Characteristics of Virulence Factors in Methicillin-Resistant Staphylococcus aureus Strains Isolated From a Referral Hospital in Tehran, Iran

Author(s):
Fateh RahimiFateh Rahimi1,*, Sharmin KarimiSharmin Karimi1
1Department of Microbiology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

Archives of Clinical Infectious Diseases:Vol. 11, issue 1; e33220
Published online:Jan 23, 2016
Article type:Research Article
Received:Sep 17, 2015
Accepted:Dec 06, 2015
How to Cite:Rahimi F, Karimi S. Characteristics of Virulence Factors in Methicillin-Resistant Staphylococcus aureus Strains Isolated From a Referral Hospital in Tehran, Iran. Arch Clin Infect Dis. 2016;11(1):e33220. doi: https://doi.org/10.5812/archcid.33220

Abstract

Background:

Methicillin-resistant Staphylococcus aureus (MRSA) has been known as one of the most important nosocomial pathogens that able to produce a variety of virulence factors.

Objectives:

In this study, we aimed to describe the prevalence, presence of different virulence factors, staphylococcal cassette chromosome mec (SCCmec) and prophage typing of MRSA strains isolated from a referral hospital in Tehran, Iran.

Materials and Methods:

A total of 279 S. aureus strains were collected from a referral hospital in Tehran during August to December of 2013. All isolates were confirmed using species specific primers and were tested for susceptibility to oxacillin and cefoxitin disks by the recommendations of clinical and laboratory standards institute (CLSI). The staphylococcal enterotoxin (sea-seq) and pvl, hlb and sak genes were detected and typed using prophage typing and SCCmec typing methods.

Results:

Out of the 279 S. aureus isolates, 91 (32.6%) strains were confirmed as MRSA. Totally, 6 enterotoxin and 2 virulence factor genes were detected in MRSA strains. The sea, sek, seq and hlb genes were present in all MRSA and sak, seg, sei and sel were detected in 85%, 35%, 23% and 44% of the strains. Only SCCmec type III and type 3 ccr and 2 different prophage patterns were identified among the strains.

Conclusions:

Our results show the presence of clonal groups of enterotoxin-producing MRSA strains in this hospital in Tehran. The presence of bacteriophage encoded virulence factors and resistance to oxacillin enable bacteria to produce a broad spectrum range of diseases.

1. Background

Staphylococcus aureus is a facultative anaerobe, gram-positive opportunistic pathogen which is known as a major cause of hospital-acquired (HA) and community-acquired (CA) infections and is able to produce a variety of virulence factors such as enterotoxins, staphylokinase, toxic shock syndrome toxin-1 (TSST-1), microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), β-lysin, capsular polysaccharides, Panton-Valentine leukocidin (PVL), lipase and exfoliative toxin (1). Some of these factors are encoded by bacteriophages through lysogenic phage conversion (1, 2). Staphylococcal enterotoxins (SEs) are members of superantigen family (3, 4), which are involved in modulating the host immune response and also may play a role in evasion of host defenses and bacterial persistence (4). At the moment, 23 known major types of SEs (SEA to SEV) were identified and the production of SEs in MRSA strains may cause food poisoning that is characterized by nausea, vomiting, abdominal cramps and diarrhea, and it is one of the most common food-borne diseases in the world (4-6). Different enterotoxins are classified into 5 different groups based on the comparisons of amino acid sequences, in which group 1 comprises the SEA, SED, SEE, SEJ, SEN, SEO, SEP and SES, group 2 comprises the SEB, SEC, SEG, SER and SEU, group 3 comprises the SEI, SEK, SEL, SEM, and SEQ and groups 4 and 5 comprise only the SEV and SEH, respectively. Staphylococcal enterotoxins A-I and SER-SET can display the emetic activity (6).
Bacteriophages are a class of mobile genetic elements which convert non-lysogenic staphylococci to lysogenic and virulent one through horizontal gene transfer (7). Incorporation of different classes of prophages into the choromosome of S. aureus strains enables them to produce broad spectrum of virulence factors such as PVL (SGA encoded) TSST, exfoliative toxin, lipase (SGB encoded), enterotoxin A, E, G, K and P, β-lysin and staphylokinase (SGF encoded) (4). S. aureus bacteriophages are members of Siphoviridae (temperate bacteriophages) and Myoviridae (lytic bacteriophages) families (1).
S. aureus strains have the ability to acquire antibiotic resistance genes via mobile genetic elements which make them resistant to a broad spectrum of antibiotics such as methicillin. Methicillin-resistant S. aureus (MRSA) strains were appeared first in 1961 and spread worldwide during decades (7). Infections caused by hospital-acquired MRSA (HA-MRSA) strains have increased during the past decades and exhibited increased antimicrobial resistance. On the other hand, community-associated MRSA (CA-MRSA) strains occur in people who have not been hospitalized or recently had invasive procedures. CA-MRSA strains are susceptible to different antibiotics other than beta-lactams and harbor pvl gene as a marker and infection occur typically as skin or soft tissue infections (7). Resistance to methicillin is due to the presence of staphylococcal cassette chromosome mec (SCCmec), which eleven types have been recognized and MRSA strains are classified as type’s I - XI (8).

2. Objectives

In this experimental study, we aimed to describe the prevalence, presence of different virulence factors, SCCmec and prophage typing of MRSA strains isolated from a referral hospital in Tehran, Iran.

3. Materials and Methods

3.1. Samples Collection

A total of 279 S. aureus strains were collected from patients (outpatients and inpatients) who exhibited clinical symptoms of infections in a referral hospital in Tehran during August to December of 2013. Patients were hospitalized for at least 72 hours classified as inpatients. Strains were collected from wound (106), urine (83), trachea (45), blood (20), sputum (18) and cerebrospinal fluid (CSF) (7).
All isolates were identified as S. aureus using species specific nucA gene primers as described previously (9). For DNA extraction from all strains, the boiling method was employed, according to the protocol introduced by Rahimi et al. (10). Moreover, DNA of the MRSA strains was extracted using a High Pure PCR Template Preparation kit (Roche, Germany). Also, the polymerase chain reaction (PCR) and multiplex-PCR reactions were mixed in a volume of 25 μL consisting of 1 µL of template DNA, 10X PCR buffer, dNTP mix (100 μM), MgCl2 (0.8 μM), each primer (0.4 μM) and taq DNA polymerase (1 U).

3.2. Screening of Methicillin-Resistant Staphylococcus aureus Strains

Susceptibility of all S. aureus strains to oxaillin (1 µg) and cefoxitin (30 µg) as a surrogate indicator for detection of MRSA strains (Mast diagnostics, Merseyside, United Kingdom) was examined according to the guidelines of clinical and laboratory standards institute (CLSI) (11).

3.3. Detection of Virulence Genes

All MRSA strains were examined for the presence of enterotoxin genes (sea-seq) according to the protocols introduced previously (sea-sej and sel: cycle conditions: 94°C for 5 minutes; 30 cycles at 94°C for 45 seconds, 62°C for 45 seconds, and 72°C for 105 seconds; and a final extension at 72°C for 10 minutes) (9) (sek and sem-seq: cycle conditions: 95°C for 15 minutes; 40 cycles at 94°C for 30 seconds, 55°C for 40 seconds, and 72°C for 60 seconds; and a final extension at 72°C for 7 minutes) (12). Moreover, PCR assays were performed to detect genes sak (staphylokinase toxin), hlb (haemolysin) by specific primers described by Goerke et al. (13) (cycle conditions: 94°C for 4 minutes; 35 cycles at 94°C for 30 seconds, 55°C for 2 minutes, and 72°C for 60 seconds; and a final extension at 72°C for 7 minutes).The pvl gene was detected in a PCR assay according to the specific primers introduced by McClure et al. (14) (cycle conditions: initial activation at 94°C for 10 minutes; 10 cycles at 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 75 seconds; 25 cycles at 94°C for 45 seconds, 50°C for 45 seconds, and 72°C for 75 seconds; and a final extension at 72°C for 10 minutes). The list of primers used for identification of virulence genes has been shown in Table 1.
Table 1. Primers Used for Polymerase Chain Reaction Identification of Virulence Genes
GenesSequenceReference
sea(9)
F5′-TAAGGAGGTGGTGCCTATGG
R5′-CATCGAAACCAGCCAAAGTT
seb(9)
F5′-TCGCATCAAACTGACAAACG
R5′-GCAGGTACTCTATAAGTGCC
sec(9)
F5′-ACCAGACCCTATGCCAGATG
R5′-TCCCATTATCAAAGTGGTTTCC
sed(9)
F5′-TCAATTCAAAAGAAATGGCTCA
R5′-TTTTTCCGCGCTGTATTTTT
see(9)
F5′-TACCAATTAACTTGTGGATAGAC
R5′-CTCTTTGCACCTTACCGC
seg(9)
F5′-CCACCTGTTGAAGGAAGAGG
R5′-TGCAGAACCATCAAACTCGT
seh(9)
F5′-TCACATCATATGCGAAAGCAG
R5′-TCGGACAATATTTTTCTGATCTTT
sei(9)
F5′-CTCAAGGTGATATTGGTGTAGG
R5′-CAGGCAGTCCATCTCCTGTA
sej(9)
F5′-GGTTTTCAATGTTCTGGTGGT
R5′-AACCAACGGTTCTTTTGAGG
sek(12)
F5′-ATGAATCTTATGATTTAATTTCAGAATCAA
R5′-ATTTATATCGTTTCTTTATAAGAAATATCG
sel(9)
F5′-CACCAGAATCACACCGCTTA
R5′-CTGTTTGATGCTTGCCATTG
sem(12)
F5′-ATGAAAAGAATACTTATCATTGTTGTTTTATTG
R5′-CTTCAACTTTCGTCCTTATAAGATATTTC
sen(12)
F5′-ATAAAAAATATTAAAAAGCTTATGAGATTGTTC
R5′-ACTTAATCTTTATATAAAAATACATCAATATG
seo(12)
F5′- TATGTAGTGTAAACAATGCATATGCA
R5′-TCTATTGTTTTATTATCATTATAAATTTGCAAAT
sep(12)
F5′-TTAGACAAACCTATTATCATAATGGAAGT
R5′-TATATAAATATATATCAATATGCATATTTTTAGACT
seq(12)
F5′-GGAAAATACACTTTATATTCACAGTTTCA
R5′-ATTTATTCAGTTTTCTCATATGAAATCTC
hlb(13)
F5′-AGCTTCAAACTTAAATGTCA
R5′-CCGAGTACAGGTGTTTGGTA
sak(13)
F5′-GTGCATCAAGTTCATTCGAC
R5′-TAAGTTGAATCCAGGGTTTT
pvl(14)
F5′-ATCATTAGGTAAAATGTCTGGACATGATCCA
R5′-GCATCAAGTGTATTGGATAGCAAAAGC

3.4. Prophage Typing

A multiplex PCR assay was performed for prophage typing of MRSA strains using specific primers (2) for prophage types SGA, SGB, SGF, SGL and SGD and also 2 subtypes SGFa and SGFb (cycle conditions: 94°C for 5 minutes; 30 cycles at 94°C for 60 seconds, 57°C for 1.5 minutes, and 70°C for 1.5 minutes; and a final extension at 70°C for 3 minutes).

3.5. SCCmec Typing

The presence of mecA gene among MRSA strains was tested according to the protocol published previously (14) (cycle conditions: 94°C for 10 minutes; 25 cycles at 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 75 seconds; and a final extension at 72°C for 10 minutes). SCCmec typing was performed using a multiplex-PCR assay contained specific primers for types I - V as reported previously (15). A multiplex-PCR assay was employed for ccr typing of MRSA strains according to the protocol of Zhang et al. (15) (cycle conditions: initial activation at 94°C for 5 minutes; 10 cycles at 94°C for 45 seconds, 65°C for 45 seconds, and 72°C for 1.5 minutes; 25 cycles at 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1.5 minutes; and a final extension at 72°C for 10 minutes)

4. Results

4.1. Identification and Screening of Methicillin-Resistant Staphylococcus aureus Strains

All 279 strains isolated in this study were confirmed as S. aureus using the genotyping method. Among these, 91 strains (32.6%) that showed resistance to oxacillin and cefoxitin and also were positive for the mecA gene were selected as MRSA.

4.2. Identification of Virulence Genes

As shown in Table 2, six different enterotoxin genes were successfully detected among MRSA strains. Among these, sea, sek and seq were present in all strains and seg, sei and sel were detected in 35%, 23% and 44% of the strains. On the other hand, the PCR for detection of hlb and sak genes were positive among 100% and 85% of the MRSA strains, respectively.
Table 2. Virulence Patterns for Methicillin-Resistant Staphylococcus aureus Strains
No. of Virulence GenesFrequency (%)Pattern
Four virulence genes4 (4.4)
sea, sek, seq, hlb4 (4.4)1
Five virulence genes45 (49.5)
sea, sek, seq, hlb, sak45 (49.5)2
Six virulence genes6 (6.6)
sea, seg, sek, sel, seq, hlb2 (2.2)3
sea, sei, sek, sel, seq, hlb4 (4.4)4
Seven virulence genes31 (34)
sea, seg, sek, sel, seq, hlb, sak19 (20.8)5
sea, sei, sek, sel, seq, hlb, sak6 (6.6)6
sea, seg, sei, sek, seq, hlb, sak2 (2.2)7
sea, seg, sei, sek, sel, seq, hlb4 (4.4)8
Eight virulence genes5 (5.5)
sea, seg, sei, sek, sel, seq, hlb, sak5 (5.5)9
According to the presence of different virulence genes, a total of 9 different patterns were identified. Among these, 5 isolates harbored 8 different virulence genes together. Also, 4 isolates were also positive for genes encoding, SEA, SEK, SEQ and HLB, and the presence of virulence factors among isolates was limited to at least 4 virulence genes. Moreover, nineteen strains (20.8%) were classified in the virulence pattern 5 and harbored seven genes.

4.3. Prophage Typing and SCCmec Typing

Among all 91 MRSA strains, we could detect SGB, SGF, SGFa and SGFb prophage types (Table 3), and all isolates at least contained 1 prophage type and 2 subtypes. Moreover, 2 prophage patterns were also identified among all isolates.
Table 3. The Frequency of Prophage Patterns, SCCmec and ccr Types Among Methicillin-Resistant Staphylococcus aureus Isolates
PatternsProphage TypesSCCmecccrpvlFrequency (%)
SGBSGFSGFaSGFb
1++++III3-72 (79.1)
2-+++III3-19 (20.9)
Only SCCmec type (III) and type 3 ccr were detected among all 91 MRSA strains and none of the isolates were found to be positive for pvl gene (Table 3).

5. Discussion

The prevalence of MRSA in this study was 32.6%. The rate of MRSA in Iran varies in different cities (19 - 90%) (1, 7, 10, 16-21). The variation in different reports in Iran could be due in part to different populations, geographical locations and the quality of hospitals samplings which were carried out.
Unlike other studies in Iran (1, 7, 20), in this study, the prevalence of prophage types among MRSA strains was limited to SGB, SGF, SGa and SGFb, and none of the isolates harbored SGA and SGL prophage types. As we showed previously (7), the absence of SGA prophage type among MRSA strains results in the lack of the pvl gene and consequently no CA-MRSA strains. Moreover, according to our previous claim that the presence of SGA prophage type is related to the low minimum inhibitory concentration (MIC) of oxacillin, none of the isolates had MIC ≥ 4 µg/mL (data not shown). Also, 2 prophage patterns were identified among isolates and type 1 was the dominant type and 80% of the strains were classified in this pattern. We previously showed that, this type was the dominant type among MRSA strains in Tehran (1, 7, 20). Presence of 2 different prophage patterns among MRSA strains indicated the potential of our strains to produce broad spectrum of virulence factors such as exfoliative toxin A, toxic shock syndrome toxin-1 (TSST1), lipase, enterotoxins (A, E, G, K and P), staphylokinase and beta-lysin (1). Similar prophage patterns in previous studies further suggest the circulation of some MRSA clonal types in Tehran.
Similar to this study, reports from Iran and other countries indicated the dominant SCCmec type III among different hospitals (7, 16, 17, 19, 22-24), environment (25) and poultry farms (26). Moreover, all isolates were negative for the pvl gene and the hospital origin of all isolates was demonstrated. In this study, the distribution of SCCmec type III was consistent with the fact that all strains were isolated from patients after 72 hours of admission to the hospital, and were HA-MRSA.
In this study, 6 different enterotoxin and also 2 virulence genes were detected among all MRSA strains. Genes encoding enterotoxins A, K and Q and also hemolysin B were present in all MRSA strains. SEA, SEK and HLB are prophage (SGF) -encoded virulence factors and SEQ is encoded by SaPI. Interestingly, as we showed all MRSA strains harbored SGF, SGFa and SGFb prophage types; so, the presence of sea, sek and hlb was not surprising for us. The prevalence of sea, sek and seq genes among these isolates was higher than other reports (27-29), indicating the pathogenic potential of these isolates. These variations could be due to the origin of these strains and also the location and geographical situation of different countries (30). Like other reports (9, 12, 31-35), here all strains were grouped into different patterns consisting of multiple virulence genes. One explanation for the presence of multiple toxins in most strains is that these genes are often structurally linked. The absence of different enterotoxin genes among the isolates in this study could be due to the lack of plasmids and pathogenicity islands encoding these enterotoxins (4, 36). For example, the sed and sej genes are located at the same plasmids; so, it was not surprising we could not detect both genes. At the moment, the enterotoxin producing strains are spread extensively in the world and have become a challenge for public health and involved in colonization and a broad spectrum diseases (37, 38).
This study demonstrated that the hlb gene is widely distributed among MRSA strains in this hospital. In this study all MRSA isolates were positive for the hlb gene. Although the role of beta hemolysin in diseases is not clearly understood (39), Katayama et al. (40) illustrated that hemolysin also has an important role in skin colonization by damaging keratinocytes, in addition to its well-known hemolytic activity for erythrocytes. Staphylokinase also is another prophage- encoded virulence factor, which favors symbiosis of staphylococci with the host that makes it an important colonization factor (41).
In conclusion, our findings illustrated the presence of highly virulent HA-MRSA strains in a referral hospital in Tehran. The presence of bacteriophage encoded virulence factors and resistance to oxacillin enable bacteria to produce broad spectrum range of diseases, which highlight the potential risk for hospitalized patients in this hospital. Persistence of such strains in hospitals in Tehran could be a challenge for public health.

Acknowledgments

Footnotes

References

  • 1.
    Rahimi F, Bouzari M, Katouli M, Pourshafie MR. Prophage and antibiotic resistance profiles of methicillin-resistant Staphylococcus aureus strains in Iran. Arch Virol. 2012;157(9):1807-11. [PubMed ID: 22684535]. https://doi.org/10.1007/s00705-012-1361-4.
  • 2.
    Pantucek R, Doskar J, Ruzickova V, Kasparek P, Oracova E, Kvardova V, et al. Identification of bacteriophage types and their carriage in Staphylococcus aureus. Arch Virol. 2004;149(9):1689-703. [PubMed ID: 15593413].
  • 3.
    Fraser JD, Proft T. The bacterial superantigen and superantigen-like proteins. Immunol Rev. 2008;225:226-43. [PubMed ID: 18837785]. https://doi.org/10.1111/j.1600-065X.2008.00681.x.
  • 4.
    Schelin J, Wallin-Carlquist N, Cohn MT, Lindqvist R, Barker GC, Radstrom P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence. 2011;2(6):580-92. [PubMed ID: 22030860]. https://doi.org/10.4161/viru.2.6.18122.
  • 5.
    Tang Y, Sussman M, Liu D, Poxton I, Schwartzman J. Molecular Medical Microbiology. 2nd ed. Philadelphia: Elsevier; 2015.
  • 6.
    Argudin MA, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel). 2010;2(7):1751-73. [PubMed ID: 22069659]. https://doi.org/10.3390/toxins2071751.
  • 7.
    Rahimi F, Katouli M, Pourshafie MR. Characteristics of hospital- and community-acquired meticillin-resistant Staphylococcus aureus in Tehran, Iran. J Med Microbiol. 2014;63(Pt 6):796-804. [PubMed ID: 24648470]. https://doi.org/10.1099/jmm.0.070722-0.
  • 8.
    Petrelli D, Repetto A, D'Ercole S, Rombini S, Ripa S, Prenna M, et al. Analysis of meticillin-susceptible and meticillin-resistant biofilm-forming Staphylococcus aureus from catheter infections isolated in a large Italian hospital. J Med Microbiol. 2008;57(Pt 3):364-72. [PubMed ID: 18287301]. https://doi.org/10.1099/jmm.0.47621-0.
  • 9.
    Zouharova M, Rysanek D. Multiplex PCR and RPLA Identification of Staphylococcus aureus enterotoxigenic strains from bulk tank milk. Zoonoses Public Health. 2008;55(6):313-9. [PubMed ID: 18489539]. https://doi.org/10.1111/j.1863-2378.2008.01134.x.
  • 10.
    Rahimi F, Bouzari M, Maleki Z, Rahimi F. Antibiotic susceptibility pattern among Staphylococcus spp. with emphasis on detection of mecA gene in methicillin resistant Staphylococcus aureus isolates. Arch Clin Infec Dis. 2009;4(3):143-50.
  • 11.
    Clinical and Laboratory Standard Institute C. Performance standards for antimicrobial susceptibility testing: Sixteenth informational supplement. Wayne, Pa: Clinical and Laboratory Standards Institute; 2012.
  • 12.
    Sergeev N, Volokhov D, Chizhikov V, Rasooly A. Simultaneous analysis of multiple staphylococcal enterotoxin genes by an oligonucleotide microarray assay. J Clin Microbiol. 2004;42(5):2134-43. [PubMed ID: 15131181].
  • 13.
    Goerke C, Wirtz C, Fluckiger U, Wolz C. Extensive phage dynamics in Staphylococcus aureus contributes to adaptation to the human host during infection. Mol Microbiol. 2006;61(6):1673-85. [PubMed ID: 16968231]. https://doi.org/10.1111/j.1365-2958.2006.05354.x.
  • 14.
    McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci. J Clin Microbiol. 2006;44(3):1141-4. [PubMed ID: 16517915]. https://doi.org/10.1128/JCM.44.3.1141-1144.2006.
  • 15.
    Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43(10):5026-33. [PubMed ID: 16207957]. https://doi.org/10.1128/JCM.43.10.5026-5033.2005.
  • 16.
    Fatholahzadeh B, Emaneini M, Gilbert G, Udo E, Aligholi M, Modarressi MH, et al. Staphylococcal cassette chromosome mec (SCCmec) analysis and antimicrobial susceptibility patterns of methicillin-resistant Staphylococcus aureus (MRSA) isolates in Tehran, Iran. Microb Drug Resist. 2008;14(3):217-20. [PubMed ID: 18694326]. https://doi.org/10.1089/mdr.2008.0822.
  • 17.
    Japoni A, Jamalidoust M, Farshad S, Ziyaeyan M, Alborzi A, Japoni S, et al. Characterization of SCCmec types and antibacterial susceptibility patterns of methicillin-resistant Staphylococcus aureus in Southern Iran. Jpn J Infect Dis. 2011;64(1):28-33. [PubMed ID: 21266752].
  • 18.
    Javidnia S, Talebi M, Saifi M, Katouli M, Rastegar Lari A, Pourshafie MR. Clonal dissemination of methicillin-resistant Staphylococcus aureus in patients and the hospital environment. Int J Infect Dis. 2013;17(9):e691-5. [PubMed ID: 23622783]. https://doi.org/10.1016/j.ijid.2013.01.032.
  • 19.
    Mohammadi S, Sekawi Z, Monjezi A, Maleki MH, Soroush S, Sadeghifard N, et al. Emergence of SCCmec type III with variable antimicrobial resistance profiles and spa types among methicillin-resistant Staphylococcus aureus isolated from healthcare- and community-acquired infections in the west of Iran. Int J Infect Dis. 2014;25:152-8. [PubMed ID: 24909489]. https://doi.org/10.1016/j.ijid.2014.02.018.
  • 20.
    Rahimi F, Bouzari M, Katouli M, Pourshafie MR. Prophage Typing of Methicillin Resistant Staphylococcus aureus Isolated from a Tertiary Care Hospital in Tehran, Iran. Jundishapur J Microbiol. 2012;6(1):80-5. https://doi.org/10.5812/jjm.4616.
  • 21.
    Rahimi F, Bouzari M, Katouli M, Pourshafie MR. Antibiotic Resistance Pattern of Methicillin Resistant and Methicillin Sensitive Staphylococcus aureus Isolates in Tehran, Iran. Jundishapur J Microbiol. 2013;6(2):144-9. https://doi.org/10.5812/jjm.4896.
  • 22.
    Cirlan M, Saad M, Coman G, Bilal NE, Elbashier AM, Kreft D, et al. International spread of major clones of methicillin resistant Staphylococcus aureus: nosocomial endemicity of multi locus sequence type 239 in Saudi Arabia and Romania. Infect Genet Evol. 2005;5(4):335-9. [PubMed ID: 16168939]. https://doi.org/10.1016/j.meegid.2004.09.005.
  • 23.
    Lina G, Quaglia A, Reverdy ME, Leclercq R, Vandenesch F, Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob Agents Chemother. 1999;43(5):1062-6. [PubMed ID: 10223914].
  • 24.
    Schmitz FJ, Sadurski R, Kray A, Boos M, Geisel R, Kohrer K, et al. Prevalence of macrolide-resistance genes in Staphylococcus aureus and Enterococcus faecium isolates from 24 European university hospitals. J Antimicrob Chemother. 2000;45(6):891-4. https://doi.org/10.1093/jac/45.6.891.
  • 25.
    Rahimi F, Bouzari M. Biochemical Fingerprinting of Methicillin-Resistant Staphylococcus aureus Isolated From Sewage and Hospital in Iran. Jundishapur J Microbiol. 2015;8(6). eee19760. https://doi.org/10.5812/jjm.19760v2.
  • 26.
    Rahimi F, Karimi S. Characteristics of Methicillin Resistant Staphylococcus aureus Strains Isolated From Poultry in Iran. Arch Clin Infec Dis. 2015;10(4). eee30885. https://doi.org/10.5812/archcid.30885.
  • 27.
    Bystroń J, Molenda J, Bania J, Kosek-Paszkowska K, Czerw M. Occurrence of enterotoxigenic strains of Staphylococcus aureus in raw poultry meat. Pol J Vet Sci. 2004;8(1):37-40. [PubMed ID: 15794472].
  • 28.
    Klotz M, Opper S, Heeg K, Zimmermann S. Detection of Staphylococcus aureus enterotoxins A to D by real-time fluorescence PCR assay. J Clin Microbiol. 2003;41(10):4683-7. [PubMed ID: 14532203].
  • 29.
    Pourmand MR, Memariani M, Hoseini M, Bagherzadeh Yazdchi S. High prevalence of sea gene among clinical isolates of Staphylococcus aureus in Tehran. Acta Medica Iranica. 2009;47(5):357-61.
  • 30.
    Cremonesi P, Luzzana M, Brasca M, Morandi S, Lodi R, Vimercati C, et al. Development of a multiplex PCR assay for the identification of Staphylococcus aureus enterotoxigenic strains isolated from milk and dairy products. Mol Cell Probes. 2005;19(5):299-305. [PubMed ID: 16006095]. https://doi.org/10.1016/j.mcp.2005.03.002.
  • 31.
    Aydin A, Sudagidan M, Muratoglu K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol. 2011;148(2):99-106. [PubMed ID: 21652103]. https://doi.org/10.1016/j.ijfoodmicro.2011.05.007.
  • 32.
    Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70(2):631-41. [PubMed ID: 11796592].
  • 33.
    Jarraud S, Peyrat MA, Lim A, Tristan A, Bes M, Mougel C, et al. egc, A Highly Prevalent Operon of Enterotoxin Gene, Forms a Putative Nursery of Superantigens in Staphylococcus aureus. J Immunol. 2001;166(1):669-77. https://doi.org/10.4049/jimmunol.166.1.669.
  • 34.
    Smyth DS, Hartigan PJ, Meaney WJ, Fitzgerald JR, Deobald CF, Bohach GA, et al. Superantigen genes encoded by the egc cluster and SaPIbov are predominant among Staphylococcus aureus isolates from cows, goats, sheep, rabbits and poultry. J Med Microbiol. 2005;54(Pt 4):401-11. [PubMed ID: 15770028]. https://doi.org/10.1099/jmm.0.45863-0.
  • 35.
    Spanu V, Spanu C, Virdis S, Cossu F, Scarano C, De Santis EP. Virulence factors and genetic variability of Staphylococcus aureus strains isolated from raw sheep's milk cheese. Int J Food Microbiol. 2012;153(1-2):53-7. [PubMed ID: 22094181]. https://doi.org/10.1016/j.ijfoodmicro.2011.10.015.
  • 36.
    Carfora V, Caprioli A, Marri N, Sagrafoli D, Boselli C, Giacinti G, et al. Enterotoxin genes, enterotoxin production, and methicillin resistance in Staphylococcus aureus isolated from milk and dairy products in Central Italy. Int Dairy J. 2015;42:12-5. https://doi.org/10.1016/j.idairyj.2014.10.009.
  • 37.
    Ataee RA, Hedaiatich M, Mansuor Khanshan R, Ataee MH. Molecular Screening of Staphylococcal Enterotoxin Type P Encoding Gene From Clinical Isolates. Jundishapur J Microbiol. 2013;6(5). https://doi.org/10.5812/jjm.6365.
  • 38.
    Nowrouzian FL, Dauwalder O, Meugnier H, Bes M, Etienne J, Vandenesch F, et al. Adhesin and superantigen genes and the capacity of Staphylococcus aureus to colonize the infantile gut. J Infect Dis. 2011;204(5):714-21. [PubMed ID: 21844297]. https://doi.org/10.1093/infdis/jir388.
  • 39.
    Ariyanti D, Salasia SIO, Tato S. Characterization of haemolysin of Staphylococcus aureus isolated from food of animal origin. Indonesia J Biotechnol. 2011;16(1):32-7.
  • 40.
    Katayama Y, Baba T, Sekine M, Fukuda M, Hiramatsu K. Beta-hemolysin promotes skin colonization by Staphylococcus aureus. J Bacteriol. 2013;195(6):1194-203. [PubMed ID: 23292775]. https://doi.org/10.1128/JB.01786-12.
  • 41.
    Bokarewa MI, Jin T, Tarkowski A. Staphylococcus aureus: Staphylokinase. Int J Biochem Cell Biol. 2006;38(4):504-9. [PubMed ID: 16111912]. https://doi.org/10.1016/j.biocel.2005.07.005.

Similar Articles

5
Sep
2018
https://www.google.com/search?q=staphylococcus+aureus&source=lnms&tbm=isch&sa=X&sqi=2&ved=0ahUKEwjl1-rfsaPdAhUEy1MKHSqRCwIQ_AUICigB&biw=1366&bih=631#imgrc=xmjpRJxzgXczKM:

Characterization of Virulence Factors and Prophage Profiles of Methicillin-Resistant Staphylococcus aureus Strains Isolated from a Referral Hospital in Tehran, Iran

Fateh Rahimi,
Leili Shokoohizadeh

Rahimi F, Shokoohizadeh L. Characterization of Virulence Factors and Prophage Profiles of Methicillin-Resistant Staphylococcus aureus Strains Isolated from a Referral Hospital in Tehran, Iran. Arch Clin Infect Dis. 2018;13(5):e59385. doi: https://doi.org/10.5812/archcid.59385

24
Oct
2012

Prophage Typing of Methicillin Resistant Staphylococcus aureus Isolated from a Tertiary Care Hospital in Tehran, Iran

Fateh Rahimi,
Majid Bouzari,
Mohammad Katouli,
Mohammad Pourshafie

Rahimi F, Bouzari M, Katouli M, Pourshafie M. Prophage Typing of Methicillin Resistant Staphylococcus aureus Isolated from a Tertiary Care Hospital in Tehran, Iran. Jundishapur J Microbiol. 2012;6(1):80-85. doi: https://doi.org/10.5812/jjm.4616

3
Oct
2017

Molecular Characterization and Antimicrobial Susceptibility Patterns of Methicillin-Resistant Staphylococcus aureus Isolates in Tabriz, Northwest of Iran

Mojtaba Nikbakht,
Mohammad Ahangarzadeh Rezaee,
Alka Hasani,
Mohammad Reza Nahaei,
Javid Sadeghi,
Sirus Jedari Seifi

Nikbakht M, Ahangarzadeh Rezaee M, Hasani A, Nahaei MR, Sadeghi J, et al. Molecular Characterization and Antimicrobial Susceptibility Patterns of Methicillin-Resistant Staphylococcus aureus Isolates in Tabriz, Northwest of Iran. Arch Pediatr Infect Dis. 2017;5(4):e61620. doi: https://doi.org/10.5812/pedinfect.61620

30
Nov
2023
Jundishapur J Microbiol

Molecular Characterization and Phage Typing of Methicillin-resistant Staphylococcus aureus Isolated from Clinical Samples in Isfahan, Iran

Fatemeh Sadat Zarkesh Esfahani,
Fereshte Ghandehari,
Bahram Nasr Esfahani,
Keivan Beheshti-Maal

Zarkesh Esfahani FS, Ghandehari F, Nasr Esfahani B, Beheshti-Maal K. Molecular Characterization and Phage Typing of Methicillin-resistant Staphylococcus aureus Isolated from Clinical Samples in Isfahan, Iran. Jundishapur J Microbiol. 2023;16(10):e139277. doi: https://doi.org/10.5812/jjm-139277

1
Jun
2014

Analysis of Virulence Genes Among Methicillin Resistant Staphylococcus aureus (MRSA) Strains

Seyedeh Mahsan Hoseini Alfatemi,
Mohammad Motamedifar,
Nahal Hadi,
Hadi Sedigh Ebrahim Saraie

Hoseini Alfatemi SM, Motamedifar M, Hadi N, Sedigh Ebrahim Saraie H. Analysis of Virulence Genes Among Methicillin Resistant Staphylococcus aureus (MRSA) Strains. Jundishapur J Microbiol. 2014;7(6):e10741. doi: https://doi.org/10.5812/jjm.10741


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC