Frequency of Bacteria Causing Exudative Diarrhea in Children Less Than Five Years Old in a Tertiary Hospital, Iran

Author(s):
Masoumeh Sadat MontazeriMasoumeh Sadat Montazeri1, Hannan KhodaeiHannan KhodaeiHannan Khodaei ORCID1, Leila AzimiLeila AzimiLeila Azimi ORCID1,*, Masoud AlebouyehMasoud AlebouyehMasoud Alebouyeh ORCID1, Roxana Mansour GhanaieeRoxana Mansour GhanaieeRoxana Mansour Ghanaiee ORCID1, Mohammad RahbarMohammad RahbarMohammad Rahbar ORCID2, Abdollah KarimiAbdollah KarimiAbdollah Karimi ORCID1
1Pediatric Infections Research Center, Research Institute for Children’s Health, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Microbiology, Reference Health Laboratories Research Center, Ministry of Health and Medical Education, Tehran, Iran

Archives of Pediatric Infectious Diseases:Vol. 13, issue 1; e150600
Published online:Oct 13, 2024
Article type:Research Article
Received:Jul 07, 2024
Accepted:Aug 28, 2024
How to Cite:Montazeri MS, Khodaei H, Azimi L, Alebouyeh M, Mansour Ghanaiee R, et al. Frequency of Bacteria Causing Exudative Diarrhea in Children Less Than Five Years Old in a Tertiary Hospital, Iran. Arch Pediatr Infect Dis. 2025;13(1):e150600. doi: https://doi.org/10.5812/apid-150600

Abstract

Background:

Exudative diarrhea is a significant global public health issue, particularly affecting children under the age of 5. Identifying the cause of diarrhea is crucial for epidemiological surveillance and, in some cases, for ensuring appropriate treatment for patients.

Objectives:

The aim of this study was to investigate the frequency of bacteria responsible for exudative diarrhea in samples from children under five years old in a tertiary hospital in Iran.

Methods:

In this multicenter cross-sectional descriptive study, 104 children with exudative diarrhea who were referred to Mofid Children's Hospital in Tehran, as well as hospitals in Hamedan, Ardebil, and Bandar Abbas, from December 2020 to March 2022 were enrolled. DNA extraction was performed using a commercial kit, and the identification of various causative bacteria was conducted through conventional and real-time PCR. Descriptive and inferential statistics were analyzed using SPSS version 22 software.

Results:

Most of the children with exudative diarrhea were under 12 months old (31%) or between 12 and 24 months old (22%). Boys made up 66% of the participants. Additionally, 70% of the children had a fever, and 58% experienced vomiting. Furthermore, 56% of the patients were dehydrated. The most prevalent bacterial causes of exudative diarrhea were Shigella spp., followed by Salmonella spp., Campylobacter spp., Clostridium difficile, E. coli-Stx1, and E. coli-Stx2.

Conclusions:

The findings indicated that *Shigella* spp. was the leading cause of diarrhea in children under five years old. The most common signs and symptoms associated with exudative diarrhea were fever and vomiting, which physicians should consider in their diagnostic and treatment processes.

1. Background

Exudative diarrhea in children under five is characterized by the presence of abnormal blood, mucus, or pus in the stool, indicating inflammation or damage to the intestinal lining (1). This condition can be particularly severe in young children, often leading to dehydration and malnutrition (2, 3).
Clinical manifestations of exudative diarrhea include the presence of blood and/or mucus in the stool, increased stool frequency and volume, fever, nausea, abdominal pain, irritability, and mild to moderate dehydration (4-6). Bloody diarrhea is a clear indicator of exudative diarrhea, suggesting involvement of the lower intestine. The presence of white blood cells in the stool further signals an ongoing inflammatory process. Exudative diarrhea is generally more severe than watery or non-bloody diarrhea and, if untreated, can lead to complications such as electrolyte imbalances, malnutrition, and dehydration (7, 8).
The causes of exudative diarrhea are often multifactorial, involving various bacterial pathogens. Understanding the prevalence and distribution of these pathogens is essential for effective disease management and prevention (9). Research has shown that hospital-acquired diarrhea in this age group frequently involves diarrheagenic Escherichia coli (DEC) and Cryptosporidium, with DEC being the most commonly identified pathogen in hospital settings (5, 10, 11).
Polymerase chain reaction (PCR) has proven to be an effective molecular technique for the rapid and accurate detection of bacterial pathogens, enabling extensive epidemiological studies across different regions and populations (12). In Iran, exudative diarrhea remains a major health issue among children under five, contributing to increased morbidity and mortality. Despite the significant role of bacterial pathogens, comprehensive data on their frequency and distribution across various regions of Iran remain limited (13).

2. Objectives

The objective of this study was to examine the frequency of bacteria responsible for exudative diarrhea in samples from children under five years of age.

3. Methods

3.1. Study Design and Sampling

In this multicenter cross-sectional descriptive study, 104 children with exudative diarrhea, referred to Mofid Children's Hospital in Tehran, as well as hospitals in Hamedan, Ardebil, and Bandar Abbas between December 2020 and March 2022, were enrolled.

3.1.1. Inclusion Criteria

Children under five years of age with confirmed exudative diarrhea at the time of sampling were included in the study.

3.1.2. Exclusion Criteria

Children with diarrhea types other than exudative were excluded.

3.1.3. Sample Collection and Handling

Stool samples were collected from patients and transferred to the laboratory at the Pediatric Infections Research Center (PIRC) within six hours of collection.

3.1.4. Data Collection

A questionnaire was used to gather information regarding age, gender, clinical manifestations, and the bacterial agents identified in the exudative stool samples.
The study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences.

3.2. Samples Preparation

Stool samples were processed by adding 1000 µL of sterile, DNase- and RNase-free water to 5 grams of stool, followed by thorough mixing. The mixture was then centrifuged at 5000 rpm for 5 minutes to separate the upper supernatant, from which DNA was subsequently extracted.

3.3. Molecular Detection of Bacteria

The DNA extraction from all samples was performed using a commercial extraction kit (SIMBIOLAB Company) in accordance with the manufacturer’s protocol. The identification of causative bacteria was conducted using various PCR methods, as outlined in Table 1.
Table 1.Different Used Type of Polymerase Chain Reaction in This Study
MethodsBacteria
Multiplex RT-PCR aClostridium difficile
Yersinia enterocolitica
Multiplex conventional PCRCampylobacter spp.
Salmonella spp.
Multiplex conventional PCRE. coli-Stx1
E. coli-Stx2
Conventional PCRShigella spp.

a Real-time PCR

The primers and PCR conditions used in this study were based on those described in previous studies (14, 15). The specific primers used are listed in Table 2.
Table 2.Primers Used in This Study
Bacteria and Primer Sequencing 5’ to 3’Target GenesPCR Product Size (bp)References
C. difficile16srRNA157(14)
Forward, TTGAGCGATTTACTTCGGTAAAGA
Reverse, CCATCCTGTACTGGCTCACCT
Y. enterocoliticaail91
Forward, GGTCATGGTGATGTTGATTACTATTCA
Reverse, CGGCCCCCAGTAATCCATAA
Campylobacter spp.16srRNA812(15)
Forward, GGATGACACTTTTCGGAGC
Reverse, CATTGTAGCACGTGTGTC
Salmonella spp.ttRSBCA344
Forward, CCTGTCAGCCAAATATTACG
Reverse, ACGACGGGTTAAATTAGCCA
E. coli-Stx1stx1329
Forward, TGACAGTAGCTATACCACGT
Reverse, GAACAGAGTCTTGTCCATGA
E. coli-Stx2Stx2376
Forward, GGACCTCACTCTGAACTG
Reverse, CCGCCATTGCATTAACAGAA
Shigella spp.ipaH342
Forward, TGAAGTTTCTCTGCGAGCAT
Reverse, CAATACCTCCGGATTCCG

3.4. Statistical Analysis

Statistical analysis was performed using SPSS version 22 software (IBM, Chicago, USA). Quantitative data are reported as mean ± SD, and qualitative data are presented as counts (percentages). The chi-square test was conducted to assess the association between gender and age group in patients with exudative diarrhea. The results indicated no statistically significant relationship between the two variables (P = 0.0765), suggesting that gender distribution does not significantly vary across different age groups in this patient population.

4. Results

This study included children under the age of five, with most participants being either under 12 months (31%) or between 12 and 24 months (22%). Among the patients, 66% were male. Fever was present in approximately 70% of cases, while the remaining 30% had normal body temperature. Vomiting was reported in 58% of the patients, and 56% exhibited signs of dehydration. Additional details are provided in Table 3.
Table 3.Demographic and Clinical Characteristics of Patients (n = 104)
VariablesNo. (%)
Age (mo)
≥ 1233 (31)
13 - 2423 (22)
24 - 3612 (11)
36 - 489 (0.08)
48 - 609 (0.08)
< 6018 (0.17)
Gender
Male 69 (66)
Female35 (34)
Fever73 (70)
Dehydration44 (42)
Vomiting60 (58)
In this study, samples were collected from three cities, with 54.8% obtained from Tehran, 32.7% from Hamadan, and 4.8% from Bandar Abbas. The seasonal distribution of the samples is illustrated in Figure 1.
Sampling seasons
Figure 1.

Sampling seasons

DNA extraction was performed on 104 stool samples. The most common pathogens associated with exudative diarrhea were Shigella spp., Salmonella spp., Campylobacter spp., Clostridium difficile, E. coli-Stx1, and E. coli-Stx2, in that order. Specifically, Shigella spp. and Salmonella spp. were identified as the leading causes of exudative diarrhea, as shown in Figure 2.
Results of identification of positive bacterial agents and seasons
Figure 2.

Results of identification of positive bacterial agents and seasons

5. Discussion

This study aimed to investigate the frequency of the most common bacteria causing exudative diarrhea in children under five years of age across various cities in Iran. Our results revealed that the highest prevalence of diarrhea was observed in children aged 12 months or younger, with the lowest prevalence noted in those aged 36 - 48 and 48 - 60 months. This finding contrasts with Saeed et al.'s study, which reported the highest frequency of cases in the 49 - 60-month age group (66%), followed by the 37 - 48-month age group (18%) (14).
The gender distribution of the patients is also noteworthy, with 66% of the participants being male and 34% female. This aligns with Saeed et al.'s findings, where 55% of the cases were in male children (14), a trend observed in numerous previous studies (15).
Among the bacterial causes of exudative diarrhea, Shigella spp., Salmonella spp., Campylobacter spp., Clostridium difficile, E. coli-Stx1, and E. coli-Stx2 were identified as the most prevalent.
Figure 2 provides data on the bacterial agents identified in positive samples from patients with exudative diarrhea. A detailed analysis is as follows:
(1) Shigella spp.: This bacterium was the most frequently identified pathogen, found in 19 positive samples. Shigella spp. is a well-known cause of bacterial dysentery, particularly common in children under five years old, especially in developing regions. The high frequency of Shigella suggests it may be the leading cause of exudative diarrhea in this patient population.
(2) Salmonella spp.: Identified in 6 positive samples, Salmonella is a significant pathogen associated with gastrointestinal infections in children. Although less common than Shigella, it still contributes notably to diarrheal disease in this population.
(3) Campylobacter spp.: With 5 positive samples, Campylobacter spp. also plays a role in causing diarrhea in this group. Campylobacter is a common bacterial cause of gastroenteritis worldwide and is often linked to foodborne outbreaks.
(4) Clostridium difficile: Identified in 2 positive samples, Clostridium difficile is typically associated with antibiotic-related diarrhea and can cause severe illness in young children. Although its prevalence in this study is low, its presence is clinically significant, particularly in healthcare settings.
(5) E. coli (Stx1 and Stx2): Each of these shiga toxin-producing E. coli (STEC) strains was found in 1 positive sample. Although less frequently identified, these strains can cause severe diarrhea and complications like hemolytic-uremic syndrome (HUS). The low numbers suggest a limited but potentially severe role in disease within this cohort.
(6) Yersinia enterocolitica: No positive samples were identified for Yersinia enterocolitica. This bacterium is less common and may not be a significant contributor to diarrheal illness in this specific population or region.
In summary:
- Shigella spp. is the dominant pathogen in this study, highlighting it as a primary target for interventions and treatment strategies.
- Salmonella spp. and Campylobacter spp. are also important pathogens, though less frequent.
- The presence of Clostridium difficile and shiga toxin-producing E. coli (STEC) underscores the diversity of bacterial agents responsible for exudative diarrhea, albeit less commonly.
- Yersinia enterocolitica appears to be absent in this patient group.
The data from Figure 2 emphasize the need for targeted treatment strategies and public health interventions focusing on the most common bacterial agents like Shigella spp., while also accounting for the less frequent but clinically significant pathogens.
The prevalence of the most common bacteria responsible for exudative diarrhea in children under five years old across various cities in Iran was examined using PCR. In contrast, Abed and Hassan reported that E. coli was prevalent in 55.56% of diarrheal infections (16). Variations in methodology and differences in sample size may explain this discrepancy.
In northwest Iran, Shigella species, particularly S. sonnei, were found in 85.7% of diarrheal patients (13). This contrasts with our findings, likely due to the smaller sample size in our study.
In the study by Eybpoosh et al., E. coli pathotypes were the most prevalent among children under five, accounting for 73% of cases (3). A recent systematic review in Iran also highlighted ETEC as a major pathotype, with a pooled prevalence of 16% (95% CI: 11% - 23%) (17). Moreover, previous studies in Iran have frequently identified ETEC as a common cause of diarrhea in young children (18, 19). However, our study’s findings do not align with these observations, likely due to regional and methodological differences.
In the study by Saeed et al., 48% of 437 stool samples from children with diarrhea tested positive for Escherichia coli, 8% for Shigella spp., 4% for Salmonella spp., and 2% for Campylobacter spp. (14). These results are consistent with our findings. Similarly, Jafari et al. reported a high prevalence of Shigella species in 148 samples and shiga toxin-producing Escherichia coli (STEC) in 105 samples. Additionally, EAEC, EPEC, Campylobacter, Salmonella, and ETEC were found in 92, 70, 60, 42, and 38 samples, respectively. Jafari et al.'s study did not isolate Yersinia from the stool samples, and most of the children studied (464 cases) were under one year old (19).
These results align with our findings. Like the study by El Qouqa, Yersinia enterocolitica was not detected in our study, and only a few Salmonella infections were reported (20). Furthermore, Asadi et al. found E. coli to be the most common pathogen causing diarrhea in children aged 2 months to 12 years (21). Identifying the causative agents of diarrhea, achieving rapid and accurate diagnosis, and implementing effective management strategies are crucial for preventing outbreaks.
This study has several limitations. Firstly, the small sample size is a notable limitation. Secondly, while samples were collected from various hospitals in different cities, they may not fully represent the broader population of children under five years of age in Iran. Future research addressing these limitations could provide a more comprehensive understanding of the epidemiology of bacterial exudative diarrhea in Iranian children and aid in the development of more effective prevention and control measures.

5.1. Conclusions

In conclusion, Shigella spp. emerged as the primary cause of diarrhea in children under five years of age in our study. It is recommended that future research involve specific molecular epidemiology studies with larger sample sizes to more accurately identify and understand the prevalence of diarrhea-causing infections.
The generalizability of these results may be influenced by several factors. First, while the study focused on children under five across various cities in Iran, providing valuable insights into the prevalence of exudative diarrhea in this population, the findings may not be universally applicable to all regions or age groups. Geographical, environmental, and demographic differences could affect the distribution of diarrheal pathogens. Additionally, variations in study methodologies and sample sizes, as seen in comparisons with other studies, may limit the broader applicability of the results. Future research with larger, more diverse sample populations across different regions could enhance the generalizability of these findings and provide a clearer understanding of the epidemiology of bacterial diarrhea in children.

Acknowledgments

Footnotes

References

  • 1.
    Uchida T, Suzuki T, Kikuchi A, Kakuta F, Ishige T, Nakayama Y, et al. Comprehensive Targeted Sequencing Identifies Monogenic Disorders in Patients With Early-onset Refractory Diarrhea. J Pediatr Gastroenterol Nutr. 2020;71(3):333-9. [PubMed ID: 32487952]. https://doi.org/10.1097/mpg.0000000000002796.
  • 2.
    Radlović N, Leković Z, Vuletić B, Radlović V, Simić D. Acute Diarrhea in Children. Srp Arh Celok Lek. 2015;143(11-12):755-62. [PubMed ID: 26946776]. https://doi.org/10.2298/sarh1512755r.
  • 3.
    Eybpoosh S, Mostaan S, Gouya MM, Masoumi-Asl H, Owlia P, Eshrati B, et al. Frequency of five Escherichia Coli pathotypes in Iranian adults and children with acute diarrhea. PLoS One. 2021;16(2). e0245470. [PubMed ID: 33539359]. [PubMed Central ID: PMC7861387]. https://doi.org/10.1371/journal.pone.0245470.
  • 4.
    Susianto SC, Athiyyah AF, Paramitha AAPN, Koendhori EB, Sumitro KR, Darma A, et al. Clinical Characteristic of Bloody Diarrhea in Under- Five Pediatric Inpatients. Arch Ped Gastroenterol Hepatol Nutr. 2022;1(1):9-16. https://doi.org/10.58427/apghn.1.1.2022.9-16.
  • 5.
    Fardah Athiyyah A, Shigemura K, Kitagawa K, Agustina N, Darma A, Ranuh R, et al. Clinical manifestation of norovirus infection in children aged less than five years old admitted with acute diarrhea in Surabaya, Indonesia: a cross-sectional study. F1000Res. 2019;8:2130. [PubMed ID: 32201573]. [PubMed Central ID: PMC7065660]. https://doi.org/10.12688/f1000research.21069.3.
  • 6.
    Agustina N, Darma A, Ranuh R, Raharjo D, Shirakawa T, Fujisawa M, et al. Clinical manifestation of norovirus infection in children aged less than five years old admitted with acute diarrhea in Surabaya, Indonesia: a cross-sectional study. Peer. 2020.
  • 7.
    Arasaradnam RP, Brown S, Forbes A, Fox MR, Hungin P, Kelman L, et al. Guidelines for the investigation of chronic diarrhoea in adults: British Society of Gastroenterology, 3rd edition. Gut. 2018;67(8):1380-99. [PubMed ID: 29653941]. [PubMed Central ID: PMC6204957]. https://doi.org/10.1136/gutjnl-2017-315909.
  • 8.
    Juckett G, Trivedi R. Evaluation of chronic diarrhea. Am Fam Physician. 2011;84(10):1119-26. [PubMed ID: 22085666].
  • 9.
    Hodges K, Gill R. Infectious diarrhea: Cellular and molecular mechanisms. Gut Microbes. 2010;1(1):4-21. [PubMed ID: 21327112]. [PubMed Central ID: PMC3035144]. https://doi.org/10.4161/gmic.1.1.11036.
  • 10.
    Berhe H, Mihret A, Yitayih G. Prevalence of Diarrhea and Associated Factors among Children under-Five Years of Age in Enderta Woreda, Tigray, Northern Ethiopia, 2014. Int J Therapeut App. 2016;31:32-7. https://doi.org/10.20530/ijta_31_32-37.
  • 11.
    Moyo SJ, Gro N, Matee MI, Kitundu J, Myrmel H, Mylvaganam H, et al. Age specific aetiological agents of diarrhoea in hospitalized children aged less than five years in Dar es Salaam, Tanzania. BMC Pediatr. 2011;11:19. [PubMed ID: 21345186]. [PubMed Central ID: PMC3050719]. https://doi.org/10.1186/1471-2431-11-19.
  • 12.
    Ugboko HU, Nwinyi OC, Oranusi SU, Oyewale JO. Childhood diarrhoeal diseases in developing countries. Heliyon. 2020;6(4). e03690. [PubMed ID: 32322707]. [PubMed Central ID: PMC7160433]. https://doi.org/10.1016/j.heliyon.2020.e03690.
  • 13.
    Mogharab V, Rajput S. Factors associated with diarrhea in children under 12 years of age referred to Ostad Motahari hospital of Jahrom in 2020. J Family Med Prim Care. 2022;11(10):6170-6. [PubMed ID: 36618212]. [PubMed Central ID: PMC9810889]. https://doi.org/10.4103/jfmpc.jfmpc_342_22.
  • 14.
    Saeed A, Abd H, Sandstrom G. Microbial aetiology of acute diarrhoea in children under five years of age in Khartoum, Sudan. J Med Microbiol. 2015;64(Pt 4):432-7. [PubMed ID: 25713206]. [PubMed Central ID: PMC4635512]. https://doi.org/10.1099/jmm.0.000043.
  • 15.
    Nakogomi O, Pant AR, Sherchand O, Yokoo M, Sherchand JB. Burden of Enteropathogens Associated Diarrheal Diseases in Children Hospital, Nepal. Sci World. 1970;7(7):71-5. https://doi.org/10.3126/sw.v7i7.3830.
  • 16.
    Abed MH, Hassan MK. Detection of Diarrhoeagenic Escherichia Coli Among Other Bacterial Species Isolated from Children Patients by Automated Methods and Culture based Techniques. 2022 Int Symp Multidiscip Stu Innov Tech. 2022. p. 189-93.
  • 17.
    Zeighami H, Haghi F, Hajiahmadi F, Kashefiyeh M, Memariani M. Multi-drug-resistant enterotoxigenic and enterohemorrhagic Escherichia coli isolated from children with diarrhea. J Chemother. 2015;27(3):152-5. [PubMed ID: 24571245]. https://doi.org/10.1179/1973947813y.0000000161.
  • 18.
    Haghi F, Zeighami H, Hajiahmadi F, Khoshvaght H, Bayat M. Frequency and antimicrobial resistance of diarrhoeagenic Escherichia coli from young children in Iran. J Med Microbiol. 2014;63(Pt 3):427-32. [PubMed ID: 24281909]. https://doi.org/10.1099/jmm.0.064600-0.
  • 19.
    Jafari F, Garcia-Gil LJ, Salmanzadeh-Ahrabi S, Shokrzadeh L, Aslani MM, Pourhoseingholi MA, et al. Diagnosis and prevalence of enteropathogenic bacteria in children less than 5 years of age with acute diarrhea in Tehran children's hospitals. J Infect. 2009;58(1):21-7. [PubMed ID: 19117609]. https://doi.org/10.1016/j.jinf.2008.10.013.
  • 20.
    El Qouqa IA, El Jarou MA, Samaha AS, Al Afifi AS, Al Jarousha AM. Yersinia enterocolitica infection among children aged less than 12 years: a case-control study. Int J Infect Dis. 2011;15(1):e48-53. [PubMed ID: 21131221]. https://doi.org/10.1016/j.ijid.2010.09.010.
  • 21.
    Asadi L, Pourlak T, Ahmadi B, Aghamali M, Asgharzadeh M, Aghazadeh M, et al. Etiological Agents of Pediatric Diarrhea in Ardebil, Northwestern Iran. Arch Pediatr Infect Dis. 2018;6(1). e11771. https://doi.org/10.5812/pedinfect.11771.

Similar Articles

10
Jan
2018
Etiological Agents of Pediatric Diarrhea in Ardebil, Northwestern Iran

Etiological Agents of Pediatric Diarrhea in Ardebil, Northwestern Iran

Leila Asadi,
Tala Pourlak,
Behrooz Ahmadi,
Mina Aghamali,
Mohammad Asgharzadeh,
Mohammad Aghazadeh
,et al.

Asadi L, Pourlak T, Ahmadi B, Aghamali M, Asgharzadeh M, et al. Etiological Agents of Pediatric Diarrhea in Ardebil, Northwestern Iran. Arch Pediatr Infect Dis. 2018;6(1):e11771. doi: https://doi.org/10.5812/pedinfect.11771

31
Oct
2008

Epidemiology of Acute Diarrheal Diseases Among Children Under 5 Years of Age in Tehran, Iran

Ali Asghar Kolahi,
Mahmood Nabavi,
Mohammad Reza Sohrabi

Kolahi AA, Nabavi M, Sohrabi MR. Epidemiology of Acute Diarrheal Diseases Among Children Under 5 Years of Age in Tehran, Iran. Arch Clin Infect Dis. 2008;3(4):. doi:

30
Jun
2000

Prevalence of diarrhea caused by Enteropathogenic E.Coli in under one year old children

M Nasrolahi,
M Sharif

Nasrolahi M, Sharif M. Prevalence of diarrhea caused by Enteropathogenic E.Coli in under one year old children. J Inflamm Dis. 2024;4(1):e154699. doi:

18
Jul
2016

Characterization of Enteropathogenic Escherichia coli Associated with Diarrhea Among Iranian Infants

Mohammad Mohammadzadeh,
Hossein Goudarzi,
Hossein Dabiri,
Fatemeh Fallah

Mohammadzadeh M, Goudarzi H, Dabiri H, Fallah F. Characterization of Enteropathogenic Escherichia coli Associated with Diarrhea Among Iranian Infants. Arch Pediatr Infect Dis. 2017;5(1):e36920. doi: https://doi.org/10.5812/pedinfect.36920

15
Dec
2021
Arch Pediatr Infect Dis

Low Frequency of Adenovirus, Rotavirus, and Norovirus in Pediatric Diarrheal Samples from Central Iran

Elnaz Abbasi,
Mahdieh Mondanizadeh,
Alex van Belkum,
Ehsanollah Ghaznavi-Rad

Abbasi E, Mondanizadeh M, van Belkum A, Ghaznavi-Rad E. Low Frequency of Adenovirus, Rotavirus, and Norovirus in Pediatric Diarrheal Samples from Central Iran. Arch Pediatr Infect Dis. 2021;10(2):e118470. doi: https://doi.org/10.5812/pedinfect.118470


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles