1. Background
Urinary tract infection (UTI) refers to an infection by microbial pathogens at any site of the urinary tract, which includes the urethra, bladder, ureter, and kidneys. UTI is one of the most common bacterial infections in children; many affected children, especially infants, have severe symptoms and complications (1). It is estimated that UTI is diagnosed in 1% of boys and 3% - 8% of girls (2). The most common cause of UTI in children is Uropathogenic Escherichia coli (UPEC). The UPEC strains harbor many virulence genes that are involved in pathogenesis of UTIs (1). There is a well-established hypothesis indicating UPEC is an evolved strain of non-pathogenic strains that has gained new virulence factors in the process of horizontal transfer of DNA (3). The UPEC strains harbor various virulence factors that contribute to the development of the infectious process, such as adhesins, toxins, serum resistance and invasion that are needed to overcome the host defense system (4).
Adhesion of E. coli to uroepithelial cells may protect the bacteria from washing by urine flow, increasing their ability to multiply and invade renal tissue. Pap (pyelonephritis-associated pili) and Afa (afimbrial adhesin) are the most commonly found adhesins (5). The binding of P-fimbrial adhesin to cell receptors of the renal tissue triggers specific signaling pathways leading to mucosal inflammation and tissue damage (4). Afimbrial adhesin Afa has been implicated in the development of chronic interstitial nephritis. Clinical findings suggest that UPEC strains with Afa adhesins have properties that favor the occurrence of recurrent and chronic UTIs (3).
Apart from adhesins, exotoxins such as α-hemolysin and cytotoxic necrotizing factor 1 (CNF1) are also important virulence factors. HlyA (α-haemolysin) lipoprotein is the most important secreted virulence factor of UPEC strains (6). The cytolytic effect of HlyA encoded by α-hly plays a role in the invasion of bacteria through the epithelial barrier (4). This toxin is able to lyse nucleated host cells for several reasons: better crossing of the mucosal barriers, having access to host nutrients and iron stores, damaging effectors immune cells, and inducing the apoptosis in T lymphocytes, neutrophils, and renal cells (6). Cytotoxic necrotizing factor 1 (CNF1) has been shown to have a role in dissemination and persistence of cells in the urinary tract. This toxin causes bladder cell exfoliation and increases bacterial access to the underlying tissue (4).
Urinary tract infections, which are non-properly managed from their onset, can become a real threat ultimately leading to renal failure. Drug-resistant UPEC strains, which are increasing in prevalence worldwide, may cause significant deleterious impacts on the clinical management of UTI (1).
2. Objectives
A few studies have examined the virulence properties and antibiotic resistance of UPEC isolated from children in Sanandaj, Iran. Therefore, in this study, we sought to identify the prevalence and expression patterns of the most important virulence genes involved in the development of UTI including pap, afa, hly, and cnf1 (4, 6-8). Also, we aimed to evaluate antimicrobial resistance among E. coli strains isolated from children with UTIs in Sanandaj. The study gives insights into the current antibiotic resistance pattern and virulence properties in UPEC isolated from children in this part of the country.
3. Methods
3.1. Bacterial Isolates and Identification
In this cross-sectional study, 32 non-duplicate consecutive UPEC strains were isolated in spring 2015 (between April and June) from children with UTIs aged 0 - 12 years admitted to Besat and Tohid tertiary hospitals in Sanandaj, Iran. Sanandaj is the center of Kurdistan province in the west of Iran with a population of more than 480,000. Tohid and Besat are two referral and teaching general hospitals that are affiliated to Kurdistan University of Medical Sciences. Any case with positive urine culture of ≥ 105 colony-forming units (cfu)/mL was considered as UTI. The E. coli isolates were identified based on various standard bacteriological and biochemical methods such as Gram staining, typical morphology, lactose fermentation, production of gas, indole test, citrate utilization, motility, lysine decarboxylation, methyl red, Voges-Proskauer, etc. (9). All bacterial isolates were stored at -70°C in tryptic soy broth (Quelab, New Mexico, U.S.) containing 15% glycerol.
3.2. Antibiotic Susceptibility Test
The susceptibility of bacterial strains to antibiotics were determined using disk diffusion method conducted on Mueller-Hinton agar plates (Merck, Germany) as per the 2014 guidelines of clinical and laboratory standards institute (CLSI) (10). The disks used in the susceptibility test contained the following antibiotics (Rosco company, Denmark): ampicillin (10 μg), cefotaxime (30 μg), ceftazidime (30 μg), imipenem (10 μg), amoxicillin/clavulanic acid (30 μg), aztreonam (30 μg), ciprofloxacin (5μg), tetracycline (30 μg), trimethoprim/sulfamethoxazole, gentamicin (10 μg), cefepime (30 μg), cefoxitin (30 μg), amikacin (30 μg), norfloxacin (10 μg), nalidixic acid (30 μg), and nitrofurantoin (300 μg). The susceptibility of isolates to each antimicrobial agent was measured. E. coli ATCC 25922 was used as quality control.
3.3. DNA Extraction
Genomic DNA was prepared by the freeze-thaw method and used as the template for PCR (11). E. coli strains were grown in brain-heart infusion (BHI) broth (Quelab, New Mexico, U.S.) at 37°C overnight. The bacterial cells were then pelleted from 1 mL BHI broth and suspended in 200 µL of sterile distilled water, followed by incubation at 100°C for 10 minutes. The suspensions were immediately placed on ice for 5 minutes. Samples taken through a total of 3 freeze-thaw cycles were centrifuged and the supernatants were stored at -20°C as template DNA stocks.
3.4. Detection of Virulence Genes
Specific primers (SinaClon, Iran) were used to amplify sequences of the pap, afa, hly, and cnf-1 genes. Details of primer sequences and predicted sizes of the amplified products are shown in Table 1. Amplification of bacterial DNA was done in a total volume of 25 µL containing 3 µL DNA extract, 0.4 µM of each primer, 1X PCR buffer, 1.5 mM MgCl2, 200 µM of each dNTP, and 1 U Taq DNA polymerase (SinaClon, Iran). The amplification was performed in a thermal cycler (Eppendorf, Germany) under the following conditions: Initial denaturation at 94°C for 5 minutes; then 35 cycles of denaturation at 94°C for 1 minutes, annealing at 65°C for 1 minutes, and extension at 72°C for 1 minutes followed by a final elongation at 72°C for 7 minutes. Conditions were the same for all genes. The PCR products were electrophoresed in a 1% agarose gel (SinaClon, Iran) in 0.5X TBE (Tris-Borate-EDTA) buffer, stained with DNA safe stain (SinaClon, Iran), and photographed using a UV transillumination imaging system. The size of the amplicons was estimated by comparing them to a 100 bp Plus DNA ladder (SinaClon, Iran). The positive strains were kindly provided by Dr. S. Najar Peerayeh (Tarbiat Modares University, Tehran) and Dr. A. Rashki (University of Zabol, Zabol).
Table 1. Sequence of Primers Used to Detect Virulence Genes and Predicted Sizes of the Amplified Products of PCR
| Target | Primer Name | Primer Sequence (5’ - 3’) | Size of Amplicons, bp | Reference |
|---|---|---|---|---|
| pap | Pap1 | GACGGCTGTACTGCAGGGTGTGGCG | 328 | (12) |
| Pap2 | ATATCCTTTCTGCAGGGATGCAATA | |||
| afa | afa1 | GCTGGGCAGCAAACTGATAACTCTC | 750 | (12) |
| afa2 | CATCAAGCTGTTTGTTCGTCCGCCG | |||
| hly | hly1 | AACAAGGATAAGCACTGTTCTGGCT | 1177 | (13) |
| hly2 | ACCATATAAGCGGTCATTCCCGTCA | |||
| cnf | cnf1 | AAGATGGAGTTTCCTATGCAGGAG | 498 | (13) |
| cnf2 | CATTCAGAGTCCTGCCCTCATTATT |
3.5. Statistical Analysis
All statistical analyses were performed using SPSS version 16.0 (SPSS Inc., Chicago, USA). Data were analyzed using Pearson’s Chi-square test and Fisher’s exact test. A P value < 0.05 was considered statistically significant.
4. Results
A total of 32 UPEC strains were collected from children with UTI aged 0 - 12 years between April and June 2015. The male to female ratio in the study group was approximately 1:2 (10 males and 22 females) and the mean age was approximately 6 years. Twenty-one out of 32 patients were hospitalized while 11 were outpatients.
A total of 19 (59.4%) isolates were found to harbor at least one of the four virulence genes investigated. With regard to adhesion virulence determinants, the pap gene was present in 25% (8) and afa in 15.6% (5) of the 32 isolates. Among the genes encoding toxins, hly was found in 15.6% (5), while cnf was present in 25% (8) of the 32 isolates. Thirteen strains were negative for all the studied virulence genes. The hly and pap gens were found more frequently in females than males (18.2% vs. 10%; 27.3% vs. 20%, respectively). By contrast, females expressed a lower prevalence of cnf and afa than males (18.2% vs. 40%; 13.6% vs. 20%, respectively). However, the prevalence of virulence genes was not significantly different based on sex group (P > 0.05).
With the exception of afa gene that was detected more prevalently in the outpatient group than the inpatient group (4/11, 36.4% vs. 1/21, 4.8%), the prevalence of other virulence genes was higher in the inpatient group. The cnf, hly, and pap genes were present in 28.6%, 19%, and 28.6% of the 21 strains isolated from inpatients, respectively; while they were found in 18.2%, 9.1% and 18.2% of the 11 strains collected from outpatients, respectively. No statistically significant difference was seen between the two groups concerning the prevalence of virulence factors (P > 0.05), except for afa that was more expressed in outpatients (P = 0.019).
The isolated strains were classified in eight patterns of virulence gene expression according to various targeted sequences. The patterns are referred to as Ec followed by an Arabic numeral (Table 2). The Ec1 pattern that lacked the studied virulence genes was the most commonly detected pattern (found in 13 isolates), followed by Ec7 (found in 7 isolates) that was characterized by the presence of cnf gene only. The Ec3, Ec4, and Ec6 patterns were detected only in the hospitalized patients. The Ec2 profile which was detected only in the outpatient group and characterized by the presence of afa gene showed a meaningful distribution between the in- and out-patient groups (P = 0.012). The maximum number of detected amplicons in one strain was three of the targeted virulence gene regions. A significant association was detected between the simultaneous presence of hly and pap virulence genes (P = 0.002), which corresponded to 12.5% of the UPEC strains. Two isolates carried both pap and afa genes, and one isolate carried both pap and cnf genes, although no significance was observed according to Chi-square and Fisher’s tests.
Table 2. Virulence Patterns Identified Among 32 Uropathogenic Escherichia coli Isolated from Children
| Pattern | Virulence Gene | No. of Positive Strains in Hospitalized Patients | No. of Positive Strains in Outpatients | Total No. of Strains | |||
|---|---|---|---|---|---|---|---|
| hly | afa | pap | cnf | ||||
| Ec1 | - | - | - | - | 9 | 4 | 13 |
| Ec2 | - | + | - | - | 0 | 3 | 3 |
| Ec3 | + | - | - | - | 1 | 0 | 1 |
| Ec4 | + | - | + | + | 1 | 0 | 1 |
| Ec5 | + | - | + | - | 2 | 1 | 3 |
| Ec6 | - | - | + | - | 2 | 0 | 2 |
| Ec7 | - | - | - | + | 5 | 2 | 7 |
| Ec8 | - | + | + | - | 1 | 1 | 2 |
Antibiotic susceptibility of the UPEC strains was carried out using different classes of antibiotics. Of the 32 isolates, 96.9% were susceptible to nitrofurantoin (n = 31), 93.8% to imipenem (n = 30), and 90.6% to cefoxitin (n = 29). The least effective antibiotics were cefotaxime, ampicillin, and trimethoprim/sulfamethoxazole, which gave the susceptibility rates of 34.4%, 28.1%, and 21.9%, respectively (Table 3). Isolates from inpatients were more susceptible to cefotaxime, ceftazidime, cefepime, tetracycline, amoxicillin/clavulanic acid, imipenem, norfloxacin, nalidixic acid, and ciprofloxacin compared to the isolates from out-patients (Table 3).
Table 3. Antimicrobial Susceptibility of 32 Uropathogenic Escherichia coli Isolated from in- and Out-Patient Groupsa
| Antibiotic | Susceptibility | ||
|---|---|---|---|
| Inpatients (n = 21) | Outpatients (n = 11) | Total (n = 32) | |
| Nitrofurantoin | 20 (95.2) | 11 (100) | 31 (96.9) |
| Imipenem | 21 (100) | 9 (81.8) | 30 (93.8) |
| Cefoxitin | 19 (90.5) | 10 (90.9) | 29 (90.6) |
| Amoxicillin/clavulanic acid | 19 (90.5) | 9 (81.8) | 28 (87.5) |
| Amikacin | 18 (85.7) | 10 (90.9) | 28 (87.5) |
| Norfloxacin | 16 (76.2) | 6 (54.5) | 22 (68.8) |
| Gentamicin | 13 (61.9) | 7 (63.6) | 20 (62.5) |
| Ceftazidime | 13 (61.9) | 6 (54.5) | 19 (59.4) |
| Aztreonam | 12 (57.1) | 7 (63.6) | 19 (59.4) |
| Cefepime | 12 (57.1) | 5 (45.5) | 17 (53.1) |
| Ciprofloxacin | 14 (66.7) | 4 (36.4) | 18 (56.3) |
| Tetracycline | 8 (38.1) | 4 (36.4) | 12 (37.5) |
| Nalidixic acid | 10 (47.6) | 2 (18.2) | 12 (37.5) |
| Cefotaxime | 8 (38.1) | 3 (27.3) | 11 (34.4) |
| Ampicillin | 5 (23.8) | 4 (36.4) | 9 (28.1) |
| Trimethoprim/sulfamethoxazole | 4 (19) | 3 (27.3) | 7 (21.9) |
aValues are expressed as No. (%).
There was no relationship between the presence of virulence genes and antimicrobial susceptibility of UPEC, except for cnf gene and nalidixic acid (P < 0.05). The cnf gene was more prevalent in nalidixic acid-susceptible isolates than non-susceptible isolates (resistant plus intermediate (for cefepime: Susceptible-Dose Dependent, SDD)) (50% vs. 10%, P < 0.05).
5. Discussion
E. coli causes the vast majority of UTI in both outpatients and inpatients. The degree of severity of infection depends on the virulence of the responsible strains (3). The most important virulence factors in UPEC strains are P-fimbriae (pap), afimbrial adhesin (afa), hemolysin (hly), and cytotoxic necrotizing factor 1 (cnf1) (4, 6-8). The ability of bacteria to attach to uroepithelial cells through adhesins is critical for the initiation of infection (14). Of the 32 uropathogenic E. coli isolates tested by PCR in the present study, 25% and 15.6% exhibited pap and afa adhesins, respectively. Previous studies have shown the prevalence of pap gene in UPEC strains isolated from children as 70% and 30.2% in two Iranian studies (15, 16), 39.6% in a South Korean study (4), and 22.9% in a Turkish study (17). The prevalence of afa was 9.4% in Yun et al.’s study (1), 26.6% in Dormanesh et al.’s study (15), and 66.6% in Tajbakhsh et al.’s study (18), which are different from the rates found in our study.
Toxins are important virulence factors mediating invasion, dissemination, and persistence of bacteria in host cells (4). The toxins, α-hemolysin and CNF1, are believed to act by release of iron from red blood cells, dysfunction of phagocytic cells, and direct cytotoxicity to the tissues (14). Haemolysin is needed for the initial invasion of bacteria through the epithelial barrier, while CNF1 is needed for the dissemination and persistence of E. coli strains (4). hly and cnf1 genes were present in 15.6% and 25% of our isolates, respectively. The distribution of the hly gene among the studied isolates was lower than that previously reported (1, 19, 20) although it is in agreement with those reported by Farshad et al. (16) and Alizadeh et al. (21) in Iran. The prevalence of cnf-1 was 65.5% among Korean children (4), 56.66% in Iranian children (15), 27% in children hospitalized in Australia (20), and 9% in a Pakistani population (22). We found that E. coli strains obtained from hospitalized patients carried more virulence genes and hence, they are appeared to be more aggressive than the strains isolated from outpatients. This finding is in accordance with the results of previous studies (3, 23). The afa virulence gene was more prevalent in outpatients, which emphasizes the importance of admission of these infected patients to tertiary care teaching hospitals. Virulence factors may have distinctive, complex associations with one another (1). Our results revealed the occurrence of specific gene combination as pap-hly, which corresponded to 12.5% of the UPEC strains (P < 0.05) (Table 2). Recently, Regua-Mangia et al. have demonstrated the occurrence of specific gene combinations as pap-afa and pap-cnf (24). Birosova et al. also observed that afa gene was associated with pap sequence (25). In our study, two isolates carried both pap and afa genes, and one isolate carried both pap and cnf genes, although they showed insignificant associations according to Chi-square and Fisher’s tests.
Early diagnosis and prompt antibacterial treatment are critical to minimize renal scarring and progressive kidney damage in patients with UTI. Several studies have reported a relationship between antimicrobial resistance and virulence factors in UPEC. For example, tetracycline resistance has been associated with a higher prevalence of pap (P < 0.05) (1), and a lower prevalence of pap, cnf1, and hly has been reported in fluoroquinolone-resistant strains in comparison with their susceptible counterparts (26). In our study, an association was seen between the susceptibility to nalidixic acid and presence of cnf gene (P < 0.05). The presence of certain virulence genes might be dependent on the mechanisms of antibiotic action or an unknown interaction between virulence factors and antibiotics. Nitrofurantoin and imipenem antibiotics showed the highest activity against the isolates, which is in agreement with the results of other reports (27, 28). It seems that in our study, isolates from outpatients were more resistant to the tested antibiotics in comparison with isolates from inpatients, which highlights the problem of admission of these infected patients to hospital. Although most antibiotic-resistant bacteria have originally emerged in hospitals, drug-resistant strains have been increasing in the community, worldwide (29). The development of resistance in the community might be due to inappropriate use of antibiotics, the continued use of antibiotics in agriculture and animals, and ineffective infection control and health programs (30). It is estimated that 80% - 90% of human antimicrobial drugs are taken by outpatients and the remained 10% - 20% by hospitalized patients. Also, 20% - 50% of antibiotics are believed to be consumed uncertainly (31). These may expose human population to the increased risk of side effects, higher economic burden, and more resistant pathogens to antibiotic compounds.
In conclusion, this study highlights the distribution of virulence factors and the antibiotic resistance among UPEC isolated from children in Sanandaj. A better knowledge on the antibiotic resistance and virulence properties of microorganisms causing the infection may help clinicians predict the evolution of infection in the host.
