Arch Clin Infect Dis

Image Credit:Arch Clin Infect Dis

Qnr Prevalence in Escherichia coli Isolates from Wastewater from Livestock Farms in Hamedan, Iran

Author(s):
Katayoon NofouziKatayoon NofouziKatayoon Nofouzi ORCID1,*, Ensiyeh SarmadiEnsiyeh Sarmadi1, Masoumeh FiroozamandiMasoumeh Firoozamandi1
1Department of Pathobiology, Faculty of Veterinary Medicine, University of Tabriz, Tabriz, Iran

Archives of Clinical Infectious Diseases:Vol. 20, issue 6; e162585
Published online:Dec 28, 2025
Article type:Research Article
Received:May 07, 2025
Accepted:Dec 18, 2025
How to Cite:Nofouzi K, Sarmadi E, Firoozamandi M. Qnr Prevalence in Escherichia coli Isolates from Wastewater from Livestock Farms in Hamedan, Iran. Arch Clin Infect Dis. 2025;20(6):e162585. doi: https://doi.org/10.5812/archcid-162585

Abstract

Background:

Multidrug-resistant (MDR) Escherichia coli represent a serious public health risk, leading to higher rates of illness, death, and economic costs. The presence of antibiotics in livestock wastewater contributes to the development of resistance among commensal and environmental bacteria, which can diminish the effectiveness of these drugs in treating both humans and animals.

Objectives:

This research aimed to examine the patterns of antibiotic resistance and the prevalence of qnrS resistance genes.

Methods:

This cross-sectional study was conducted on 24 active dairy cattle farms in Hamedan, Iran, selected based on the presence of an accessible wastewater discharge point releasing into residential or agricultural areas. A total of 96 wastewater samples were collected from June to December 2023. Inclusion criteria for samples were a minimum volume of 1 liter, collection within the study period, and processing within 24 hours under refrigerated conditions. Eosin methylene blue agar was utilized to isolate E. coli from wastewater samples. The Kirby-Bauer diffusion susceptibility method was employed to assess the antimicrobial susceptibility and resistance patterns of the isolated E. coli strains. DNA amplification was conducted in polymerase chain reaction (PCR) on a thermos-cycler, for 35 cycles, using a master mix and specific primers for the qnrS gene.

Results:

Over 60% of 40 strains isolated from 96 wastewater samples were found to be resistant against nalidixic acid (NA), ceftazidime, trimethoprim-sulfamethoxazole (SXT), and piperacillin (PRL). The qnrS resistance gene was identified in 15% of the E. coli.

Conclusions:

The findings of this study reveal that the wastewater in Hamedan is tainted with antibiotic-resistant E. coli, which poses a significant risk to agricultural communities located downstream. This contamination not only threatens public health by fostering antibiotic resistance among microbial populations but also underscores the need for improved wastewater treatment to lower bacterial levels to safe standards before it is utilized in aquaculture and agriculture.

1. Background

Due to increasing amounts of micropollutants, in the twenty-first century, the infrastructure for water treatment is insufficient. Wastewater is contaminated with a range of pollutants, such as surfactants, endocrine disruptors, and products from pharmaceuticals and personal care (1). Once antibiotics are introduced into ecosystems, they can alter the assessment of microbial community structure, thereby affecting the ecological function of aquatic environments (2). Typically, around 30 - 90% of administered doses of water-soluble antibiotics are excreted in animal urine and feces. In addition to half of used antibiotics, a large amount of antibiotics also discharged in wastewater has been taken from disposal of these unused drugs (2). Active compounds from these antibiotic residues and other pharmaceutical agents exert selective pressure and are discharged into the municipal wastewater system on a large scale before reaching the wastewater treatment plant (WWTP) (3). The primary concern regarding the release of antibiotics into the environment is the emergence and dissemination of antibiotic resistance genes (ARGs) and resistant bacteria (ARB), which could diminish the effectiveness of treatments against pathogens in both humans and animals (4). One common mechanism for acquiring resistance is through spontaneous mutations in bacterial DNA occurring at a much higher rate than lethal antibiotic concentrations of antibiotics would suggest (5). Furthermore, several of the pathogenic bacteria present in sewage also harbor ARGs that can be integrated into mobile genetic elements to allow horizontal gene transfer to indigenous environmental bacteria (6). A significant portion of ARB and ARG are released into wastewater via fecal waste from livestock. Research by Bonten et al. (7) reported that 80.5% of stool samples from healthy subjects harbored ARB and that 98% of them were Escherichia coli after cultivation. When effluents are discharged, these bacteria may multiply in the environment. Emergence and dissemination of antimicrobial resistance (AMR) and ARB is considered one of the top three threats, which is driven by the increased use of antibiotics (8). Pathogenic bacteria and fecal indicator microorganisms have received recent attention in research, especially in strains of Enterobacteriaceae, Acinetobacter spp., Aeromonas spp., and E. coli in wastewater that frequently harbor ARGs (2). In aquatic environments, a total of 38 common genes have been identified, including qnrS associated with fluoroquinolone resistance (9). The region investigated in this study was Hamedan in western Iran. The presence of antibiotics in livestock wastewater contributes to the development of resistance among commensal and environmental bacteria, which can diminish the effectiveness of these drugs in treating both humans and animals. Despite the significance of antibiotic resistance and pathogens in livestock wastewater, there is limited understanding of how they transfer to agricultural fields. Fluoroquinolone antibiotics were chosen for this analysis due to their widespread use in livestock production and their relevance to public health. The aim of this study was to measure the levels of antibiotic resistance and pathogen contamination in wastewater released from livestock farms to agricultural areas.

2. Materials and Methods

2.1. Study Site

The location of the study, Hamedan, is typical of the geographical regions spanning the Alvand Massif in northwestern Iran, a geomorphic unit of intrusive-glacial origin. The total area of agricultural land is about 950 thousand hectares, of which 630 thousand hectares are used for dry farming. Only six percent of the province's area is without vegetation. According to the 2016 census, the city was home to 554406 residents (174731 households). Hamedan has a growing peri-urban area near the urban markets, although the socio-economic conditions are generally low. As in the rest of Iran, small-scale cow farms are built next to the houses in Hamedan, with modest cow sheds for a small number of cows (usually less than 50 cows). In total, there are 66 dairy farms with an estimated livestock of 19207 animals spread across nine sub-areas in Hamedan province. The milk and meat production associated with livestock farming is 540 tons daily and 29000 tons annually in the region, respectively (10).

2.2. Study Design and Scope

This cross-sectional study took place during a clearly defined seven-month period from June 1 to December 31, 2023, and involved a quantitative survey of households as well as the analysis of wastewater samples for biological and antibiotic resistance. Additionally, the research focused on cow farms in the Hamedan region and its surrounding agricultural areas. The study analyzed wastewater runoff from cow sheds, households, and agricultural fields.

2.3. Study Population and Farm Characteristics

The 24 participating farms were characterized in detail to understand potential confounders affecting antibiotic resistance patterns. The average herd size was 42 ± 15 cows (range: 18 - 65), with an average milk production of 18.5 ± 4.2 liters per cow daily. All farms maintained Holstein-Friesian cattle breeds, and the average farm operation duration was 14 ± 8 years. Key management practices were documented: Eighteen farms (75%) used commercial feed supplements, while 6 farms (25%) relied primarily on pasture grazing. Regarding veterinary care, 15 farms (62.5%) had regular veterinary supervision, while 9 farms (37.5%) consulted veterinarians only during emergencies. Antibiotic usage patterns revealed that 20 farms (83.3%) reported using antibiotics for both therapeutic and prophylactic purposes, while 4 farms (16.7%) claimed to use antibiotics only for treating sick animals.

2.4. Potential Confounders and Control Measures

Several potential confounders were identified and documented, including farm management practices, antibiotic usage history, and environmental factors.

2.5. Sample Collection

After conducting a survey of 100 households between June and August 2023, a selection of 24 cow farms was made for sampling, taking into account their locations in different villages and the wastewater they release into those areas, including residential zones and agricultural lands. The chosen farms were also identified based on their interconnections, drainage regions, and proximity to agricultural fields in Hamedan. Four sampling points were identified from each selected farm to obtain a total of 96 wastewater samples, which were collected monthly from September to December 2023.

2.6. Inclusion and Exclusion Criteria

The farms were included in the sampling frame on the basis of the following criteria: Exclusively active dairy farms, farms had to have an active and accessible wastewater discharge point (e.g., pond, drainage canal) releasing wastewater into the environment, farms were selected to ensure representativeness across different villages and drainage regions within the study area of Hamedan, farms whose wastewater discharge was in close proximity to residential areas or agricultural land were favored. Individual wastewater samples were included in the analysis if they: Had a minimum volume of 1 liter, were collected within the designated study period (between June and December 2023), were brought to the laboratory on ice, and were processed within the prescribed time window of 24 hours after collection. Samples were excluded from analysis for the following reasons: Any sample that was not kept at 2 - 8°C during transport or that had exceeded the 24-hour time limit for processing was discarded. The sampling procedures for wastewater were in accordance with Iranian standard No. 7960 for water and wastewater sampling (11). Approximately 1 liter of wastewater was collected using disinfected stainless steel dippers. The water samples were collected from ponds or canals at a depth of about 20 cm below the surface in polypropylene bottles with an air space of 2.5 cm in each bottle and transported to the laboratory on ice for processing within a maximum of 24 hours after collection. The bottles were labelled with the type of sample, a code, and the location. These samples were analyzed for E. coli. All samples were kept in a cooler (2 - 8˚C) for transport to the laboratory and were tested on the same day.

2.7. Bacteriology Analysis

The microbiological analysis was carried out by the Laboratory for Microbiology. Eosin methylene blue agar was utilized to isolate E. coli from wastewater samples. Prior to this, the agar plate surfaces were dried, after which 0.1 mL of the sample was pipetted onto each plate and evenly spread using a sterile spatula. The plates were then incubated for 24 hours at 37˚C. The appearance of green, metallic colonies on the agar indicated the presence of E. coli. The isolation process followed the method outlined by Pham-Duc et al. (12).

2.8. Antimicrobial Resistance and Susceptibility

Testing The Kirby-Bauer diffusion susceptibility method (13) was employed to assess the antimicrobial susceptibility and resistance patterns of the isolated E. coli strains. This process involved subculturing the bacteria on Muller-Hinton (MH) agar (Himedia, India). Standard antimicrobial diffusion discs with a depth of about 4 mm were placed on the agar surface and incubated at 37˚C for 18 - 24 h. Escherichia coli strains were tested against 16 antibiotics, including: Nalidixic acid (NA; 30), doxycycline (DO; 30), ceftazidime-avibactam (CAZ-AVI; 10/4), ciprofloxacin (CIP; 5), cefepime (CPM; 30), imipenem (IPM; 10), cefotaxime (CTX; 30), ceftriaxone (CRO; 30), trimethoprim-sulfamethoxazole (SXT; 25), amoxicillin (AMX; 30), amikacin (AK; 30), gentamicin (CN; 30), cefoxitin (FOX; 30), aztreonam (ATM; 30), and piperacillin (PRL; 30). The diameter of the zone where growth was inhibited was measured with calipers, and the results were assessed using the CLST M 100 ED 28-2018 method (14).

2.9. Isolation of Bacterial DNA (Escherichia coli) in Wastewater

Bacterial DNA isolation was carried out using the boiling method (15), and the quality and quantity of the extracted DNA from bacterial cultures was assessed using UV spectroscopy. To evaluate DNA purity, we measured the optical density (OD) at 260/280 with a Scan-Drop-Volume spectrophotometer (Implen, Germany). For polymerase chain reaction (PCR) analysis, we only included samples with a DNA purity close to 1.8, as values below this threshold suggested sample contamination. DNA amplification was conducted in PCR on a thermos-cycler (Bio Rad, USA), for 35 cycles, using a master mix (Kimia Danesh Tajhiz, Iran) and specific primers for the qnrS gene. The working protocol uses a 20 µL reaction volume by adding 12.5 µL PCR mix and 1 µL primer as well as 3 µL DNA sample. The sequence of the primers used and the fragment size are listed in Table 1.
Table 1.Sequences of the Primers Used to Identify qnrS Gene in Escherichia coli Isolates From Calves with Diarrhea
Gene, PrimersOligonucleotid Sequence (5´ → 3´)Size
qnrS219
ForwardTCACCTTCACCGCTTGCACATT
ReverseAATCACACGCACGGAACTCTATACC

3. Results

In water samples taken from various locations in Hamedan, 40 E. coli isolates were detected. Of the 40 isolates tested, 6 (15%) were positive for the qnrS gene (Figure 1). The sensitivity was tested to different antibiotics according to CLSI guidelines, which showed the highest resistance rate for AMX (70%). The frequency of resistance detected in E. coli strains for the antibiotics tested is shown below: Nalidixic acid (67.5%), DO (12.5%), CAZ-AVI (67.5%), CIP (55%), CPM (60%), IPM (25%), CTX (50%), CRO (17.5%), SXT (62.5%), AMX (70%), AK (12.5%), CN (0), FOX (50%), ATM (52.5%), and PRL (62.5%). Figure 2 represents the antimicrobial susceptibility patterns of isolates obtained from Hamedan wastewater.
Gel image for the molecular detection of qnrS (219 bp) gene. Lane M: 50 bp DNA ladder, Lane 1: Positive control, Lane 2: Negative control, Lanes 3-8: Samples.
Figure 1.

Gel image for the molecular detection of qnrS (219 bp) gene. Lane M: 50 bp DNA ladder, Lane 1: Positive control, Lane 2: Negative control, Lanes 3-8: Samples.

Antimicrobial susceptibility patterns of <i>Escherichia coli</i> isolated from livestock wastewater in Hamedan, Iran. Nalidixic acid (NA), doxycycline (DO), ceftazidime-avibactam (CAZ-AVI), ciprofloxacin (CIP), cefepime (CPM), imipenem (IPM), cefotaxime (CTX), ceftriaxone (CRO), trimethoprim-sulfamethoxazole (SXT), amoxicillin (AMX), amikacin (AK), gentamicin (CN), cefoxitin (FOX), aztreonam (ATM), and piperacillin (PRL)
Figure 2.

Antimicrobial susceptibility patterns of Escherichia coli isolated from livestock wastewater in Hamedan, Iran. Nalidixic acid (NA), doxycycline (DO), ceftazidime-avibactam (CAZ-AVI), ciprofloxacin (CIP), cefepime (CPM), imipenem (IPM), cefotaxime (CTX), ceftriaxone (CRO), trimethoprim-sulfamethoxazole (SXT), amoxicillin (AMX), amikacin (AK), gentamicin (CN), cefoxitin (FOX), aztreonam (ATM), and piperacillin (PRL)

4. Discussion

This study demonstrated high levels of E. coli in wastewater applied to farmland from small-scale dairy farms. The contamination in the community and agricultural fields was partly due to household wastewater. This study's findings indicate that fluoroquinolone-resistant genes are found in isolated E. coli. Overall, the E. coli isolates from Hamedan demonstrated antibiotic resistance in the following order: Amoxicillin, NA, ceftazidime, and trimethoprim-sulfamethoxazole. In the multidrug-resistant (MDR) strains, the key antibiotics with high resistance rates were similar, but ranked differently. Multidrug-resistant strains were more resistant to most classes of the antibiotics. Recent research has underscored the significant levels of antibiotic resistance among E. coli strains, highlighting the urgent issue of antibiotic resistance in Hamedan. Escherichia coli are significant opportunistic pathogens responsible for urinary tract infections in both animals and humans (16). The misuse of these antibiotics has led to selective pressure in the development of multi-drug resistant bacteria. The introduction of quinolones into therapy in the 1960s was a real advance for medicine at the time. Regrettably, after just ten years of use, the initial instances of resistance emerged, although their frequency was significantly lower than it is now (17). In the present work, we found that E. coli recovered from livestock wastewater had relatively high rates of quinolone resistance (67.5%). Livestock wastewater is an important source of quinolone resistance in Hamedan, Iran. The relatively high quinolone resistance rates found in the present study could be due to the misuse of these antibiotics. Based on the results of the present study, the highest resistance rate was found for NA (67.5%). This finding was higher than previous reports from Hamedan, Iran (18). Due to the increasing incidence of MDR, fluoroquinolones are currently considered the first choice for the treatment of calf diarrhea. In fact, several studies have documented the emergence and spread of fluoroquinolone-resistant enteric disease. The growth of this phenomenon over time might align with the significant identification of qnr genes. This has been a hypothesis among several researchers because of the strong connection between qnr genes and various forms of resistance (19). This result aligns with earlier research (20, 21), including an Italian survey in which 54% of the veterinarians surveyed identified fluoroquinolones as their top choice and 38% as their second choice for treating diarrhea in calves (22). Additionally, a study conducted in Switzerland found fluoroquinolones were the most frequently used treatment for 47% of parental treatments (23). A straightforward comparison of the values found in wastewater in Hamedan with those from clinical units in other parts of the world revealed a 29.2% reduction in qnr gene incidence in Iran, particularly in Tehran (24), while the Netherlands showed a significant 78% decrease in genes encoding qnrA (25). Like other developing countries, Iranian farmers frequently purchase medications for their animals directly, as veterinary medicines are readily accessible in various locations throughout the province (26). For a long time, antibiotics have been commonly used by livestock breeders in Iran as growth enhancers. Furthermore, many customers tend to implement some treatment methods on their own before seeking assistance at a veterinary diagnostic and medical facility. They have begun using various antibiotics or have discontinued their treatment prematurely. Furthermore, antibiogram testing is a relatively new concept that has not been widely embraced by many customers. Few farmers see this test as essential or prioritize it, believing it is not required and thus feel no obligation to conduct it. Additionally, veterinarians or clinicians who prescribe more medications for animal treatment tend to be more favored. Many clients are unwilling to incur any costs beyond the consultation fee, including laboratory expenses. Besides the factors mentioned earlier, veterinarians can also contribute to the rise of AMR. This illustrates how their traits influence their choices regarding the development of AMR. Many newly graduated veterinarians lack experience in prescribing medications, contributing significantly to the rise of AMR. Additionally, many of these veterinarians often diagnose diseases and prescribe treatments primarily based on their personal experiences. Antibiogram testing, a newer therapeutic approach, has not been widely embraced by the veterinary community. Furthermore, many people in society are not well informed about AMR and its implications for veterinary practice. For some veterinarians, AMR is not considered a critical factor in diagnosis, treatment, and monitoring. This study has several limitations. Firstly, the non-random sampling method used may not accurately represent specific cow management practices or water management strategies. Secondly, the research focused solely on the resistance gene for fluoroquinolones and did not examine AMR genes for other antibiotics. Additionally, the samples were collected over a brief period, from June to December 2023, without significant seasonal variation. More research is needed to determine how seasonal factors might influence levels of antibiotic resistance and pathogen load in wastewater. Nonetheless, the findings offer insights into the prevalence of E. coli and antibiotic resistance in wastewater at a particular moment in time. A multifaceted approach that considers the impact of co-selective elements like biocides and heavy metals, along with resistance genes, could facilitate a thorough exploration of these factors in the realm of AMR.

4.2. Conclusions

The findings of this study reveal that the wastewater in Hamedan is tainted with antibiotic-resistant E. coli, which poses a significant risk to agricultural communities located downstream. This contamination not only threatens public health by fostering antibiotic resistance among microbial populations but also underscores the need for improved wastewater treatment to lower bacterial levels to safe standards before it is utilized in aquaculture and agriculture. Effective wastewater management strategies, such as composting and biogas systems, should be prioritized to address this issue.

Acknowledgments

Footnotes

References

  • 1.
    Lepesova K, Olejnikova P, Mackulak T, Tichy J, Birosova L. Annual changes in the occurrence of antibiotic-resistant coliform bacteria and enterococci in municipal wastewater. Environ Sci Pollut Res Int. 2019;26(18):18470-83. [PubMed ID: 31049859]. https://doi.org/10.1007/s11356-019-05240-9.
  • 2.
    Bouki C, Venieri D, Diamadopoulos E. Detection and fate of antibiotic resistant bacteria in wastewater treatment plants: a review. Ecotoxicol Environ Saf. 2013;91:1-9. [PubMed ID: 23414720]. https://doi.org/10.1016/j.ecoenv.2013.01.016.
  • 3.
    Adeoye JB, Tan YH, Lau SY, Tan YY, Chiong T, Mubarak NM, et al. Advanced oxidation and biological integrated processes for pharmaceutical wastewater treatment: A review. J Environ Manag. 2024;353:120170. [PubMed ID: 38308991]. https://doi.org/10.1016/j.jenvman.2024.120170.
  • 4.
    Rizzo L, Manaia C, Merlin C, Schwartz T, Dagot C, Ploy MC, et al. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: a review. Sci Total Environ. 2013;447:345-60. [PubMed ID: 23396083]. https://doi.org/10.1016/j.scitotenv.2013.01.032.
  • 5.
    Selvarajan R, Obize C, Sibanda T, Abia ALK, Long H. Evolution and Emergence of Antibiotic Resistance in Given Ecosystems: Possible Strategies for Addressing the Challenge of Antibiotic Resistance. Antibiotics. 2022;12(1). [PubMed ID: 36671228]. [PubMed Central ID: PMC9855083]. https://doi.org/10.3390/antibiotics12010028.
  • 6.
    Baquero F, Martinez JL, Canton R. Antibiotics and antibiotic resistance in water environments. Curr Opin Biotechnol. 2008;19(3):260-5. [PubMed ID: 18534838]. https://doi.org/10.1016/j.copbio.2008.05.006.
  • 7.
    Bonten M, Stobberingh E, Philips J, Houben A. Antibiotic resistance of Escherichia coli in fecal samples of healthy people in two different areas in an industrialized country. Infection. 1992;20(5):258-62. [PubMed ID: 1428182]. https://doi.org/10.1007/BF01710790.
  • 8.
    World Health Organization. Antimicrobial Resistance. Geneva, Switzerland: World Health Organization,; 2023. Available from: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance.
  • 9.
    Aydin S, Ince B, Ince O. Development of antibiotic resistance genes in microbial communities during long-term operation of anaerobic reactors in the treatment of pharmaceutical wastewater. Water Res. 2015;83:337-44. [PubMed ID: 26188597]. https://doi.org/10.1016/j.watres.2015.07.007.
  • 10.
    Gharekhani J, Yakhchali M. Risk factors associated to Toxoplasma gondii infection in dairy farms in Hamedan suburb, Iran. J Parasit Dis. 2020;44(1):116-21. [PubMed ID: 32174713]. [PubMed Central ID: PMC7046887]. https://doi.org/10.1007/s12639-019-01167-7.
  • 11.
    International Organization for Standardization. Water quality — Sampling Part 10: Guidance on sampling of waste water. Geneva, Switzerland: International Organization for Standardization,; 2020.
  • 12.
    Pham-Duc P, Nguyen-Viet H, Luu-Quoc T, Cook MA, Trinh-Thi-Minh P, Payne D, et al. Understanding Antibiotic Residues and Pathogens Flow in Wastewater from Smallholder Pig Farms to Agriculture Field in Ha Nam Province, Vietnam. Environ Health Insights. 2020;14:1178630220943210. [PubMed ID: 33088179]. [PubMed Central ID: PMC7543113]. https://doi.org/10.1177/1178630220943206.
  • 13.
    Mtonga S, Nyirenda SS, Mulemba SS, Ziba MW, Muuka GM, Fandamu P. Epidemiology and antimicrobial resistance of pathogenic E. coli in chickens from selected poultry farms in Zambia. J Zoonotic Dis. 2021;5(1):18-28. https://doi.org/10.22034/jzd.2021.12711.
  • 14.
    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. Berwyn, U.S: Clinical and Laboratory Standards Institute,; 2023.
  • 15.
    Asadi Nadari M, Ownagh A, Nofouzi K. Study on antibiotic resistance pathern in diarrheic calves of Tabriz dairy farms. Animal Sci Res. 2024;34(2):88-99. https://doi.org/10.22034/as.2023.56083.1703.
  • 16.
    Li Q, Chang W, Zhang H, Hu D, Wang X. The Role of Plasmids in the Multiple Antibiotic Resistance Transfer in ESBLs-Producing Escherichia coli Isolated From Wastewater Treatment Plants. Front Microbiol. 2019;10:633. [PubMed ID: 31001218]. [PubMed Central ID: PMC6456708]. https://doi.org/10.3389/fmicb.2019.00633.
  • 17.
    Pham TDM, Ziora ZM, Blaskovich MAT. Quinolone antibiotics. Medchemcomm. 2019;10(10):1719-39. [PubMed ID: 31803393]. [PubMed Central ID: PMC6836748]. https://doi.org/10.1039/c9md00120d.
  • 18.
    Alikhani MY, Hashemi SH, Aslani MM, Farajnia S. Prevalence and antibiotic resistance patterns of diarrheagenic Escherichia coli isolated from adolescents and adults in Hamedan, Western Iran. Iran J Microbiol. 2013;5(1):42-7. [PubMed ID: 23466523]. [PubMed Central ID: PMC3577554].
  • 19.
    Eibl C, Bexiga R, Viora L, Guyot H, Felix J, Wilms J, et al. The Antibiotic Treatment of Calf Diarrhea in Four European Countries: A Survey. Antibiotics. 2021;10(8). [PubMed ID: 34438960]. [PubMed Central ID: PMC8388724]. https://doi.org/10.3390/antibiotics10080910.
  • 20.
    Berge AC, Lindeque P, Moore DA, Sischo WM. A clinical trial evaluating prophylactic and therapeutic antibiotic use on health and performance of preweaned calves. J Dairy Sci. 2005;88(6):2166-77. [PubMed ID: 15905446]. https://doi.org/10.3168/jds.S0022-0302(05)72892-7.
  • 21.
    Zwald AG, Ruegg PL, Kaneene JB, Warnick LD, Wells SJ, Fossler C, et al. Management practices and reported antimicrobial usage on conventional and organic dairy farms. J Dairy Sci. 2004;87(1):191-201. [PubMed ID: 14765827]. https://doi.org/10.3168/jds.S0022-0302(04)73158-6.
  • 22.
    Busani L, Graziani C, Franco A, Di Egidio A, Binkin N, Battisti A. Survey of the knowledge, attitudes and practice of Italian beef and dairy cattle veterinarians concerning the use of antibiotics. Vet Rec. 2004;155(23):733-8. [PubMed ID: 15623086].
  • 23.
    Pipoz F, Meylan M. [Calf health and antimicrobial use in Swiss dairy herds: Management, prevalence and treatment of calf diseases]. Swiss Arch Vet Med. 2016;158(6):389-96. DE. [PubMed ID: 27504834]. https://doi.org/10.17236/sat00064.
  • 24.
    Ranjbar R, Farahani O. The Prevalence of Plasmid-mediated Quinolone Resistance Genes in Escherichia coli Isolated from Hospital Wastewater Sources in Tehran, Iran. Iran J Public Health. 2017;46(9):1285-91. [PubMed ID: 29026795]. [PubMed Central ID: PMC5632331].
  • 25.
    Doma AO, Popescu R, Mituletu M, Muntean D, Degi J, Boldea MV, et al. Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania. Antibiotics. 2020;9(10). [PubMed ID: 33066610]. [PubMed Central ID: PMC7602382]. https://doi.org/10.3390/antibiotics9100698.
  • 26.
    Toghroli R, Hassani L, Aghamolaei T, Sharma M, Sharifi H, Jajarmi M. Explaining the barriers faced by veterinarians against preventing antimicrobial resistance: an innovative interdisciplinary qualitative study. BMC Infect Dis. 2024;24(1):455. [PubMed ID: 38689250]. [PubMed Central ID: PMC11059684]. https://doi.org/10.1186/s12879-024-09352-7.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles