I (6%), V, III, I (3%), and V, III, VII (1%), with each subgroup carrying distinctive sets of ExPEC virulence markers. The results also showed that 29% of E. coli in the healthy children had malX and 23% had papGII. It was also found that 32% of the strains isolated from the healthy children had antigens O2 and 36% were unknown.

Conclusions:

In this study, 27% of the strains belonged to B2 phylogroup and 6% to B1 phylogroup. Moreover, serogroups O2, O16, and O25 were predominant and belonged to B2 phylogroup. Moreover, malX, papGII, usp, papGIII, aggR, and eae virulence genes also had the highest to lowest supply among the tested strains, respectively. Moreover, B2 isolates were shown to have further virulence-related genes in comparison to the non B2 isolates.

1. Background

Escherichia coli is a commensal bacterium living in the intestinal tract of animals and humans (1). In particular, adherent-invasive E. coli (AIEC) pathotype was one of the key bacterial triggers of IBD (2). Certain strains are the member of the extraintestinal pathogenic E. coli (ExPEC). Besides, it is possible to classify E. coli strains into the phylogenetic groups, such as B1, A, C, B2, E, D, F, as well as clade I/II (3). Moreover, the ExPEC strains, in which diverse virulence factor genes are used to characterize, are the members of D and B2 phylogenetic groups fundamentally. Most E. coli types, including EPEC (carrying bfp and eae genes), may be commonly assigned to 1 of the 4 clusters of B1, A, D, as well as B2 (4). Among E. coli phylogenetic groups, B2 phylogroup is believed to be more important than others. These strains indicate more ability to persist in the gut microbiota compared to the ones in other E. coli phylogenetic groups, which may be caused by accumulating pathogenicity islands (PAIs) as well as ExPEC virulence genes (5). Furthermore, B2 strains have at least 10 phylogenetic sub-groups (I–X) or lineages, including I (STc131), II (STc73), III (STc127), IV (STc141), V (STc144), VI (STc12), VII (STc14), VIII (STc452), IX (STc95), and X (STc372) (6). Studies indicated the predominance of subgroups I (STc131), II (STc73), as well as IX (STc95) in a majority of ExPEC strains (7). The present study subtyped the phylogenetic group B2 strains previously isolated from the commensal feces of healthy children. Their serogroups, virulence markers, as well as abilities to persist in the microbiota are associated with certain B2 groups.
Antimicrobial resistance such as third-generation cephalosporin-resistant (3GCR) in the commensal bacteria and acquiring virulence factors by these strains is worrisome in terms of its ability to spread to pathogens. These challenges result in increased healthcare costs and mortality. However, there is no sufficient data on the antimicrobial resistance profile, the virulence traits of these commensal strains, especially in a developing country like Iran. Therefore, the present study involves the identification profiles of these isolates from the stool of healthy children under 10 years old (8, 9).

2. Objectives

This study aimed to identify B2 phylogenetic groups in the extended-spectrum Cephalosporins resistant E. coli isolated from the stool of healthy children under 10 years old.

3. Methods

3.1. Ethical Statements and Bacterial Isolate

We performed this cross-sectional study in Tarbiat Modares University, Tehran, Iran, from January 2020 - February 2021. According to the research design, we examined 100 strains of E. coli resistant to broad-spectrum Cephalosporins (CTX, CAZ = 100% and ESBL genes (TEM = 26%, CTX-M1 = 98%, SHV = 51%) isolated from the feces of healthy children under 10 years (57 males and 43 females). Subsequently, all the strains were transferred in Tryptic Soy Broth and incubated at 37°C overnight. In the next step, we streaked these strains on the MacConkey agar and performed incubation at a temperature of 37°C for 24 hours, and finally, pink colonies were subcultured on EMB (Eosin Methylene Blue), so that the colonies over them exhibited a green-metallic sheen color. Ultimately, we used a set of biochemical experiments for further confirmation. Then, in order to store them for a longer period, we used a tryptic soy broth consisting of 20% glycerol (provided by Merck Company: Germany) for storing the treated isolates at a temperature of -20°C.

3.2. Virulence Typing

Through the use of primers and PCR, particular genes were specified: cytolethal distending toxin (cdt), cytotoxic necrotizing factor 1 (cnf1), invasion of brain endothelium (ibeA), secretion autoinducer toxin (sat), uropathogenic-specific protein (usp), pathogenicity island marker (malX), Dr-antigen binding adhesins (afa/Dr), bundle-forming pili (bfp), shiga-like toxins (stx) intimin (eae), and transcriptional activator aggR. Table 1 presents the primers and temperature conditions.
Table 1.Primers and Amplicon Size (bp) for Detection of Virulence Genes
Target GenePrimers, Genes, and Sequence (5’- 3’)Amplicon Size (bp)Ref.
eaeF: GTAAGTCTCAAACGCAAGCAACCAC229(10)
R: AACCTTGTTGTCAATTTTCAGTTCATCA
bfpF: AATGGTGCTTGCGCTTGCTGC268(10)
R: GCCGCTTTATCCAACCTGGTA
papGIF: TCGTGCTCAGGTCCGGAATTT461(11)
R: TGGCATCCCCCAACATTATCG
papGIIF: GGGATGAGCGGGCCTTTGAT190
R: CGGGCCCCCAAGTAACTCG
papGIIIF: GGCCTGCAATGGATTTACCTGG258
R: CCACCAAATGACCATGCCAGAC
Stx1F: TAAATCGCCATTCGTTGACTAC180(12)
R: AGAACGCCCACTGAGATCATC
Stx2F: GGCACTGTCTGAAACTGCTCC255
R: TCGCCAGTTATCTGACATTCTG
cdtF: TAAATGGAATATACATGTCCG588(13)
R: TTTCCAGCTACTGCATAATC
Cnf-1F: GAACTTATTAAGGATAGT543(13)
R: CATTATTTATAACGCTG
ibeAF; AGGCAGGTGTGCGCCGCGTAC170(14)
R: TGGTGCTCCGGCAAACCATGC
uspF: CGGCTCTTACATCGGTGCGTTG615(15)
R: GACATATCCAGCCAGCGAGTTC
malXF: GGACATCCTGTTACAGCGCGCA930(15)
R: TCGCCACCAATCACAGCCGAAC
aggRF: GTATACACAAAAGAAGGAAGC194(16)
R: ACAGAATCGTCAGCATCAGC
afa-DrF: CGAAAACGGCACTGACAAG230(17)
R: AGGCTTTCCGTGAATACAACC

3.3. Phylotyping Method and Detection of Phylogroups in Isolates

In this step, we applied PCR based method as described by Clermont et al. for determining nine phylogroups, e.g., B1, A, C, B2, E, D, F as well as clade I/II. Moreover, PCR was employed to amplify the key targeted genes such as yjaA, chuA, arpA, and TspE4.C2. To characterize the phylogroups E and C, we utilized the allele-specific PCR primers (3). Table 2 depicts the primers and temperature conditions.
Table 2.Primers and Amplicon Size (bp) for Detection of Phylogroups
Target GenePrimers, Genes, and Sequence (5’- 3’)Amplicon Size (bp)Ref.
chuAF: GAC GAA CCA ACG GTC AGG AT279(3)
R: TGC CGC CAG TAC CAA AGA CA
yjaAF: TGA AGT GTC AGG AGA CGC TG211
R: ATG GAG AAT GCG TTC CTC AAC
TspE4.C2F: GAG TAA TGT CGG GGC ATT CA152
R: CGC GCC AAC AAA GTA TTA CG
arpAF: AACGCTATTCGCCAGCTTGC400
R: TCTCCCCATACCGTACGCTA

3.4. Subtyping of B2 Subgroups

Utilizing PCR method, B2 subgroups, including I (STc131), II (STc73), III (STc127), IV (STc141), V (STc144), VI (STc12), VII (STc14), IX (STc95), and X (STc372)) were performed for 27 strains that were determined in Phylogrouping stage. Table 3 represents the primers and the product size.
Table 3.Primers and Amplicon Size (bp) for Detection of B2 Subgroups
Primer DesignationPrimer SequencesTargetSub-groupProduct SizeRef.
pabBgpII.F5 ′-GAGTCACTGCCAGAAATTGCA-3′pabBII415(6)
pabBgpII.R5 ′-GGCGAAAGGCTTAAAATTGCACT-3′
trpAgpIII.F5 ′-GACGCGCTGGAATTAGGCTC-3′trpAIII255
trpAgpIII.R5 ′-ATCGGCAACCAGCACCGAAT-3′
dinBgpVI.F5 ′-CAGCGGTGGAGATGCGCGAT-3′dinBVI652
dinBgpVI.R5 ′-CAGCGGTGGAGATGCGCGAT-3′
icdgpVII.f5 ′-GCGGTATTCGCTCTCTGAAT-3′icdVII810
icdgpVII.r5 ′-CAATTAAATCAGCCGCTTCG-3′
aesgpIX.f5 ′-CCTGGCCTGCAACGGGAG-3′aesIX160
aesgpIX.r5 ′-TCTGGCTGCGGATAAAAGAG-3′
putPgpI.f5 ′-GGTATCGCTTACTTTAACGG-3′putPI373
putPgpI.r5 ′-ACCACCGGACCAAACGCC-3′
trpAgpIV.f5 ′-TGCCAGTGGAAGAGTCCGCT-3′trpAIV261
trpAgpIV.r5 ′-CCGGGGCGGAAATACCAAAG-3′
polBgpV.f5 ′-GCCGTTTCGCCGAAGATAAA-3′polBV530
polBgpV.r5 ′-TAATGATCTTCAGCGCCTGT-3′
aesgpX.f5 ′-GACCGTTGTGAATACTCTTCA-3′aesX713
aesgpX.r5 ′-TATAACAGGGCGGCACATTT-3′
chuAgene.15 ′-CGATACGGTCGATGCAAAAG-3′chuAInternal control1013
chuAgene.25 ′-TTGGACAACATCAGGTCATC-3′

3.5. Amplification of O-Serogroup

According to the analysis, the commonest serogroups of the extraintestinal E. coli entail O2, O1, O6, O4, O12, O7, O16, O15, O25, O18, O157, as well as O75 antigens that were examined with PCR. Table 4 reports the primers and the product size.
Table 4.Primers and Amplicon Size (bp) for Detection of O-Serogroup Amplification (O1, O2, O4, O6, O7, O12, O15, O16, O18, O25, O75, and O157)
Target GenePrimers, Genes, and Sequence (5’- 3’)Ampliconsize (bp)Ref
gndbis.f5-ATACCGACGACGCCGATCTG-3-(18)
rfbO1.r5-CCAGAAATACACTTGGAGAC-3189
rfbO2a.r5-GTGACTATTTCGTTACAAGC-3274
rfbO18.r5-GAAGATGGCTATAATGGTTG-3360
rfbO16.r5-GGATCATTTATGCTGGTACG-3450
rfbO6a.r5-AAATGAGCGCCCACCATTAC-3584
rfbO7.r5-CGAAGATCATCCACGATCCG-3722
rfbO4.r5-AGGGGCCATTTGACCCACTC-3193
rfbO12.r5-GTGTCAAATGCCTGTCACCG-3239
rfbO25a.r5-GAGATCCAAAAACAGTTTGTG-3313
rfbO75.r5-GTAATAATGCTTGCGAAACC-3419
rfbO15.r5-TGATAATGACCAACTCGACG-3536
rfbO157.r5-TACGACAGAGAGTGTCTGAG-3672

3.6. Statistical Analyses

SPSS21 and t-test were employed for analyzing the obtained data. Moreover, the confidence interval was considered to be 95% (CI = 95%), and P-value < 0.05 was considered to be significant.

3.7. Ethical Statement

As mentioned earlier, the present research was verified by the Ethical Committee of the Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran (IR.MODARES.REC.1399.085).

4. Results

Of 100 isolates tested for virulence encoding genes, papGII 23% (n = 23), papGIII 8% (n = 8), usp 14% (n = 14), aggR, eae 1% (n = 1), malX 29% (n = 29), bfp, stx1, stx2, cnf, afa-Dr, cdt, ibeA, and papGI = 0 were recognized (Figure 1).
PCR reactions for virulence encoding genes of <i>Escherichia coli</i> in all strains (<i>papGII</i>, <i>papGIII</i>, <i>usp</i>, <i>aggR</i>, <i>eae</i>, <i>malX</i> were positive), (<i>bfp</i>, <i>stx1</i>, <i>stx2</i>, <i>cnf</i>, <i>afa-Dr</i>, <i>cdt</i>, <i>ibeA</i>, <i>papGII</i> were negative); M: Ladder 1000 bp; <i>papGIII</i>, 258 bp; <i>aggR</i>, 254 bp; <i>malX</i>, 930 bp; <i>usp</i>, 615 bp; <i>eae</i>, 167 bp; <i>papGII</i>, 190 bp.
Figure 1.

PCR reactions for virulence encoding genes of Escherichia coli in all strains (papGII, papGIII, usp, aggR, eae, malX were positive), (bfp, stx1, stx2, cnf, afa-Dr, cdt, ibeA, papGII were negative); M: Ladder 1000 bp; papGIII, 258 bp; aggR, 254 bp; malX, 930 bp; usp, 615 bp; eae, 167 bp; papGII, 190 bp.

4.1. Detection of Phylogroups

As reported in Clermont et al.’s study, the researchers showed the generation of a specific profile by one of the quadruplex genotypes relative to the absence or presence of the 4 genes; for example, (+, −, +, −) demonstrates arpA (+), chuA (−), yjaA (+), and TspE4.C2 (−). Considering this method, the percentage of phylogroup B1 was 6% (6/100), B2 was 27% (27/100), clade I/II was 1% (1/100), D/E was 16% (16/100), and E/clade I was 1% (1/100); also, 49% (49/100) of the strains were unknown. None of the isolates were recognized as phylogroups A, C, D, E, and F.

4.2. Analysis of B2 Subgroups

According to the analysis, the commonest B2 sub-groups were determined among the E. coli strains in the healthy infants: I (2%), IX (1%), V (8%), IV, V, VII (1%), IX, V (3%), IX, V, III, I (1%), IX, V, III, VII, I (%1), V, I (6%), V, III, I (3%), and V, III, VII (1%).

4.3. Serogroup Typing in Escherichia coli Isolates

Table 5 presents the serogroup distribution in phylogroups of the E. coli strains isolated from the stool of healthy children below the age of 10. O2, O1, and O4 serogroups were the most abundant known serogroups among all the phylogroups, respectively. However, O157 was not in either of the strains (Figure 2).
Table 5.Serogroup Distribution in Phylogroups of Escherichia coli Strains; B2 Phylogroups Had the Highest Serogroup and in Clade I/II, E/Clade I Phylogroups Had the Lowest Serogroups.
PhylogroupsSerogroups
O1O2O4O6O7O12O15O16O18O25O75O157Unknown
A0000000000000
B10300000000003
B215100005121011
C0000000000000
D0000000000000
E0000000000000
F0000000000000
D/E1411110000007
Clade I/II0100000000000
E/clade I0000000000001
Unknown619402010111014
PCR reactions for Serogrouping of <i>Escherichia coli</i> in all strains (O1, O2, O4, O6, O7, O12, O15, O16, O18, O25, O75, and O157). Lane: 1, ladder 1000 bp; 2, 189 bp; 3, 274 bp; 4, 193 bp; 5, 584 bp; 6, 722 bp; 7, 313 bp; 8, 536 bp; 9, 450 bp; 10, 360 bp; 11, 419 bp.
Figure 2.

PCR reactions for Serogrouping of Escherichia coli in all strains (O1, O2, O4, O6, O7, O12, O15, O16, O18, O25, O75, and O157). Lane: 1, ladder 1000 bp; 2, 189 bp; 3, 274 bp; 4, 193 bp; 5, 584 bp; 6, 722 bp; 7, 313 bp; 8, 536 bp; 9, 450 bp; 10, 360 bp; 11, 419 bp.

4.4. Phylogenetic Groups and Pathogenicity Genes

Analysis of the relationship between virulence genes with the phylogenetic groups showed that the spread of each virulence gene enhanced largely in the phylogenetic group B2 than that in the remaining phylogenetic groups.
Table 6 demonstrates the relationship between phylogenetic groups and pathogenicity genes.
Table 6.The Relationship of Phylogenetic Groups and Pathogenicity Genes
Phylogenetic GroupVirulence Gene Pattern (No. Isolate)
B1papGII (3), aggR (1)
B2malX (17), usp (10), papGIII (4), papGII (9)
Clade I/II-
D/EmalX (2), papGII (2)
E/clade IpapGII (1)
UnknownmalX (10), usp (4), papGII (1), eae (1)

a B2 phylogroup has the highest virulence factors, and no virulence factors were observed in clade I/II.

b The aggR gene was observed in group B1 and eae in an unknown phylogenetic group, while papGII was common to all phylogroups.

5. Discussion

The emergence and spread of third-generation cephalosporin-resistant E. coli in developing countries are a great concern. Healthy children colonized with ESBL-producing strains may transmit the resistant strains to other individuals, including the hospitalized patients (19). Based on four genes, namely arpA, chuA, yjaA, and TspE4.C2, E. coli strains could be categorized into the phylogenetic groups presented as follows: A, B1, B2, C, D, E, F, and clade I/II (3). Among these phylogroups, the phylogroup B2 mainly includes the strains which cause extraintestinal infections in humans as opportunistic pathogens (18). The present study was conducted to investigate the virulence factors, determine phylogroups, B2 subgroups, and serogroups of E. coli strains resistant to the broad-spectrum Cephalosporins isolated from the fecal samples of healthy children below 10 years of age. The study showed that 27% of the strains belonged to B2 phylogroup and 6% to B1 phylogroup. Among B2 phylogroup strains, the highest frequency belonged to subgroup V (polB genes). The malX, papGII, usp, papGIII, aggR, and eae virulence genes, respectively, had the highest to lowest supply among the tested strains. However, among B2 phylogroup strains, only malX, papGII, usp, and papGIII virulence genes were reported. We observed that 14 strains were positive for usp genes (is prevalent among strains causing urinary tract infections), one strain was positive for eae gene (a marker for EPEC pathovar), one strain was positive for aggR gene (a marker for EAEC pathovar), 29 strains were positive for malX gene (it is enriched in the strains causing extraintestinal infections). The results of serogroup determination based on O antigen indicated that the highest frequency was observed in the serogroups O1, O2, and O4 among all phylogroups, yet serogroups O2, O16, and O25 were predominant among phylogroup B2 strains. Nowrouzian et al. reported that among 140 commensal E. coli B2 strains, 47% of the Pakistani strains and 84% of the Swedish strains belonged to a major B2 subgroup (subgroups I-X) (7). Alizade et al. conducted a study on 216 strains of E. coli isolated from fecal samples of the patients with watery diarrhea. Although most strains belonged to B1 phylogroup, most strains contained the broad-spectrum beta-lactamase gene (CTX-M1) (20). Nojoomi and Ghasemian addressed E. coli strains isolated from the feces of the healthy children, about 98% of E. coli strains had CTX-M1 gene, which indicates the difference between serogroup and antigenic profile of the strains and the virulence genes (21). Our results indicate the diversity of phylogroups among E. coli strains with the predominance of B2 group, and none of the isolates were recognized as phylogroup A, C, D, E, and F. This is, while in another similar study in Tunisia on community fecal carriage of broad-spectrum cephalosporin-resistant was B1, D, B2, and A phylogroups, respectively (22). It is the first study in Iran that showed a higher frequency of B2 phylogroup than other phylogroups among the E. coli isolates from fecal samples of the healthy children, while most similar studies were performed on urine, feces, and or blood samples of children or adults with urinary tract infection, diarrhea, and or sepsis. According to the obtained findings herein and similar articles, it seems that phylogroup B2 strains play a major role in the extraintestinal infections and carrying resistance genes that can result in the dissemination in hospital settings, and increase frequency in nosocomial infections with human health impact. Meanwhile, their frequency in healthy individuals is a function of lifestyle, customs, geographical area, nutritional status, and level of public health. The frequency of virulence genes in these bacteria varies depending on their invasive conditions or coexistence with the host, how they interact with the host immune system, and the infection site. The obtained findings suggested the evolution of features in the group B2 E. coli strains, which enable them to survive in the complicated context of the humans’ intestines.

5.1. Conclusions

As shown in this research, we addressed the typing of the phylogenetic group B2 strains isolated from the commensal gut microbiota of healthy children under 10 years old. Virulence genes were more prevalent in group B2, carrying resistance genes, and the virulence factors like usp and papG by these strains can result in extraintestinal infections and increased frequency in nosocomial infections with the human health impact and leave few treatment options for the infections when caused by these strains in these children.

Footnotes

References

  • 1.
    Cabal A, Garcia-Castillo M, Canton R, Gortazar C, Dominguez L, Alvarez J. Prevalence of Escherichia coli Virulence Genes in Patients with Diarrhea and a Subpopulation of Healthy Volunteers in Madrid, Spain. Front Microbiol. 2016;7:641. [PubMed ID: 27199966]. [PubMed Central ID: PMC4859089]. https://doi.org/10.3389/fmicb.2016.00641.
  • 2.
    Fang X, Monk JM, Mih N, Du B, Sastry AV, Kavvas E, et al. Escherichia coli B2 strains prevalent in inflammatory bowel disease patients have distinct metabolic capabilities that enable colonization of intestinal mucosa. BMC Syst Biol. 2018;12(1):66. [PubMed ID: 29890970]. [PubMed Central ID: PMC5996543]. https://doi.org/10.1186/s12918-018-0587-5.
  • 3.
    Clermont O, Christenson JK, Denamur E, Gordon DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013;5(1):58-65. [PubMed ID: 23757131]. https://doi.org/10.1111/1758-2229.12019.
  • 4.
    Bingen E, Picard B, Brahimi N, Mathy S, Desjardins P, Elion J, et al. Phylogenetic analysis of Escherichia coli strains causing neonatal meningitis suggests horizontal gene transfer from a predominant pool of highly virulent B2 group strains. J Infect Dis. 1998;177(3):642-50. [PubMed ID: 9498443]. https://doi.org/10.1086/514217.
  • 5.
    Nowrouzian FL, Wold AE, Adlerberth I. Escherichia coli strains belonging to phylogenetic group B2 have superior capacity to persist in the intestinal microflora of infants. J Infect Dis. 2005;191(7):1078-83. [PubMed ID: 15747243]. https://doi.org/10.1086/427996.
  • 6.
    Clermont O, Christenson JK, Daubie AS, Gordon DM, Denamur E. Development of an allele-specific PCR for Escherichia coli B2 sub-typing, a rapid and easy to perform substitute of multilocus sequence typing. J Microbiol Methods. 2014;101:24-7. [PubMed ID: 24685601]. https://doi.org/10.1016/j.mimet.2014.03.008.
  • 7.
    Nowrouzian FL, Clermont O, Edin M, Ostblom A, Denamur E, Wold AE, et al. Escherichia coli B2 Phylogenetic Subgroups in the Infant Gut Microbiota: Predominance of Uropathogenic Lineages in Swedish Infants and Enteropathogenic Lineages in Pakistani Infants. Appl Environ Microbiol. 2019;85(24). [PubMed ID: 31562173]. [PubMed Central ID: PMC6881811]. https://doi.org/10.1128/AEM.01681-19.
  • 8.
    Beceiro A, Tomas M, Bou G. Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world? Clin Microbiol Rev. 2013;26(2):185-230. [PubMed ID: 23554414]. [PubMed Central ID: PMC3623377]. https://doi.org/10.1128/CMR.00059-12.
  • 9.
    Islam S, Selvarangan R, Kanwar N, McHenry R, Chappell JD, Halasa N, et al. Intestinal Carriage of Third-Generation Cephalosporin-Resistant and Extended-Spectrum beta-Lactamase-Producing Enterobacteriaceae in Healthy US Children. J Pediatric Infect Dis Soc. 2018;7(3):234-40. [PubMed ID: 28992133]. [PubMed Central ID: PMC5820225]. https://doi.org/10.1093/jpids/pix045.
  • 10.
    Mora FX, Aviles-Reyes RX, Guerrero-Latorre L, Fernandez-Moreira E. Atypical enteropathogenic Escherichia coli (aEPEC) in children under five years old with diarrhea in Quito (Ecuador). Int Microbiol. 2016;19(3):157-60. [PubMed ID: 28494085]. https://doi.org/10.2436/20.1501.01.273.
  • 11.
    Xicohtencatl-Cortes J, Cruz-Cordova A, Cazares-Dominguez V, Escalona-Venegas G, Zavala-Vega S, Arellano-Galindo J, et al. Uropathogenic Escherichia coli strains harboring tosA gene were associated to high virulence genes and a multidrug-resistant profile. Microb Pathog. 2019;134:103593. [PubMed ID: 31195111]. https://doi.org/10.1016/j.micpath.2019.103593.
  • 12.
    Taghadosi R, Shakibaie MR, Alizade H, Hosseini-Nave H, Askari A, Ghanbarpour R. Serogroups, subtypes and virulence factors of shiga toxin-producing Escherichia coli isolated from human, calves and goats in Kerman, Iran. Gastroenterol Hepatol Bed Bench. 2018;11(1):60-7. [PubMed ID: 29564067]. [PubMed Central ID: PMC5849120].
  • 13.
    Hinenoya A, Shima K, Asakura M, Nishimura K, Tsukamoto T, Ooka T, et al. Molecular characterization of cytolethal distending toxin gene-positive Escherichia coli from healthy cattle and swine in Nara, Japan. BMC Microbiol. 2014;14:97. [PubMed ID: 24742173]. [PubMed Central ID: PMC4001111]. https://doi.org/10.1186/1471-2180-14-97.
  • 14.
    Shokouhi Mostafavi S, Najar Peerayeh S, Mohabbati Mobarez A, Parizi MK. Detection of virulence factors, phylogroups, serogroups and biofilm formation among CTX-M-1 positive Escherichia coli isolated from patients with pyelonephritis. Biomed. Res. 2018;29(8). https://doi.org/10.4066/biomedicalresearch.29-18-270.
  • 15.
    Adwan G, Adwan K, Bourinee H. Molecular characterization of some new E. coli strains theoretically responsible for both intestinal and extraintestinal infections. Int. j. med. health res. 2016;5(6):158-63.
  • 16.
    Nyanga PL, Onyuka J, Webale MK, Were T, Budambula V. Escherichia coli pathotypes and Shigella sero-groups in diarrheic children in Nairobi city, Kenya. Gastroenterol Hepatol Bed Bench. 2017;10(3):220-8. [PubMed ID: 29118939]. [PubMed Central ID: PMC5660273].
  • 17.
    Spano LC, da Cunha KF, Monfardini MV, de Cassia Bergamaschi Fonseca R, Scaletsky ICA. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil. BMC Infect Dis. 2017;17(1):773. [PubMed ID: 29254489]. [PubMed Central ID: PMC5735577]. https://doi.org/10.1186/s12879-017-2872-0.
  • 18.
    Clermont O, Johnson JR, Menard M, Denamur E. Determination of Escherichia coli O types by allele-specific polymerase chain reaction: application to the O types involved in human septicemia. Diagn Microbiol Infect Dis. 2007;57(2):129-36. [PubMed ID: 17020797]. https://doi.org/10.1016/j.diagmicrobio.2006.08.007.
  • 19.
    Sapkota B, Yadav SK, Dhungana G, Ansari S, Mishra SK. Intestinal Carriage of Extended-Spectrum beta-Lactamase- (ESBL-) Possessing Escherichia coli and Klebsiella Species among Nepalese Health Science and Non-Health Science Students. Can J Infect Dis Med Microbiol. 2021;2021:4767429. [PubMed ID: 33897921]. [PubMed Central ID: PMC8052163]. https://doi.org/10.1155/2021/4767429.
  • 20.
    Alizade H, Fallah F, Ghanbarpour R, Aflatoonian MR, Goudarzi H, Sharifi H. Phylogenetic groups, extended-spectrum beta-lactamases and metallo-beta-lactamase in Escherichia coli isolated from fecal samples of patients with diarrhea in Iran. Gastroenterol Hepatol Bed Bench. 2015;8(3):207-14. [PubMed ID: 26328043]. [PubMed Central ID: PMC4553161].
  • 21.
    Nojoomi F, Ghasemian A. The relation of phylogroups, serogroups, virulence factors and resistance pattern of Escherichia coli isolated from children with septicemia. New Microbes New Infect. 2019;29:100517. [PubMed ID: 31080621]. [PubMed Central ID: PMC6501060]. https://doi.org/10.1016/j.nmni.2019.100517.
  • 22.
    Ferjani S, Saidani M, Hamzaoui Z, Alonso CA, Torres C, Maamar E, et al. Community fecal carriage of broad-spectrum cephalosporin-resistant Escherichia coli in Tunisian children. Diagn Microbiol Infect Dis. 2017;87(2):188-92. [PubMed ID: 27856044]. https://doi.org/10.1016/j.diagmicrobio.2016.03.008.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles