Association of PvuII T> C and XbaI A> G Polymorphisms of Estrogen Receptor α Gene with Uterine Leiomyoma: A Case-Control Study

Author(s):
Mojgan MokhtariMojgan Mokhtari1, Sepideh ZakerianSepideh Zakerian2, Farzaneh Farajian-MashhadiFarzaneh Farajian-Mashhadi3, 4, Saeedeh SalimiSaeedeh SalimiSaeedeh Salimi ORCID5,*
1Department of Obstetrics and Gynecology, School of Medicine, Iran University of Medical Sciences, Tehran, Iran
2Department of Obstetrics and Gynecology, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran
3Department of Pharmacology, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran
4Cellular and Molecular Research Center, Zahedan University of Medical Sciences, Zahedan, Iran
5Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran

Gene, Cell and Tissue:Vol. 5, issue 2; e79616
Published online:Aug 08, 2018
Article type:Research Article
Received:May 23, 2018
Accepted:Aug 04, 2018
How to Cite:Mokhtari M, Zakerian S, Farajian-Mashhadi F, Salimi S. Association of PvuII T> C and XbaI A> G Polymorphisms of Estrogen Receptor α Gene with Uterine Leiomyoma: A Case-Control Study. Gene Cell Tissue. 2018;5(2):e79616. doi: https://doi.org/10.5812/ijhrba.79616

Abstract

Background:

Uterine leiomyomas (ULs) are benign tumors in the uterus that their growth and progression are stimulated by the estrogen hormone. In the current study, we aimed to determine if estrogen receptor α (ERα) polymorphisms could be used as the markers of the susceptibility to UL.

Methods:

The ERα gene polymorphisms of 154 UL women and 186 controls were genotyped by PCR or PCR-RFLP methods.

Results:

The frequency of ESRα PvuII T> C polymorphism genotypes did not differ among the women with leiomyoma and controls. However, the frequency of ESRα XbaI GG genotype was significantly higher than the frequency of AA genotype (27% vs 10%) in UL women and the UL risk was 4.1 folds greater in women carrying GG genotype (P < 0.0001). In the UL women, a higher frequency was observed for TG and CG haplotypes of ESRα PvuII/XbaI polymorphisms compared to TA haplotype and these haplotypes showed 3.2 and 1.5 folds increases in UL risk (P = 0.003 and P = 0.04, respectively). The frequency of CA haplotype was higher in controls, and the CA haplotype might have a potential to protect against UL (P = 0.04).

Conclusions:

The GG genotype of XbaI A> G polymorphism and TG and CG haplotypes of PvuII T> C / XbaI A> G polymorphisms could increase the risk of UL.

1. Background

Uterine leiomyomas (ULs) are benign tumors that arise from uterine smooth muscle cells and diagnosed in about 30 - 40% of women during the reproductive age. Almost the cause of 17% of the hysterectomies in the U.S is UL (1).
Evidence shows that ULs are monoclonal and originate from somatic mutations in myometrial cells, causing the advanced lack of growth regulation (2). UL formation is multistep and multifactorial and growth factors, ovarian steroid hormones, and cytokines play key roles in its development (3, 4). The occurrence of several myomas establishes a genetic susceptibility for myoma development; but, the familial inheritance of UL has not been well considered (5). Although the incidence of these tumors is high, their exact pathophysiology and the proliferative pathway are not identified. Age, endogenous hormones, family history, African-American race, weight, a diet rich in red meat, and menopausal hormone therapy are various risk factors of UL (6).
The UL is an estrogen-dependent complication because it develops during the reproductive (hormonally active) years and regresses after menopause (7). In addition, UL grows during gestation, and the hypogonadal condition induced by gonadotropin-releasing hormone (GnRH) agonists often leads to a decrease in myomas (8).
Leiomyomas are estrogen-dependent and this steroid hormone triggers the progression of cell proliferation in the G1 phase of the cell cycle in various tissues including the uterus (9).
Physiological and pathological activities of estrogen are applied through an estrogen receptor (ER). There are two isoforms of estrogen receptors (ERα and ERβ) coded by two different genes. Both receptors are expressed in osteoblasts, osteoclasts, bone marrow, and uterus (10, 11). Since genetic alterations in these receptors can affect estrogen function, polymorphisms of these genes could be good candidates for disease in women (11).
ERα gene is located on a 6q25 chromosome and contains eight exons and seven introns (12). There are several polymorphisms in this gene that can affect the expression or its function. One of these polymorphisms is the displacement of T/C on the border of intron 1 and exon 2 that is detected by PvuII (rs2234693) restriction enzyme (11). Another polymorphism is the displacement of A/G near the PvuII polymorphism, which is detected by XbaI restriction enzyme. In silico analysis revealed that PvuII and XbaI polymorphisms could slightly distress the mRNA splicing’s of ERα although these substitutions cannot generate new cryptic splice acceptor or donor sites; thus, these genes polymorphisms have not intense modification on these mRNA splicing (13).
According to the role of genetics on UL susceptibility, several studies have evaluated the association between genetic polymorphisms in different genes and UL, the results of which are inconsistent (14-16). Given the high prevalence of UL and the possible role of estrogen and its receptors in the incidence of the disease, the present study was conducted to examine the possible association of ERαPvuII and XbaI polymorphisms with UL in an Iranian population.

2. Methods

2.1. Patients

This case-control study was conducted on 154 pre-menopause women undergoing myomectomy or hysterectomy and 186 BMI and age-matched healthy controls. Women who received hormonal drugs within the last year prior to the study were excluded. The UL women were selected using probability sampling method from among the patients of gynecologic clinics and their disease had been confirmed pathologically.
The healthy controls were also the premenopausal women selected from among the women referring for the routine check-up and the Pap smear test. The UL and control groups were matched according to age and ethnicity. The control group was examined by physical and ultra-sonographic evaluations to exclude the uterine leiomyoma. All women with systemic diseases and a history of malignancy were excluded from the study.
The protocol of the study was approved by the Ethics Committee of Zahedan University of Medical Sciences. All the women gave their informed consent before participating in the study.

2.2. DNA Analysis

The genomic DNA was extracted from the peripheral blood using the salting-out method. PvuII and XbaI polymorphisms were genotyped by polymerase chain reaction-restriction fragment lengths polymorphism (PCR-RFLP).
A 1.3 Kb PCR product that comprised the PvuII and XbaI polymorphic sites was amplified using two oligonucleotide primers forward: 5’- CTGCCACCCTATCTGTATCTTTTCCTATTCTCC -3’ and reverse: 5’ - TCTTTCTCTGCCACCCTGGCGTCGATTATCTGA - 3’, as previously described (17). PCR was performed according to the following protocol: initial denaturation at 94°C for 3 minutes; 30 cycles of denaturation at 94°C for 62 seconds; annealing at 62°C for 60 seconds; and extension at 72°C for 90 seconds and a final extension at 72°C for 5 minutes. The PCR products were digested with the PvuII and XbaI restriction enzymes. The digested products were electrophoresed on 2% agarose gel stained with safe stain (Figures 1A and 1B).
The PCR-RFLP analysis results of A. <i>PvuII T</i>&gt; C and b. <i>XbaI</i> A&gt; G polymorphisms of <i>ERα</i> gene
Figure 1.

The PCR-RFLP analysis results of A. PvuII T> C and b. XbaI A> G polymorphisms of ERα gene

2.3. Statistical Analysis

Statistical analysis was performed using SPSS version 18.0 software. The Hardy-Weinberg equilibrium was evaluated by the chi-square test. Statistical differences between qualitative variables were determined using the chi-square test or Fisher Exact Test and quantitative variables using independent sample t-test. Different allele frequencies were calculated using the genotype of all samples. The comparison of allele frequencies and genotypes was made using the chi-square test. Linkage disequilibrium (LD) was analyzed using CubeX software (18). The logistic regression analysis was used to assay the independent effect of each risk polymorphism and haplotype on UL. A P-Value of less than 0.05 was considered significant.

3. Results

Table 1 presents the clinical and demographic characteristics of the uterine leiomyoma women and controls. There was no significant difference according to maternal age and age of menarche between the UL and control groups. The bleeding and pain symptoms were more frequent in the UL women than in the controls.
Table 1.The Demographic and Clinical Characteristics of the UL Patients and Controls
ParameterPatient (N = 154)Control (N = 186)P-Value
Age (y)38.5 ± 1037.1 ± 5.50.1
Marrieda147 (95.5)182 (98)0.2
BMI (Kg/m2)25.3 ± 5.225.2 ± 4.90.9
Age at menarche (yr)13.4 ± 1.313.2 ± 1.60.3
Menstrual days6.1 ± 1.65.8 ± 1.50.09
Intervals of menstruation (d)28.1 ± 428.7 ± 20.2
Bleedinga88 (57)7 (3.8)< 0.0001
Paina46 (30)9 (5)< 0.0001

a Values represented as No. (%).

The frequency of CC, TC, and TT genotypes of PvuII T> C polymorphism was not significantly different between the two groups (P > 0.05) (Table 2). The frequency of the C allele was not statistically different between the UL and control groups (P = 1). However, the frequency of GG genotype of XbaI A> G polymorphism was significantly higher than AA genotype and could increase the risk of UL up to 4.1 folds (OR, 4.1 [95% CI, 2.1to 8.1]; P < 0.0001) (Table 2). The frequency of the G allele indicated a significant difference (P < 0.0001).
Table 2.The Frequency of Alleles and Genotypes of ERαPvuII T> C and XbaI A> G Polymorphisms in the Uterine Leiomyoma Women and Controlsa
ERα PolymorphismsPatient (N = 154)Control (N = 186)P-ValueAdjusted OR (95%CI)
PvuII T > C
TT41 (27)50 (26.9)Ref = 1
TC79 (51)94 (50.5)0.961 (0.6 - 1.6)
CC34 (22)42 (22.6)11 (0.6 - 1.8)
Allele
T161 (52)194 (52)1
G147 (48)178 (48)11 (0.7 - 1.4)
XbaI A> G
AA36 (23)69 (37)1
AG77 (50)98 (53)0.11.5 (0.9 - 2.5)
GG41 (27)19 (10)< 0.00014.1 (2.1 - 8.1)
Allele
A149 (48)236 (63)1
G159 (52)136 (37)< 0.00011.9 (1.4 - 1.2.5)

a Values represented as No. (%).

The frequency of four haplotypes of ERαPvuII and XbaI polymorphisms is shown in Table 3.
Table 3.Haplotypes Frequency of ERαPvuII T> C and XbaI A> G Polymorphisms in the Uterine Leiomyoma Women and Controls
HaplotypePatientControlP-Value
TA0.41 - 1260.4792 - 1781
TG0.1128 - 340.0396 - 150.003 3.2 (1.7 - 6.1)
CA0.0738 - 230.1552 - 580.04 0.6 (0.3 - 1)
CG0.4035 - 1240.326 - 1210.04 1.5 (1 - 2)
The frequency of TG and CG haplotypes was significantly higher than the frequency of TA haplotype in UL women and these haplotypes showed 3.2 (OR, 3.2 [95% CI, 1.7 to 6.1]; P = 0.003) and 1.5 (OR, 1.5 [95% CI, 1 to 2]; P = 0.04) folds increases in the UL risk. Moreover, the CA haplotype was significantly more frequent in the controls; therefore, CA haplotype might be a protective factor against UL (OR, 0.6 [95% CI, 0.3 to 1]; P = 0.04). Linkage disequilibrium calculated for ERαPvuII and XbaI polymorphisms showed D’ = 0.68, r2 = 0.4 in the UL women and D’ = 0.8, r2 = 0.39 in the control women.

4. Discussion

Uterine leiomyoma is an estrogen-dependent neoplasm in women. Therefore, estrogen and ERs play key roles in the pathogenesis of this complication (19). Genetic and environmental factors could contribute to the development of UL. Several ERα polymorphisms can affect the function of the sex-steroid system. However, the mechanisms of these polymorphisms on diseases remain unclear (20). Although polymorphisms (unlike mutations) are not directly related to the diseases, they are valuable approaches in the investigation of multifactorial disorders. Polymorphisms that occur in the regulatory or structural regions could alter the expression levels of genes or function of proteins. It seems that the susceptibility genes interact with other genes and environmental factors to accelerate disease progression (21).
Numerous studies indicate that ERα polymorphisms could affect various physiological processes in the humans, especially in women, which may be involved in the pathogenesis of various diseases (13, 20, 22). In the present study, there was no association between the genotypes of ESRα PvuII T> C polymorphism and UL. However, the frequency of GG genotype of ESRαXbaI A> G polymorphism was significantly higher than the frequency of AA genotype and could increase the risk of leiomyoma up to 4.1 folds (0.0001 > P). The XbaI G allele was significantly more frequent in the UL women (0.0001 > P). The frequency of TG and CG haplotypes were higher than the frequency of TA haplotype in the UL women. Furthermore, the CA haplotype was significantly more frequent in the controls.
Unlike the results of the current study, Kitawaki et al. in 2001 found a correlation between ESRαPvuII polymorphism and endometriosis, adenomyosis, and leiomyomata (estrogen-dependent benign uterine diseases) in Japan (14). However, in 2001, Massart et al. (23) showed no correlation between PvuII and XbaI polymorphisms of ESRα gene and UL in Italy. No association also was observed by Denschlag et al. in Germany and Villanova et al. in Brazil between ESRαPvuII polymorphism and UL susceptibility (24, 25). Similar to the findings of the present study, Hsieh et al. (20) found an association between G allele of XbaI polymorphism and UL in Taiwan; however, contrary to our results, they revealed an association between ESRα PvuII T> C polymorphism and UL.
Al-Hendy and Salama observed an association between ESRα PP (CC) genotype in black and white women but not in Hispanic women. In addition, they found a higher frequency for the PP genotype in black women compared to white or Hispanic women, which might explain the increased occurrence of UL among black women (26). Govindan et al. (27) indicated an association between the C allele of PvuII polymorphism and endometriosis and UL in India.
In a meta-analysis of 11 studies by Feng et al. (28) in 2011, a significant association was observed between ERαPvuII, but not XbaI polymorphism, and a higher risk of uterine leiomyoma. Taghizade Mortezaee et al. (29) showed no correlation between ERαPvuII and XbaI polymorphisms and increased risk of leiomyoma in the west of Iran. In a recent study, Veronica et al. (30) indicated that ERβ -13950TC genotype and progesterone receptor +331GA and AA genotypes, as well as the corresponding hormonal levels, could be involved as biomarkers in the UL prediction.
These different results may be due to different genetic backgrounds or due to the heterogenicity effect of specific genes polymorphisms in different populations. On the other hand, the linkage disequilibrium (LD) may be a reason for these differences, as well. LD is distributed differently in different populations (31).
There are some limitations to the current study such as the small sample size, which might affect the results, environmental conditions, and different ethnic groups living in the southeast of Iran. In addition, if it was possible to perform this study in both myomatous and intact tissues, the results would be more valuable.
In conclusion, the present study indicated the association between GG genotype of A> G polymorphism and UL susceptibility. Moreover, the frequency of TG and CG haplotypes of ERαPvuII T> C and XbaI A> G polymorphisms was higher and CA haplotype was lower in the UL women. However, the role of these polymorphisms in the pathogenesis of leiomyoma should be clarified and the role of other polymorphisms of this gene should be investigated in further studies.

Footnotes

References

  • 1.
    Hoffman B, Schorge J, Schaffer J, Halvorson L, Bradshaw K, Cunningham F. Williams gynecology. 2 ed. Mcgraw-hill; 2012.
  • 2.
    Jeon YT, Kim JW, Park NH, Song YS, Kang SB, Lee HP. DNA repair gene XRCC1 Arg399Gln polymorphism is associated with increased risk of uterine leiomyoma. Hum Reprod. 2005;20(6):1586-9. [PubMed ID: 15760950]. https://doi.org/10.1093/humrep/deh836.
  • 3.
    Parker WH. Etiology, symptomatology, and diagnosis of uterine myomas. Fertil Steril. 2007;87(4):725-36. [PubMed ID: 17430732]. https://doi.org/10.1016/j.fertnstert.2007.01.093.
  • 4.
    Wallach EE, Buttram VC, Reiter RC. Uterine leiomyomata: etiology, symptomatology, and management. Fertil Steril. 1981;36(4):433-45. https://doi.org/10.1016/s0015-0282(16)45789-4.
  • 5.
    Hodges LC, Bergerson JS, Hunter DS, Walker CL. Estrogenic effects of organochlorine pesticides on uterine leiomyoma cells in vitro. Toxicol Sci. 2000;54(2):355-64. [PubMed ID: 10774817].
  • 6.
    Parker WH, Fu YS, Berek JS. Uterine sarcoma in patients operated on for presumed leiomyoma and rapidly growing leiomyoma. Obstet Gynecol. 1994;83(3):414-8. [PubMed ID: 8127535].
  • 7.
    Speroff L, Fritz MA. Clinical gynecologic endocrinology and infertility. lippincott Williams & wilkins; 2005.
  • 8.
    Thompson JD, Rock JA. Leiomyomata uteri and myomectomy. In: Rock JA, Thompson JD, editors. Te Linde’s operative gynecology. 8 ed. Philadelphia: Lippincott-Raven; 1997. p. 731-70.
  • 9.
    Thomas M, Kalita A, Labrecque S, Pim D, Banks L, Matlashewski G. Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol. 1999;19(2):1092-100. [PubMed ID: 9891044]. [PubMed Central ID: PMC116039].
  • 10.
    Gibbs RS, Danforth DN. Danforth's obstetrics and gynecology. China: Lippincott Williams & Wilkins; 2008.
  • 11.
    Kos M, Reid G, Denger S, Gannon F. Minireview: genomic organization of the human ERalpha gene promoter region. Mol Endocrinol. 2001;15(12):2057-63. [PubMed ID: 11731608]. https://doi.org/10.1210/mend.15.12.0731.
  • 12.
    Zuppan PJ, Hall J, Ponglikitmongkol M, Spielman R, King M. Polymorphisms at the estroten receptor (ESR) locus and linkage relation-ships on chromosome 6q. Cytegenet. Cell Genet. 1989;51:1116.
  • 13.
    Salimi S, Mohammadpour-Gharehbagh A, Keshavarzi F, Farajian-Mashhadi F, Mousavi M, Sandoughi M. Association between ERalpha polymorphisms and systemic lupus erythematosus: susceptibility and in silico analysis. Int J Rheum Dis. 2018;21(1):214-22. [PubMed ID: 29356461]. https://doi.org/10.1111/1756-185X.13230.
  • 14.
    Kitawaki J, Obayashi H, Ishihara H, Koshiba H, Kusuki I, Kado N, et al. Oestrogen receptor-alpha gene polymorphism is associated with endometriosis, adenomyosis and leiomyomata. Hum Reprod. 2001;16(1):51-5. [PubMed ID: 11139535].
  • 15.
    Salimi S, Hajizadeh A, Khodamian M, Pejman A, Fazeli K, Yaghmaei M. Age-dependent association of MDM2 promoter polymorphisms and uterine leiomyoma in South-East Iran: A preliminary report. J Obstet Gynaecol Res. 2015;41(5):729-34. [PubMed ID: 25511444]. https://doi.org/10.1111/jog.12625.
  • 16.
    Yaghmaei M, Salimi S, Namazi L, Farajian-Mashhadi F. Association of XRCC1 Arg399GIn and Tp53 Arg72Pro polymorphisms and increased risk of uterine leiomyoma - A case-control study. Genet Mol Biol. 2015;38(4):444-9. [PubMed ID: 26692154]. [PubMed Central ID: PMC4763320]. https://doi.org/10.1590/S1415-475738420140359.
  • 17.
    Aslani S, Hossein-Nezhad A, Mirzaei K, Maghbooli Z, Afshar AN, Karimi F. VDR FokI polymorphism and its potential role in the pathogenesis of gestational diabetes mellitus and its complications. Gynecol Endocrinol. 2011;27(12):1055-60. [PubMed ID: 21663527]. https://doi.org/10.3109/09513590.2011.569786.
  • 18.
    Kumazaki K, Nakayama M, Suehara N, Wada Y. Expression of vascular endothelial growth factor, placental growth factor, and their receptors Flt-1 and KDR in human placenta under pathologic conditions. Hum Pathol. 2002;33(11):1069-77. [PubMed ID: 12454810]. https://doi.org/10.1053/hupa.2002.129420.
  • 19.
    Al-Hendy A, Salama S. Gene therapy and uterine leiomyoma: a review. Hum Reprod Update. 2006;12(4):385-400. [PubMed ID: 16603566]. https://doi.org/10.1093/humupd/dml015.
  • 20.
    Hsieh YY, Wang YK, Chang CC, Lin CS. Estrogen receptor alpha-351 XbaI*G and -397 PvuII*C-related genotypes and alleles are associated with higher susceptibilities of endometriosis and leiomyoma. Mol Hum Reprod. 2007;13(2):117-22. [PubMed ID: 17121748]. https://doi.org/10.1093/molehr/gal099.
  • 21.
    Orsted DD, Bojesen SE, Tybjaerg-Hansen A, Nordestgaard BG. Tumor suppressor p53 Arg72Pro polymorphism and longevity, cancer survival, and risk of cancer in the general population. J Exp Med. 2007;204(6):1295-301. [PubMed ID: 17535973]. [PubMed Central ID: PMC2118619]. https://doi.org/10.1084/jem.20062476.
  • 22.
    Salimi S, Farajian-Mashhadi F, Tabatabaei E, Shahrakipour M, Yaghmaei M, Mokhtari M. Estrogen receptor alpha XbaI GG genotype was associated with severe preeclampsia. Clin Exp Hypertens. 2017;39(3):220-4. [PubMed ID: 28448182]. https://doi.org/10.1080/10641963.2016.1235182.
  • 23.
    Massart F, Becherini L, Marini F, Noci I, Piciocchi L, Del Monte F, et al. Analysis of estrogen receptor (ERα and ERß) and progesterone receptor (PR) polymorphisms in uterine leiomyomas. Med Sci Monitor. 2003;9(1):BR25-30.
  • 24.
    Denschlag D, Bentz EK, Hefler L, Pietrowski D, Zeillinger R, Tempfer C, et al. Genotype distribution of estrogen receptor-alpha, catechol-O-methyltransferase, and cytochrome P450 17 gene polymorphisms in Caucasian women with uterine leiomyomas. Fertil Steril. 2006;85(2):462-7. [PubMed ID: 16595228]. https://doi.org/10.1016/j.fertnstert.2005.07.1308.
  • 25.
    Villanova FE, Andrade PM, Otsuka AY, Gomes MT, Leal ES, Castro RA, et al. Estrogen receptor alpha polymorphism and susceptibility to uterine leiomyoma. Steroids. 2006;71(11-12):960-5. [PubMed ID: 16935316]. https://doi.org/10.1016/j.steroids.2006.07.005.
  • 26.
    Al-Hendy A, Salama SA. Ethnic distribution of estrogen receptor-alpha polymorphism is associated with a higher prevalence of uterine leiomyomas in black Americans. Fertil Steril. 2006;86(3):686-93. [PubMed ID: 16860797]. https://doi.org/10.1016/j.fertnstert.2006.01.052.
  • 27.
    Govindan S, Shaik NA, Vedicherla B, Kodati V, Rao KP, Hasan Q. Estrogen receptor-alpha gene (T/C) Pvu II polymorphism in endometriosis and uterine fibroids. Dis Markers. 2009;26(4):149-54. [PubMed ID: 19729795]. [PubMed Central ID: PMC3833240]. https://doi.org/10.3233/DMA-2009-0625.
  • 28.
    Feng Y, Lin X, Zhou S, Xu N, Yi T, Zhao X. The associations between the polymorphisms of the ER-alpha gene and the risk of uterine leiomyoma (ULM). Tumour Biol. 2013;34(5):3077-82. [PubMed ID: 23749503]. https://doi.org/10.1007/s13277-013-0874-0.
  • 29.
    Taghizade Mortezaee F, Tabatabaiefar MA, Hashemzadeh Chaleshtori M, Miraj S. Lack of Association between ESR1 and CYP1A1 Gene Polymorphisms and Susceptibility to Uterine Leiomyoma in Female Patients of Iranian Descent. Cell J. 2014;16(2):225-30. [PubMed ID: 24567938]. [PubMed Central ID: PMC4072073].
  • 30.
    Veronica M, Ali A, Venkateshwari A, Mamata D, Nallari P. Association of estrogen and progesterone receptor gene polymorphisms and their respective hormones in uterine leiomyomas. Tumour Biol. 2016;37(6):8067-74. [PubMed ID: 26715264]. https://doi.org/10.1007/s13277-015-4711-5.
  • 31.
    Huang Y, Wright SI, Agrawal AF. Genome-wide patterns of genetic variation within and among alternative selective regimes. PLoS Genet. 2014;10(8). e1004527. [PubMed ID: 25101783]. [PubMed Central ID: PMC4125100]. https://doi.org/10.1371/journal.pgen.1004527.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles