1. Background
Burn infection is one of the most serious and common health problems worldwide, especially in the developing countries. Patients with severe burn injuries need urgent care to diminish complications after severe burns. One of the most notable and crucial complications of burn is wound infections (1). It is estimated that about 75% of the mortality is due to the infections that develop afterwards in burn injuries (2). Burn damages the skin and exposes a large portion of tissue to infectious agents in a long time and as a more sustainable source of infection is a suitable place for opportunistic microorganisms to reside, afterwards colonization and bacterial products increase inflammation and infection (3, 4). Treatment of wound infections is a challenge due to the biofilms formation and resistance to antibiotics (5). Also, inadequate initial therapy is associated with poor clinical outcomes, longer hospital stays and higher costs (6). Pseudomonas aeruginosa and Acinetobacter baumannii appear as important pathogens particularly in burn wards. Opportunistic pathogens such as P. aeruginosa and A. baumannii, cause infections such as pneumonia, septicemia, urinary tract infections, endocarditis, skin, ear and eye infections. Antibiotic therapy is considered as the main strategy to treat and manage burn infections. However, increasing antibiotic resistance is a crucial problem for health care systems (7). Recently this problem is hardened by appearance of multidrug resistant (MDR) strains with more than 40% - 50% mortality rates (8). Carbapenems are often used as a last resort to treat infections caused by multidrug-resistant Gram-negative bacilli (9, 10). The increase of carbapenem resistance in these microorganisms is a major concern. The most common mechanism of resistance is the production of carbapenemases, such as Ambler classes A, B and D enzymes. Metallo-beta-lactamases (MBLs) are associated with plasmid genes such as blaIMP and blaVIM that are the major mechanisms to acquire resistance to carbapenems. New Delhi metallo-ß-lactamase (NDM-1) as a new type of MBL was first detected in a Swedish patient admitted to hospital in New Delhi, India (11, 12). MBL genes distribute quickly in many species of Gram-negative bacilli because they exist on mobile gene cassettes (13, 14). Thus, detection of MBL-producing strains is essential to select the best option to treat patients and manage the prevalence of resistance (9).
2. Objectives
The current study aimed to determine the prevalence of MBL genes in P. aeruginosa and A. baumanii species among patients with burn injuries in Shahid Motahari hospital in Tehran, Iran.
3. Methods
3.1. Bacterial Identification
Samples were collected by sterile swabs from patients with burn injuries referred to the burn unit of Shahid Motahari hospital (level I burn care center) in Tehran; it is the referral state hospital for the patients with burn injuries and also the main center for the burn research in Tehran, Iran. The collected samples were transferred into Stuart media and immediately transported to the department of microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Samples were cultured on MacConkey and blood agar (Merck, Germany) and incubated at 37°C for 24 hours. Identification of bacterial isolates were accomplished by conventional biochemical tests including catalase, oxidase, triple-sugar-iron (TSI) agar, oxidation/fermentation of glucose using OF media and growth at 42°C; A. baumannii was further confirmed by blaOXA-51 gene using polymerase chain reaction (PCR) and sequencing techniques (15).
3.2. Antimicrobial Susceptibility Testing
Resistance to antibiotics was determined by Kirby-Bauer disc diffusion method on Mueller Hinton agar (Merck, Germany) using the following antibiotics: gentamicin (GEN: 10 μg), amikacin (AK: 30 μg), imipenem (IPM: 10 μg), cefotaxime (CTX: 30 μg), cefepime (FEP: 30 μg), meropenem (MEM: 10 μg), doripenem (DPM: 10 μg), ciprofloxacin (CIP: 5 μg), ticarcillin (TIC: 75 μg), piperacillin/tazobactam (PTZ: 100/10 μg), ceftazidime (CAZ: 30 μg), aztreonam (AZA: 30 μg) and piperacillin (PIP, 100 μg) (Mast, UK) for P. aeruginosa strains. Imipenem (IPM: 10 μg), meropenem (MEM: 10 μg), ceftazidime (CAZ: 30 μg), cefotaxime (CTX: 30 μg), amikacin (AK: 30 μg), piperacillin/tazobactam (PTZ: 100/10 μg), piperacillin (PIP, 100 μg), ceftriaxone (CTX: 10 μg), tetracycline (TE: 10 μg), colistin (CT: 10 μg), ciprofloxacin (CIP: 5 μg), cefepime (FEP: 30 μg), trimethoprim-sulfamethoxazole (TS: 2.5 μg) and gentamicin (GEN: 10 μg) (Mast, UK) used for A. baumannii and P. aeruginosa strains. The zones of inhibition were reported according to the clinical and laboratory standards institute (CLSI) (M100-S23) 2013. The quality control strains used for the study were P. aeruginosa ATCC27853 and Escherichia coli ATCC 25922 (10, 16).
3.3. MBL Detection by Combination Disk Diffusion Test (CDDT)
The frequency of MBLs producers was measured by combination disk diffusion Test (CDDT). The strains resistant to carbapenems (imipenem and meropenem) were screened for MBL production by CDDT using IMP (10 mg) and MER (10 mg) (Mast Group, Merseyside, UK) solely and in combination with ethylenediaminetetraacetic acid (EDTA). An increase of 7 mm or more in the inhibition zone diameter of EDTA containing imipenem disc compared to imipenem disc was considered positive for MBL (17, 18). The positive control strain used for the study was P. aeruginosa.
3.4. Molecular Detection of Resistance Genes
Total DNAs of different bacterial isolates were extracted by the DNA extraction kit (Bioneer Company, Korea, Cat. number K-3032-2). The existence of blaIMP, blaVIM, blaDIM, blaAIM, blaGIM and blaNDM genes were determined by PCR using the following suitable primers: IMP-F(GGAATAGAGTGGCTTAAYTCTC), IMP-R (GGTTTAAYAAAACAACCACC) (232 bp) for blaIMP, VIM-F(GATGGTGTTTGGTCGCATA), VIM-R(CGAATGCGCAGCACCAG) (390 bp) for blaVIM, DIM-F(GCTTGTCTTCGCTTGCTAACG), DIM-R(CGTTCGGCTGGATTGATTTG) (699 bp) for blaDIM, AIM-F(CTGAAGGTGTACGGAAACAC), AIM-R(GTTCGGCCACCTCGAATTG) (322 bp) for blaAIM, GIM-F(TCGACACACCTTGGTCTGAA), GIM-R(AACTTCCAACTTTGCCATGC) (477 bp) for blaGIM, NDM-F(GGTTTGGCGATCTGGTTTTC) and NDM-R(CGGAATGGCTCATCACGATC) (621 bp) for blaNDM (15). Reactions were performed on a thermal cycler (Eppendorf, Master Cycler Gradient) and PCR programs used in this study were as previously described (19). PCR product bands were analyzed after electrophoresis on a 1.5% agarose gel at 95 V for 45 minutes in 0.5x Tris/Borate/EDTA (TBE) containing ethidium bromide, and the result was checked under UV irradiation. Pseudomonas aeruginosa PA53 (ACCESSION: KM359726) for IMP-1 and Pseudomonas aeruginosa Psa1 (ACCESSION: KT313641) for VIM-1 genes were used as the control strains. DNA sequencing was performed on the purified PCR products by the Bioneer Company (Korea). The nucleotide sequences were analyzed by Finch TV software and compared with sequences in the GenBank using the NCBI basic local alignment search tool (www.ncbi.nlm.nih.gov/BLAST).
3.5. Statistical Analysis
To analyze the results, MINITAB16 software was used. P value and confidence intervals (CI) were < 0.05 and 95%, respectively.
4. Results
This cross-sectional study was performed on hospitalized patients with burn injuries from January 2012 to May 2015. Three hundred and nine nonduplicate isolates of P. aeruginosa and one hundred and eighty-nine isolates of A. baumannii were collected from inpatients in Shahid Motahari burn hospital, Tehran, Iran.
4.1. Antimicrobial susceptibility of P. aeruginosa and A. baumannii isolates
In the current study, the most effective antibiotic against the studied isolates was colistin. The results of disc diffusion test with different antibiotics for P. aeruginosa and A. baumannii isolates are shown in Tables 1 and 2.
| Antibiotics | Resistance in 2012, No. (%) | Resistance in 2013, No. (%) | Resistance in 2014, No. (%) | Resistance in 2015, No. (%) |
|---|---|---|---|---|
| Gentamicin | 49 (49) | 34 (72.34) | 59 (95.1) | 95 (95) |
| Amikacin | 79 (79) | - | 52 (83.8) | 95 (95) |
| Imipenem | 83(83) | 37 (78.72) | 58 (93.5) | 96 (96) |
| Carbenicillin | 83 (83) | - | - | - |
| Cefepime | 87 (87) | 32 (68.08) | 53 (85.5) | 96 (96) |
| Meropenem | 83 (83) | 35 (74.46) | 54 (87.1) | 96 (96) |
| Ciprofloxacin | 88 (88) | 32 (68.08) | 55 (88.7) | 97 (97) |
| Piperacillin/tazobactam | 86 (86) | - | 42 (67.7) | 95 (95) |
| Ceftazidime | 83 (83) | 34 (72.34) | 41 (66.1) | 85 (85) |
| Aztreonam | 84 (84) | 39 (82.97) | 39 (62.9) | 97 (97) |
| Piperacillin | 90 (90) | - | 47 (75.8) | 95 (95) |
| Tobramycin | 90 (90) | - | - | - |
| Colistin | 0 | - | 0 | 1 (1) |
| Ticarcillin | - | - | 59 (95.1) | 99 (99) |
| Doripenem | - | - | 55 (88.7) | 95 (95) |
| Antibiotics | Resistance in 2012, No. (%) | Resistance in 2013, No. (%) | Resistance in 2014 - 2015, No. (%) |
|---|---|---|---|
| Gentamicin | 27 (96.42) | 56(93.33) | 95 (94.05) |
| Co-trimoxazole | 28 (100) | 60 (100) | 101 (100) |
| Amikacin | 28 (100) | 50 (83.33) | 101 (100) |
| Imipenem | 28 (100) | 58 (96.66) | 101 (100) |
| Cefotaxime | 28 (100) | 60 (100) | 101 (100) |
| Cefepime | 28 (100) | 60(100) | 101 (100) |
| Meropenem | 28 (100) | 60(100) | 101 (100) |
| Ciprofloxacin | 28 (100) | 60 (100) | 101 (100) |
| Ceftriaxone | 28 (100) | 60 (100) | 101 (100) |
| Piperacillin/tazobactam | 28 (100) | 60 (100) | 101 (100) |
| Ceftazidime | 28 (100) | 60 (100) | 101 (100) |
| Tetracycline | 28 (100) | 50 (83.33) | 101 (100) |
| Piperacillin | 28 (100) | 60 (100) | 101 (100) |
| Colistin | 0 | 0 | 0 |
4.2. Screening for MBLs Using CDDT
In the current study, among the 309 P. aeruginosa clinical isolates, 278 strains were imipenem resistant and 178 (64.02%) were determined as MBL producers by the CDDT test. In addition, it was found that from 189 A. baumannii strains, 187 isolates were imipenem resistant and 85(45.4%) were MBL producers.
4.3. Detection of MBL Genes
PCR technique showed the existence of blaIMP-1 and blaVIM-1 genes in 30 (16.8%) and 52 (29.2%) isolated strains of P. aeruginosa, respectively; while the other gene was not detected. The blaOXA-51, blaIMP-1 and blaVIM-1 genes were detected in 187 (100%), 10 (5.3%) and 34 (18.18%) of A. baumannii isolates, respectively; whereas none of them were positive for blaDIM, blaAIM, blaGIM and blaNDM genes. The nucleotide sequence data reported in this paper was submitted to the GenBank sequence database and assigned accession no. KM359726, KM359725, KT313640, KP780165, KP765726, KP765725, JX648311, KR703251, for blaIMP and KT313641 for blaVIM in P. aeruginosa strains and KU372121 , KR424775, KU372120, KU372118, KF723585 for blaIMP in A. baumannii strains.
5. Discussion
Pseudomonas aeruginosa and Acientobacter baumannii are responsible for hospital-acquired infections and are recently two of the most important healthcare-associated infections in hospitals. Infection caused by these bacteria often lead to significant mortality and morbidity (15, 20). In the current study, the best coverage against P. aeruginosa isolates was obtained with colistin sulfate and gentamicin. Also, the resistance rate of A. baumannii isolates against most of the antibiotics was 100%. Therefore, the best coverage against the study A. baumannii isolates was obtained with colistin sulfate. Colistin is active against a broad range of Gram-negative bacteria, including most members of Enterobacteriaceae (20). In “the lancet infectious diseases”, Yi-Yun Liu et al. (21), described mcr-1 a plasmid-mediated gene that confers colistin resistance in E. coli and Klebsiella pneumoniae strains isolated from animals and patients in China. Transfer of the resistance to multidrug resistant Enterobacteriaceae would seriously limit the current treatment options. Keep it in mind that the resistance genes responsible for antimicrobial resistance are found on conjugative plasmids and that carbapenem and colistin-resistant E. coli may be found in retail meat, if such strains colonise in the human intestinal tract they can transfer the resistance plasmids to other Gram-negative pathogens such as P. aeruginosa and A. baumannii and the consequence is untreatable infections (22). Carbapenem resistance mechanisms in Gram-negative bacilli are associated with resistance to other classes of antibiotics such as penicillins, monobactams and cephalosporins possibly because of parallel resistance mechanisms (23, 24). Actually, resistance to carbapenems caused resistance to other valuable antibiotics, which makes the treatment process very difficult. Therefore, identifying carbapenem resistant strains and infection control programs are very useful (25). The most common mechanism of resistance is the production of β-lactamases, including enzymes of Ambler classes A, D and B, with the corresponding genes often associated with mobile genetic elements such as plasmids (19). Simple and suitable tests are needed to identify MBL-producing isolates that is a crucial step to monitor these emerging resistance. Suppression of enzyme via EDTA is an efficient method used to differentiate MBL mechanisms from other β-lactamases (9, 17, 26) and also PCR method was valuable to determine MBL-producing isolates (13). In the current study, from 278 imipenem-resistant P. aeruginosa and 187 imipenem-resistant A. baumannii isolates, 178 and 85 isolates were MBL-producers, respectively. Large outbreaks by MBL-producing P. aeruginosa strains were described in hospitals in Greece, Italy and Korea (27). Among MBL genes, IMP is more important, especially in Iran; however, its first report was from Japan in 1980. The other gene is VIM reported from Ahwaz, Iran (15). In the current study, PCR techniques showed the existence of blaIMP-1 and blaVIM-1 genes in 30 (16.8%) and 52 (29.2%) of P. aeruginosa strains, respectively; while the other gene was not detected. The blaOXA-51, blaIMP-1 and blaVIM-1 genes were detected in 187 (100%), 10 (5.3%) and 34 (18.18%) of A. baumannii isolates, respectively; whereas none of them were positive for blaDIM, blaAIM, blaGIM and blaNDM genes. The prevalence of blaIMP and blaVIM types of MBL-producing A. baumannii was previously reported in Iran in 2014. It was shown that out of 99 imipenem resistant A. baumannii strains, 86 (86.86%) were MBL producers. The frequencies of blaIMP and blaVIM genes in MBL producing A. baumannii isolates were 3 (3.48%) and 15 (17.44%), respectively (15). Another study revealed that among 75 Gram-negative isolates from patients with burn injuries, 47(62.67%) were recognized as P. aeruginosa and 28 (36.33%) as A. baumannii; the CDDT results showed that 13 (17.8%) of the P. aeruginosa isolates and 12 (16.4%) of the A. baumannii isolates were the MBLs producers. Additionally, this study reported that the mortality rate caused by MBL producing P. aeruginosa and A. baumannii infection was 5 (20%) among the burn patients (19). Also, it is reported that 94% of P. aeruginosa isolates from Tehran were identified as MBL producers and carried the blaVIM-2 gene (19). In another study as the first carbapenem resistance report from Libya in 2014, totally 49 isolates (24 P. aeruginosa and 25 A. baumannii) were collected and imipenem resistance was observed in twenty-one P. aeruginosa and twenty-two A. baumannii isolates (87.75%); nineteen P. aeruginosa isolates had the blaVIM-2 gene (28). A study in Poland on MBL-producer A. baumannii isolates showed that 10.3% of the isolates carried blaIMP-like gene and blaVIM-4 was not detected in the isolates. Also, in a similar study in India, 47% of A. baumannii isolates carried blaVIM and 0.9% of them harbored blaIMP (29). The blaIMP and blaVIM-producing P. aeruginosa strains are reported worldwide (27). The rapid diagnosis of MBL isolates is helpful to select suitable options for antimicrobial therapy and prevent the spread of MBL strains. The clinical microbiology laboratories should consider it important to detect MBL producing P. aeruginosa and A. baumannii isolates. It is recommended to routinely check that all carbapenem resistant P. aeruginosa and A. baumannii isolates for the MBL production.