SCCmec Typing of Methicillin-Resistant Staphylococcus aureus: An Eight Year Experience

Author(s):
Mohammad Fateh AmirkhizMohammad Fateh Amirkhiz1, Mohammad Ahangarzadeh RezaeeMohammad Ahangarzadeh RezaeeMohammad Ahangarzadeh Rezaee ORCID2,*, Alka HasaniAlka Hasani1, 2, Mohammad AghazadehMohammad Aghazadeh1, Behrooz NaghiliBehrooz Naghili2
1Department of Microbiology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, IR Iran
2Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, IR Iran

Archives of Pediatric Infectious Diseases:Vol. 3, issue 4; e30632
Published online:Oct 12, 2015
Article type:Research Article
Received:Jun 08, 2015
Accepted:Aug 27, 2015
How to Cite:Fateh Amirkhiz M, Ahangarzadeh Rezaee M, Hasani A, Aghazadeh M, Naghili B. SCCmec Typing of Methicillin-Resistant Staphylococcus aureus: An Eight Year Experience. Arch Pediatr Infect Dis. 2015;3(4):e30632. doi: https://doi.org/10.5812/pedinfect.30632

Abstract

Background:

Methicillin resistant Staphylococcus aureus strains (MRSA) are important pathogens that cause serious diseases in humans. Throughout the recent years, the spread of these strains has increased in medical environments and society, and has become a serious challenge in health systems. Therefore, it is vital to investigate the various MRSA types to identify the origins of the infections and to control the spread of these infections in hospitals.

Objectives:

The current study aimed to evaluate the different SCCmec types in MRSA isolates from hospitals of Tabriz, by staphylococcal cassette chromosome mec (SCCmec) typing.

Materials and Methods:

The present descriptive and retrospective study was performed on 151 selected S. aureus isolates obtained from clinical specimens who were referred to Tabriz university of medical sciences educational-health care centers from April 2005 to September 2012. MRSA isolates were identified by agar disk diffusion and mecA PCR assays. Ultimately, they were typified according to the genetic diversity of the chromosome cassette of SCCmec and ccr regions.

Results:

Of the 151 isolates, 53 were recognized as MRSA. All of these 53 samples were sensitive to teicoplanin and vancomycin. Antibiotic resistance patterns were as follows: azithromycin 56.6%, ciprofloxacin 28.3%, imipenem 11.3%, meropenem 9.4%, ofloxacin 13.2%, ceftriaxone 66%, cotrimoxazole 49.1%, gentamicin 52.8%, linezolid 11.3%, penicillin 90.6%, and rifampicin 5.7%. The majority of MRSA isolates belonged to SCCmec III (69.8%) followed by SCCmec IVc (7.5%), SCCmec IVa (3.8%), and SCCmec I (1.9%). Other types of SCCmec were not observed in the present study. Moreover, from the 53 MRSA samples, 9 were recognized as non-typable. However, staphylococcal cassette chromosome recombinase (ccr ) genetic complex analysis revealed that among the 53 studied samples, 4 isolates had ccr type 1 pattern, and 11 and 32 isolates had ccr type 2 and ccr type 3 pattern, respectively. Furthermore, 6 isolates were considered as non-typable with ccr -typing.

Conclusions:

As about 70% of methicillin-resistant isolates belonged to SCCmec III, the present study can conclude that, over an 8-year period, only one dominant and stable clone of MRSA strain was found in Tabriz hospitals. This finding could be a result of incorrect medical orientations, inadequate infection controlling policies, and insufficient preventive approaches.

1. Background

Methicillin-resistant Staphylococcus aureus (MRSA) strains have long been recognized as one of the major human pathogens responsible for a wide range of infections. Even presently, beta-lactams, such as penicillins, have fundamental roles in the treatment of staphylococcal infections. However, one of the most important causes of the penicillin resistance in S. aureus is the expression of the mecA gene. The mecA gene is encoded inside a mec operon, which is carried by the staphylococcal cassette chromosome, SCCmec (1). In addition to the mecA gene, all MRSA strains have other genes such as mecR1, ccr AB, ccr C, and j connective regions in SCCmec regions. Two essential parts in the SCCmec elements of staphylococci are the ccr and mec gene complexes. Furthermore, antibiotic resistance genes may possibly be present in the SCCmec region. Thus, ccr typing is a suitable method to determine the presence of SCCmec genes (2). The SCCmec chromosome cassette is divided into 8 different types (I-VIII). Generally types IV, V, VII are named as community acquired MRSA (CA-MRSA), and types I, II, III, VI, and VIII are called hospital acquired MRSA or HA-MRSA (2-5).
With most studies focusing on the evolutionary relationships between different MRSA strains (6-11), various molecular typing techniques were used for the epidemiological study of MRSA. Several studies have been conducted globally to determine the prevalence of various SCCmec types in different regions of the world (12-14). However, to the best of our knowledge, no comprehensive investigations have been performed regarding MRSA strain typing in Northwest Iran.

2. Objectives

The present study was designed and carried out in Tabriz hospitals to evaluate the prevalence of different SCCmec types in MRSA isolates over time (from April 2005 to September 2012). Furthermore, antimicrobial susceptibility patterns of the MRSA isolates were also determined. Such monitoring can determine the conditions of MRSA distribution in hospital communities.

3. Materials and Methods

In the present study, the sample population consisted of 151 non-duplicate S. aureus strains that were selected randomly from stock isolated during eight years from April 2005 to September 2012 in five educational hospitals of the Tabriz University of Medical Sciences, Iran. The isolates were collected from the various clinical specimens including, wounds, blood, urine, sputum, synovial and other body fluids of patients. All S. aureus isolates were identified with previously described standard morphological and biochemical methods such as growth on mannitol salt agar, colony morphology, gram staining, catalase, slide, or tube coagulase, and DNase tests (15).

3.1. Antimicrobial Susceptibility Tests

All S. aureus isolates were tested against 14 antibiotics using disc agar diffusion including: penicillin (10 U), oxacillin (1 µg), gentamicin (10 µg), trimethoprim-sulfamethoxazole (25 µg), rifampin (5 µg), vancomycin (30 µg), linezolid (30 µg), ceftriaxone (30 µg), ciprofloxacin (5 µg), ofloxacin (5 µg), imipenem (10 µg), meropenem (10 µg), teicoplanin (30 µg), and azithromycin (15 µg) (10). S. aureus ATCC 29213 was used as a control strain for the antibacterial susceptibility testing (16).

3.2. DNA Extraction

The extraction was carried out by applying the DNG kit (CinnaGen Co.) with a slight modification. Initially, each strain was incubated for 24 hours in LB broth medium and then transferred to a microtube and centrifuged at 8,000 rpm. Supernatant was discarded and the pellet was re-suspended in 100 µl of TE buffer, and heated to 95°C for 10 minutes. Next, 400 µl of CinnaGen DNG extraction solution was added, vortexed, and then 600 µl of isopropanol was added. It was then frozen at -20°C for 30 minutes, and centrifuged at 12,000 g. The supernatant was discarded, and the product was washed twice using 75% ethanol. Ultimately, the final product was re-suspended in 50 µl of TE buffer.

3.3. Amplification of nuc, mec, SCCmec, and ccr Complex Genes

3.3.1. Detection of nuc and mecA Genes

To confirm the identity of S. aureus isolates and methicillin resistance, polymerase chain reaction (PCR) assay was performed using the primers for the nuc and mecA genes. Table 1 shows and describes the process.
Table 1. Set of Primers Used In This Study a
PrimerSequence (5’→3’)Amplicon size, bpTarget geneReferences
Type I613SCCmec I(10)
FGCTTTAAAGAGTGTCGTTACAGG
RCGAAATCAATGGTTAATGGACC
Type II398SCCmec II(10)
FCGTTGAAGATGATGAAGCG
RCGAAATCAATGGTTAATGGACC
Type III280SCCmec III(10)
FCCATATTGTGTACGATGCG
RCCTTAGTTGTCGTAACAGATCG
Type IVa776SCCmec IVa(10)
FGCCTTATTCGAAGAAACCG
RCTACTCTTCTGAAAAGCGTCG
Type IVb493SCCmec IVb(10)
FTCTGGAATTACTTCAGCTGC
RAAACAATATTGCTCTCCCTC
Type IVc200SCCmec IVc(10)
FACAATATTTGTATTATCGGAGAGC
RTTGGTATGAGGTATTGCTGG
Type IVd881SCCmec IVd(10)
F5CTCAAAATACGGACCCCAATACA
R6TGCTCCAGTAATTGCTAAAG
Type V325SCCmec V(10)
FGAACATTGTTACTTAAATGAGCG
RTGAAAGTTGTACCCTTGACACC
nuc279nuc(15)
FGCGATTGATGGTGATACGGTT
RAGCCAAGCCTTGACGAACTAAAGC
MecA147147mecA(10)
FGTGAAGATATACCAAGTGATT
RATGCGCTATAGATTGAAAGGAT
ccrAB-β2ATTGCCTTGATAATAGCCITCT(16)
ccrAB-α2AACCTATATCATCAATCAGTACGT700Type 1 ccr(16)
ccrAB-α3TAAAGGCATCAATGCACAAACACT1000Type 2 ccr(16)
ccrAB-α4AGCTCAAAAGCAAGCAATAGAAT1600Type 3 ccr(16)

a Abbreviations: F, forward; R, reverse.

3.3.2. Amplification of SCCmec and the ccr Complex

SCCmec typing was performed by multiplex PCR using eight set of primers as previously described (Table 1). The PCR thermal cycling conditions included initial denaturation at 94°C for 5 minutes, followed by 10 cycles at 94°C for 45 seconds, 65°C for 45 seconds, and 72°C for 1.5 minutes, and another 25 cycles at 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1.5 minutes, ending with a final extension step at 72°C for 10 minutes, followed by a hold at 4°C.
The PCR assay for the staphylococcal ccr complex was performed using three single primers to distinguish the types 1 or 2 (Table 1) (17). Electrophoresis of products was carried out by 2% agarose gel containing 0.5 µg/ml ethidium bromide and visualized by a gel documentation system.

4. Results

4.1. Bacterial Isolation

A total of 151 S. aureus isolates collected over eight years were processed for their typing by SCCmec and ccr. From these, 53 S. aureus were confirmed as MRSA by PCR. Isolates were cultured from blood, wounds, urine, dialysis samples, sputum, pleural and synovial fluids, catheters, tracheal, abscesses, and bile aspirates.

4.2. MRSA Typing

As shown in Table 2, and Figures 1 and 2, four types of SCCmec and three different types of ccr complex were identified among the studied isolates. Accordingly, SCCmec III was the most prevalent, followed by type IVc, type Via, and type I. Nine (17%) of the MRSA isolates could not be typed in this manner. On ccr typing, the ccr -complex III was recognized as the dominant type, followed by type II and type I, while 6 MRSA isolates were non-typable by ccr region polymorphism.
Table 2. Frequency of Distinguished SCCmec With Their ccr Elements a
SCCmec typeccr typeNumber of IsolatesMRSA type
I11 (1.9%)HA-MRSA
III12 (3.8%)HA-MRSA
III25 (9.4%)HA-MRSA
III330 (56.6%)CA-MRSA
IVa22 (3.8%)CA-MRSA
IVc24 (7.5%)CA-MRSA
-11 (1.9%)Non-typable
-32 (3.8%)Non-typable
--6 (11.3%)Non-typable
Total = 53 (100)

a Values are presented as No. (%).

Lane 3: 100 bp ladder (Fermentas); lane 1: <i>mec</i>A (147 bp) and <i>nuc</i> gene (279 bp); lane 2: SCC<i>mec</i> I (613 bp); lane 4: SCC<i>mec</i> III (280 bp); lane 5: SCC<i>mec</i> IVa (776 bp); lane 6: SCC<i>mec</i> IVc (200 bp).
Figure 1.

Lane 3: 100 bp ladder (Fermentas); lane 1: mecA (147 bp) and nuc gene (279 bp); lane 2: SCCmec I (613 bp); lane 4: SCCmec III (280 bp); lane 5: SCCmec IVa (776 bp); lane 6: SCCmec IVc (200 bp).

Lane 1: 1 kbp ladder (Fermentas); lane 2: <i>ccr </i>type 1 (700 kbp); lane 3: <i>ccr</i> type 2 (1000 kbp), lane 4: <i>ccr</i> type 3 (1600 kbp).
Figure 2.

Lane 1: 1 kbp ladder (Fermentas); lane 2: ccr type 1 (700 kbp); lane 3: ccr type 2 (1000 kbp), lane 4: ccr type 3 (1600 kbp).

4.3. Antimicrobial Resistance

Table 3 briefly explains the antimicrobial resistant profiles of the MRSA isolates. As shown, there was complete susceptibility to teicoplanin and vancomycin in all 53 investigated MRSA isolates. Our results were showed a reduced gradient of MRSA susceptibility to ofloxacin, ceftriaxone, cotrimoxazole, gentamicin, azithromycin, rifampicin, ciprofloxacin, and linezolid. All strains were resistant to penicillin; however, only less than 10% were resistant to meropenem and rifampicin.
Table 3. Antimicrobial Resistance Profiles of MRSA Isolates
AntibioticResistantIntermediateSensitive
Ciprofloxacin15 (28.3%)20 (37.7%)18 (34%)
Azithromycin30 (56.6%)2 (3.8%)21 (39.6%)
Meropenem5 (9.4%)-48 (90.6%)
Teicoplanin--53 (100%)
Imipenem6 (11.3%)1 (1.9%)46 (86.8%)
Ofloxacin7 (13.2%)1 (1.9%)45 (84.9%)
Ceftriaxone35 (66%)-18 (34%)
Cotrimoxazole26 (49.1%)-27 (50.9%)
Gentamicin28 (52.8%)-25 (47.2%)
Linezolid6 (11.3%)-47 (88.7%)
Oxacillin53 (100%)--
Penicillin53 (100%)--
Rifampicin3 (5.7%)-50 (94.3%)
Vancomycin--53 (100%)

5. Discussion

SCCmec is the most important factor defining the origin and source of MRSA infections in society. If we could determine HA-MRSA or CA-MRSA, then we could manage MRSA infections and select the best treatment protocol (1). Each type of SCCmec has unique genetic elements. Eight types of SCCmec and 3 types of ccr genes were investigated in this research (12-19). We were recognized 4 types of SCCmec and among them, type III was the most prevalent in our isolates.
Recently, MRSA infections have raised global concerns. Therefore, its prevalence in most countries has been highlighted (20-23) because the determination of MRSA prevalence or spread through transmission within communities may influence how this problem will be addressed.
In the present investigation, the rate of methicillin resistance among S. aureus isolates was 33.8%, which is lower than the prevalence of MRSA in previous studies from Shahid Beheshti Hospital in Kashan, and Imam Hussein Hospital in Tehran (24, 25). This could be from the correct usage of antibiotic in our province. The prevalence of MRSA in Greece, Italy, France, and Turkey was similar to our results, but in Germany, Poland, Spain, Sweden, and Switzerland the prevalence of these isolates was lower than our results (26). This could be a result of their developed health systems. Regarding Table 3, the antibiotic susceptibility test revealed that all samples were sensitive to teicoplanin and vancomycin. Resistances to rifampin and meropenem were less than 10%, and resistances to cotrimoxazole, azithromycin, gentamicin, ceftriaxone, penicillin, oxacillin, clindamycin, and erythromycin were between 50% and 100%. However, some antibiotics, such as rifampicin, imipenem, meropenem, ofloxacin, and linezolid, were still effective against MRSA in this work; indicating that these agents may be applicable in the treatment of MRSA infections. SCCmec analysis identified 69.8% of MRSA isolates as type III, suggesting that most of the MRSA isolates in the present study may have originated from HA-MRSA or clonal diversion of MRSA. These results were consistent with previous reports about the predominance of SCCmec III in most Asian countries (27), and in Iranian cities. The next predominant type was SCCmec IVc (7.5%) followed by type IVa (3.8%), which was also confirmed by the present study and is supported by other research (13). However, we could investigate other genes correlated with SCCmec to determine more types of SCCmec, and this could be a limitation of the current research.
Obtained data showed that in the Iranian East-Azerbaijan Province, SCCmec III was the predominant SCCi type. As a result, multidrug-resistance in our province could be high. Furthermore, typing of isolates using ccr-complex verified our data about SCCmec.
The data indicate that multidrug-resistant MRSA in our isolates has caused serious problems that result from the inappropriate use of antibiotics. Therefore, physicians should prescribe suitable antibiotics based on their effectiveness, price, and accessibility.

Acknowledgments

Footnotes

References

  • 1.
    Brooks GF, Carroll K. C, Butel JS, Morse SA. Jawetz, Melnick & Adelberg's Medical Microbiology. USA: The McGraw-Hill Co; 2013.
  • 2.
    Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, Ravel J, et al. Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol. 2005;187(7):2426-38. [PubMed ID: 15774886]. https://doi.org/10.1128/JB.187.7.2426-2438.2005.
  • 3.
    Chambers HF, Deleo FR. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol. 2009;7(9):629-41. [PubMed ID: 19680247]. https://doi.org/10.1038/nrmicro2200.
  • 4.
    Ma XX, Ito T, Tiensasitorn C, Jamklang M, Chongtrakool P, Boyle-Vavra S, et al. Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents Chemother. 2002;46(4):1147-52. [PubMed ID: 11897611].
  • 5.
    Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki KI, Oguchi A, et al. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet. 2002;359:1819-27.
  • 6.
    Crisostomo MI, Westh H, Tomasz A, Chung M, Oliveira DC, de Lencastre H. The evolution of methicillin resistance in Staphylococcus aureus: similarity of genetic backgrounds in historically early methicillin-susceptible and -resistant isolates and contemporary epidemic clones. Proc Natl Acad Sci U S A. 2001;98(17):9865-70. [PubMed ID: 11481426]. https://doi.org/10.1073/pnas.161272898.
  • 7.
    Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38(3):1008-15. [PubMed ID: 10698988].
  • 8.
    Geha DJ, Uhl JR, Gustaferro CA, Persing DH. Multiplex PCR for identification of methicillin-resistant staphylococci in the clinical laboratory. J Clin Microbiol. 1994;32(7):1768-72. [PubMed ID: 7929772].
  • 9.
    Goering RV. Molecular epidemiology of nosocomial infection: analysis of chromosomal restriction fragment patterns by pulsed-field gel electrophoresis. Infect Control Hosp Epidemiol. 1993;14(10):595-600. [PubMed ID: 7901269].
  • 10.
    Navidinia M, Fallah F, Lajevardi B, Shirdoost M, Jamali J. Epidemiology of Methicillin-Resistant Staphylococcus aureus Isolated From Health Care Providers in Mofid Children Hospital. Archives of Pediatric Infectious Diseases. 2015;3(2). https://doi.org/10.5812/pedinfect.16458.
  • 11.
    Navidinia M. Detection of inducible clindamycin resistance (MLSBi) among methicillin-resistant Staphylococcus aureus (MRSA) isolated from health care providers. J Paramed Sci. 2015;6(1):91-6.
  • 12.
    Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43(10):5026-33. [PubMed ID: 16207957]. https://doi.org/10.1128/JCM.43.10.5026-5033.2005.
  • 13.
    Japoni A, Jamalidoust F, Mazyar Z, Alborzi A, Japoni S, Rafaatpour N. Characterization of SCCmec types and antibacterial suseptibility patterns of methicillin-resistant Staphylococcus aureus in Southern Iran. Jpn J Infect Dis. 2011;64(1):28-33.
  • 14.
    Ito T, Okuma K, Ma XX, Yuzawa H, Hiramatsu K. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resistance Updates. 2003;6(1):41-52. https://doi.org/10.1016/s1368-7646(03)00003-7.
  • 15.
    Murray PR. Manual of Clinical Microbiology. Washington: American Society for Microbiology Press; 2003.
  • 16.
    Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing.Twenty-Second informational supplement (M100-S22). Wayne; 2012.
  • 17.
    Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol. 1992;30(7):1654-60. [PubMed ID: 1629319].
  • 18.
    Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiensasitorn C, et al. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2001;45(5):1323-36. [PubMed ID: 11302791]. https://doi.org/10.1128/AAC.45.5.1323-1336.2001.
  • 19.
    Oliveira DC, Tomasz A, de Lencastre H. Secrets of success of a human pathogen: molecular evolution of pandemic clones of meticillin-resistant Staphylococcus aureus. The Lancet Infectious Diseases. 2002;2(3):180-9. https://doi.org/10.1016/s1473-3099(02)00227-x.
  • 20.
    Al-Hazzani A. Molecular subtyping of multiresistant community associated methicillin-resistant Staphylococcus aureus isolates in Riyadh, Saudi Arabia. Afr J Microbiol. 2011;5(11):1252-60.
  • 21.
    Peng Q, Hou B, Zhou S, Huang Y, Hua D. Staphylococcal cassette chromosome mec (SCCmec) analysis and antimicrobial susceptibility profiles of methicillin-resistant Staphylococcus aureus (MRSA) isolates in a teaching hospital, Shantou, China. Afr J Microbiol. 2010;4(9):844-8.
  • 22.
    Kilic A, Guclu AU, Senses Z, Bedir O, Aydogan H, Basustaoglu AC. Staphylococcal cassette chromosome mec (SCCmec) characterization and panton-valentine leukocidin gene occurrence for methicillin-resistant Staphylococcus aureus in Turkey, from 2003 to 2006. Antonie Van Leeuwenhoek. 2008;94(4):607-14. [PubMed ID: 18752036]. https://doi.org/10.1007/s10482-008-9278-3.
  • 23.
    Awad Al-Ruaily M, Mohamed Khalil O. Detection of mecA gene in methicillin resistant Staphylococcus aureus (MRSA) at Prince A/Rhman Sidery Hospital, Al-Jouf, Saudi Arabia. J Med Genet. 2011;3(3):41-5.
  • 24.
    Zeinali E, Moniri R, Safari M, Mousavi GA. Molecular characterization and SCCmec typing in meticillin-resistant Staphylococcus aureus isolated from clinical samples. J Kashan Univ Med Sci. 2011;14(4):439-46.
  • 25.
    Fatholahzadeh B, Emaneini M, Aligholi M, Gilbert G, Taherikalani M, Jonaidi N, et al. Molecular characterization of methicillin-resistant Staphylococcus aureus clones from a teaching hospital in Tehran. Jpn J Infect Dis. 2009;62(4):309-11. [PubMed ID: 19628913].
  • 26.
    Sader H, Watters A, Fritsche T, Jones R. Daptomycin antimicrobial activity tested against methicillin-resistant staphylococci and vancomycin-resistant enterococci isolated in European medical centers. BMC Infect Dis. 2007;(29):1-9.
  • 27.
    Chongtrakool P, Ito T, Ma XX, Kondo Y, Trakulsomboon S, Tiensasitorn C, et al. Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements. Antimicrob Agents Chemother. 2006;50(3):1001-12. [PubMed ID: 16495263]. https://doi.org/10.1128/AAC.50.3.1001-1012.2006.

Similar Articles

27
Jun
2015

Emergence of SCCmec Type I Obtained From Clinical Samples in Shiraz Teaching Hospitals, South-West of Iran

Hadi Sedigh Ebrahim-Saraie,
Mohammad Motamedifar,
Jamal Sarvari,
Seyedeh Mahsan Hoseini Alfatemi

Ebrahim-Saraie HS, Motamedifar M, Sarvari J, Hoseini Alfatemi SM. Emergence of SCCmec Type I Obtained From Clinical Samples in Shiraz Teaching Hospitals, South-West of Iran. Jundishapur J Microbiol. 2015;8(6):e16998. doi: https://doi.org/10.5812/jjm.16998v2

17
Jul
2016

Staphylococcal Cassette Chromosome mec Types Among Methicillin-Resistant Staphylococcus aureus in Northern Iran

Akram Taherirad,
Roghayeh Jahanbakhsh,
Fatemeh Shakeri,
Shaghayegh Anvary,
Ezzat Allah Ghaemi

Taherirad A, Jahanbakhsh R, Shakeri F, Anvary S, Ghaemi EA. Staphylococcal Cassette Chromosome mec Types Among Methicillin-Resistant Staphylococcus aureus in Northern Iran. Jundishapur J Microbiol. 2016;9(8):e33933. doi: https://doi.org/10.5812/jjm.33933

5
Apr
2020
Jundishapur Journal of Microbiology

Staphylococcal Cassette Chromosome mec Typing of Meticillin-Resistant Staphylococcus aureus in Kermanshah Province, West of Iran

Yahyah Hesari,
Nasrollah Sohrabi,
Ramin Abiri,
Sajjad Babaei,
Zohreh Amiri

Hesari Y, Sohrabi N, Abiri R, Babaei S, Amiri Z. Staphylococcal Cassette Chromosome mec Typing of Meticillin-Resistant Staphylococcus aureus in Kermanshah Province, West of Iran. Jundishapur J Microbiol. 2020;13(3):e98852. doi: https://doi.org/10.5812/jjm.98852

31
Dec
2024
Jundishapur J Microbiol

Methicillin-Resistant Staphylococcus aureus Isolated from Central Region of Iran: Antibiotic Resistance and SCCmecA Types

Seyed Ali Fatehi Fazli,
Mehdi Fatahi-Bafghii,
Mahmoud Vakili,
Maryam Sadeh

Fatehi Fazli SA, Fatahi-Bafghii M, Vakili M, Sadeh M. Methicillin-Resistant Staphylococcus aureus Isolated from Central Region of Iran: Antibiotic Resistance and SCCmecA Types. Jundishapur J Microbiol. 2024;17(12):e156747. doi: https://doi.org/10.5812/jjm-156747

17
May
2017

Prevalence and Genotyping of Methicillin-Resistant and - Susceptible Staphylococcus aureus Strains Isolated from Patients in a University Hospital, Isfahan, Iran

Seyed Asghar Havaei,
Mehrdad Halaji,
Sinisa Vidovic,
Jo-Anne R. Dillon,
Mohsen Karbalaei,
Fahimeh Ghanbari
,et al.

Havaei SA, Halaji M, Vidovic S, R. Dillon J, Karbalaei M, et al. Prevalence and Genotyping of Methicillin-Resistant and - Susceptible Staphylococcus aureus Strains Isolated from Patients in a University Hospital, Isfahan, Iran. Jundishapur J Microbiol. 2017;10(5):e13571. doi: https://doi.org/10.5812/jjm.13571


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles