Staphylococcus epidermidisSdrH, SdrG, and SdrF Expression in Commensal and Ocular Infection Isolates

Author(s):
Mario Eugenio Cancino-DiazMario Eugenio Cancino-Diaz1, Janet Jan-RobleroJanet Jan-RobleroJanet Jan-Roblero ORCID1, Fernando Gómez-ChávezFernando Gómez-Chávez1, Juan C. Cancino-DiazJuan C. Cancino-Diaz1,*
1ENCB, National Polytechnic Institute, 11340 Mexico City, Mexico

Health Scope:Vol. 14, issue 1; e148124
Published online:Jan 01, 2025
Article type:Research Article
Received:Apr 27, 2024
Accepted:Dec 19, 2024
How to Cite:Cancino-Diaz ME, Jan-Roblero J, Gómez-Chávez F, Cancino-Diaz JC. Staphylococcus epidermidisSdrH, SdrG, and SdrF Expression in Commensal and Ocular Infection Isolates. Health Scope. 2025;14(1):e148124. doi: https://doi.org/10.5812/healthscope-148124

Abstract

Background:

Staphylococcus epidermidis contaminates medical devices and produces biofilm, complicating antibiotic treatment for its elimination and causing a nosocomial health issue. The sdr genes (sdrG, sdrF, and sdrH) are involved in bacterial adhesion to the surface of medical devices for biofilm formation.

Objectives:

To compare the presence and expression of the sdr gene in S. epidermidis from infectious and commensal isolates to propose them as a therapeutic target.

Methods:

This is a descriptive, observational, and retrospective study. Infected ocular (n = 64), healthy conjunctiva (n = 46), and healthy skin (n = 53) isolates were genotyped using the Staphylococcal Chromosome mec (SCCmec) cassette to avoid clonality. Different genotypes representative of each isolation source selected isolates. In the selected isolates, sdr genes were determined by PCR, and RT-qPCR determined their expression.

Results:

The sdrG, sdrF, and sdrH genes were present in the genome of all selected isolates. The expression level of the sdr genes was low in all isolates and there was no significant difference between different isolation sources.

Conclusions:

The presence and expression of sdrG, sdrF, and sdrH genes are independent of the genotype and isolation source; this suggests that these proteins could be therapeutic targets to prevent the contamination of medical devices by S. epidermidis.

1. Background

Staphylococcus epidermidis is a skin commensal ubiquitous in healthy humans with two lifestyles, one harmless and the other as an opportunistic pathogen. In recent years, S. epidermidis has become relevant to healthcare because it has been identified in clinical specimens as the sole causative agent of certain infections. S. epidermidis can cause bacteremia (1), sepsis (2), endocarditis, meningitis, and toxic shock syndrome (3), as well as superficial skin infections, ocular infections (4), and infections associated with indwelling medical devices such as shunts (5), catheters (6), and prosthetic joints (7). The majority of these infections result from the use of contaminated medical devices and, therefore, usually occur in hospitals, with high costs to the public health system. The ubiquity and persistence of S. epidermidis on human skin is a high-risk factor for the contamination of medical devices, which can come from hospital staff or patients and pose a serious health problem. For example, one study reported that of 24,179 cases of nosocomial bloodstream infections caused by contaminated devices in 49 hospitals in the USA, coagulase-negative staphylococci (including S. epidermidis) were responsible for 31% of the cases (8). The cost of hospital-acquired infections is a serious problem for the public health system; the cost associated with vascular catheter-associated bloodstream infections caused by S. epidermidis is estimated to be 2 billion annually in the USA (9). The scenario is complicated by the ever-expanding use of medical devices in recent years and the excessive use of antibiotics. The ability of this bacterium to form biofilms has led S. epidermidis to become an essential nosocomial pathogen; therefore, the search for new therapeutic targets to prevent infections caused by this bacterium is of great medical interest.
A biofilm is an organized microbial ecosystem consisting of one or more microorganisms attached to a living or inert surface and enveloped in a self-produced extracellular matrix. Biofilm development occurs in three steps: Adherence, cellular aggregation, and degradation. In the adherence step, planktonic bacteria adhere to a biotic or abiotic surface; the adhered bacteria subsequently grow and secrete various compounds including polysaccharides, proteins, and extracellular DNA (eDNA). Biofilm maturation is achieved as these compounds form an extracellular matrix. Finally, the components of the biofilm matrix age, degrade and disassemble (10). Staphylococcus epidermidis can produce biofilm, which acts as a biological barrier to prevent the penetration of immune cells and antibodies. It contributes to its invasion, persistence, multidrug resistance, and host immune system evasion (11).
Staphylococcus epidermidis expresses proteins on its cell surface with biotic or abiotic adhesion characteristics during the biofilm adhesion step. One such protein is the serine-aspartate repeat (sdr) protein, which recognizes components of the host tissue extracellular matrix and binds to them to initiate biofilm formation (12). S. epidermidis expresses three sdr proteins (sdrG, sdrF, and sdrH), each with a specific affinity for extracellular matrix proteins of host tissues: sdrG binds specifically to fibrinogen and sdrF to collagen. However, the ligand for SdrH is currently unknown. Staphylococcus epidermidissdr expression is a crucial factor in biofilm formation, an initial step in the contamination of medical devices or the infection process (13). In patients infected with S. epidermidis, sdrG is necessary to promote fibrinogen adherence. Moreover, sdrG expression increases, and as a patient response, antibodies against sdrG are present in the serum of infected individuals (12, 14). Similarly, sdrF is essential for establishing intracardiac valve infections, and infected patients produce antibodies against this protein (15). The production of high antibody levels against sdrG and sdrF in patients infected with S. epidermidis indicates the involvement of these proteins in the infection process. Therefore, sdr proteins can be considered potential therapeutic targets for controlling infections by this bacterium. Thus, blocking sdr proteins would help prevent S. epidermidis adhesion to the surface of medical devices or the host tissue extracellular matrix, reducing biofilm formation and preventing infections caused by this bacterium.

2. Objectives

Bacteria residing on the skin, such as S. epidermidis, may be potential causes of medical device contamination leading to infection. S. epidermidisSdr proteins play an essential role in biotic and abiotic adhesion. However, it is currently unknown whether Sdr proteins are ubiquitous and differentially expressed in commensal and clinical isolates.
This study aimed to investigate the presence and expression of sdr genes in clinical isolates (from ocular infections) and commensal isolates (from healthy conjunctiva and skin) to propose them as therapeutic targets for preventing S. epidermidis infections.

3. Methods

3.1. Strains

We conducted a descriptive, observational, and retrospective study. A collection of S. epidermidis isolates was obtained in 2014, as previously reported (4), and this bacterial collection was donated for the present study. The bacterial collection comprises a total of 163 strains, distributed as follows: Isolates from ocular infections (n = 64), healthy conjunctiva (n = 46), and healthy skin (n = 53). Multilocus sequence typing (MLST) of ocular infection and healthy conjunctiva isolates was performed by Flores-Paez et al. (4); MLST of healthy skin isolates was performed separately with the same procedure as described (4).
The protocol for this bacterial study was approved by the Ethics Committee of the "Secretaría de Investigación y Posgrado (SIP)" of Instituto Politécnico Nacional (IPN), Mexico, under grant SIP-20240492.
Since the study used a collection of S. epidermidis isolates previously reported (4), patient-informed consent was not required for protocol approval. There was no direct interaction with patients, and the study did not impact their treatment.

3.2. DNA Extraction

Strains were cultured in trypticase soy broth (TSB, Sigma-Aldrich, Mexico) and incubated for 24 h at 37°C. They were then centrifuged at 21,633 × g for 1 minute. Cells were resuspended in 200 µL of saline solution, and glass beads (≤ 100 µm, Sigma-Aldrich) were added. Tubes were shaken in a cell disruptor (Genie, USA) for 5 min. Two hundreds µL of Winston’s solution (2% triton × -100, 1% SDS, 100 mM NaCl, 10 mM Tris-base, pH 8, 1 mM EDTA) and 400 µL of phenol-chloroform-isoamyl alcohol solution (25:24:1) were then added. The mixture was centrifuged at 13,845 × g for 15 min. The aqueous phase was separated, and the DNA was precipitated with isopropanol at double the original volume for 10 min. The mixture was centrifuged at 13,845 × g for 15 min, washed twice with 70% ethanol, and resuspended in sterile distilled water (16).

3.3. Genotyping

The determination of the Staphylococcal Chromosome mec (SCCmec) cassette consisted of multiplex PCR (17) with primers for the mecA gene and SCCmec types I, II, III, and V. Subsequently, another PCR with primers for type IV was performed. Genotyping by MLST was performed as described in (4).

3.4. PCR for sdr Genes

A reaction mixture of 25 µL was prepared containing 5 µL of 5x PCR buffer (Bioline; TN, USA), 0.5 µL of forward primer (10 µM), 0.5 µL of reverse primer (10 µM) (Table 1), 0.2 µL of Taq DNA polymerase (5U/µL) (Bioline), and 1 µL of genomic DNA. The conditions were 94°C for 2 min, followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec, with a final extension at 72°C for 5 min (16).
Table 1.Primers for sdr Genes
GenesPrimers Sequence
sdrGF: ACACGACGATACAGCAAACTG
R: CACCTTGTCCTTGACCTGAAC
sdrFF: CACAGTTGAGTTTGAGACACC
R: ATTGTGAGATTATCAGCTCCG
sdrHF: AGTGGAGATGGTGCGCCTTT
R: AGCACCCGTGGCTAATTGTC

Abbreviations: F, forward; R, reverse.

3.5. Total RNA Extraction

Cells were harvested from 3 mL of bacterial culture grown in TSB medium at 37°C for 24 h by centrifugation at 15,000 × g for 3 min. Subsequently, 200 µL of TE buffer and glass beads (≤ 100 µm) were added, and cell lysis was performed using a cell disruptor (Genie) at 865 × g for 7 min. Afterward, 1 mL of Trisure (Bioline) and 200 µL of chloroform were added. The mixture was incubated at room temperature for 10 min, centrifuged at 15,000 × g for 10 min, and the aqueous phase was collected. The volume obtained was doubled with isopropanol and incubated at -20°C for 12 h. The mixture was then centrifuged at 15,000 × g for 15 min, washed twice with 70% ethanol, and finally, the RNA was resuspended in 20 µL of sterile distilled water. In addition to extraction, total RNA was treated with DNase I (Bioline), using 2 µL of DNase I buffer (10×) and 1 µL of DNase I (10,000 units), and incubated at 37°C for 45 min. The enzyme was then inactivated at 75°C for 10 min (18).

3.6. cDNA Synthesis

For each sample, 3 µg of total RNA and 1 µL of Random Hexamer (Bioline) were used and adjusted to 10 µL with sterile distilled water. It was heated at 75°C for 10 min and immediately placed on ice. Subsequently, 4 µL of buffer (5×), 2 µL of DTT (0.1M Dithiothreitol; Bioline), 1 µL of dNTPs (10 mM, Bioline), and 2 µL of water were added and incubated for 2 min at room temperature. Then, 1 µL of M-MLV reverse transcriptase was added, and the mixture was incubated at room temperature for 8 min, incubated at 37°C for 1 hour, and finally at 65°C for 10 min (19).

3.7. Real-time PCR

The PCR mixture was prepared using the following reagents: Two µL of cDNA, 10 µL of master mix (SYBR green one master; Thermo Scientific, USA), 0.2 µL of each primer (Table 1), and 8.6 µL of water for each tube. PCR conditions were 94°C for 5 minutes, followed by 40 cycles of 94°C for 30 sec and 60°C for 40 sec. Relative expression was calculated using the 2-ΔΔCt method, using the 16S rRNA gene as the reference (19).

3.8. Statistical Analysis

For analysis of genotyping by SCCmec types, the chi-squared test was used. For the presence of the sdr genes, a contingency table of presence and absence was formulated, and Fisher's exact test was used to compare the proportions. Relative expression of the sdr genes was compared using two-way ANOVA with Tukey’s test for between-group comparison. A value of P < 0.05 was considered significant for all tests.

4. Results

4.1. Staphylococcal Chromosome mec Genotyping and Multilocus Sequence Typing

The SCCmec types for each isolate were analyzed, and it was found that healthy skin and conjunctiva isolates predominantly exhibited type II SCCmec, with frequencies of 37.7% and 30.4%, respectively; the mecA gene was expressed in these samples with frequencies of 67.9% and 69.5%, respectively. In ocular infection isolates, type II SCCmec was the most prevalent (25%), followed by type I with a frequency of 23.3%. The frequency of the mecA gene in ocular infection isolates was 75% (Table 2). Type V SCCmec was not detected in any of the isolates studied. There was no significant difference between types of SCCmec for each isolate group (P > 0.05, chi-squared test), except for healthy skin isolates for types II and IV (P < 0.05, chi-squared test; Table 2).
Table 2.Genotype Percentage of Staphylococcal Chromosome mec Type
VariablesSCCmec Type
Isolation sourceIIIIIIIVmecA Gen
Ocular infection (n = 64) a15 (23.3)16 (25)8 (12.5)14 (21.8)48 (75)
Healthy conjunctiva (n = 46) b8 (17.3)14 (30.4)9 (19.5)12 (26)32 (69.5)
Healthy skin (n = 53) c10 (18.8)20 (37.7) d11 (20.7)9 (16.9) d36 (67.9)

Abbreviation: SCCmec, Staphylococcal chromosome cassette mec.

a In 11 isolates were not found the SSCmec type.

b In 3 isolates were not found the SSCmec type.

c In 3 isolates were not found the SSCmec type.

d Significant difference (P < 0.05) with the chi-squared test.

The SCCmec type frequencies of each isolate were compared with MLST as previously reported by Flores-Paez et al., (4) and with those obtained in this work for healthy skin isolates. As shown in Tables 3 - 5, the isolates from each source were selected based on their ST and all four SCCmec types, with the aim of genotypically diverse isolates (non-clonal). These selected isolates were used for the additional determinations.
Table 3.The Relative Expression of sdr Genes from Ocular Infection a
Ocular Infection and StrainsSTSCCmecmRNA Relative Expression
sdrGsdrFsdrH
352I0.9 ± 0.070.7 ± 0.090.7 ± 0.06
1682II0.7 ± 0.020.8 ± 0.050.7 ± 0.04
2132III0.8 ± 0.030.7 ± 0.080.8 ± 0.07
532IV0.7 ± 0.040.6 ± 0.080.6 ± 0.06
509II0.7 ± 0.040.8 ± 0.080.8 ± 0.07
20509III0.9 ± 0.010.8 ± 0.060.8 ± 0.03
589IV0.7 ± 0.020.8 ± 0.050.7 ± 0.07
9610I0.8 ± 0.050.6 ± 0.080.5 ± 0.07
170023I0.7 ± 0.050.8 ± 0.060.7 ± 0.05
5423II0.8 ± 0.030.9 ± 0.070.6 ± 0.08
19923IV0.9 ± 0.010.8 ± 0.080.7 ± 0.06
9838I0.9 ± 0.040.8 ± 0.090.9 ± 0.02
194846IV0.9 ± 0.040.7 ± 0.090.8 ± 0.04
165471III0.8 ± 0.050.7 ± 0.030.6 ± 0.05
9087I0.8 ± 0.070.8 ± 0.030.7 ± 0.06

Abbreviations: ST, sequence type; SCCmec, Staphylococcal chromosome cassette mec.

a No significant difference P > 0.05 with two-way ANOVA test was found.

Table 4.The Relative Expression of sdr Genes From Healthy Conjunctiva a
Healthy Conjunctiva and StrainsSTSCCmecmRNA Relative Expression
sdrGSdrFSdrH
1392IV0.7 ± 0.080.8 ± 0.010.8 ± 0.01
1144I0.7 ± 0.040.8 ± 0.030.7 ± 0.04
924II0.7 ± 0.030.8 ± 0.050.7 ± 0.09
105I0.6 ± 0.080.7 ± 0.040.6 ± 0.04
1065II0.6 ± 0.080.6 ± 0.060.6 ± 0.05
145III0.7 ± 0.030.7 ± 0.010.7 ± 0.07
85IV0.8 ± 0.040.7 ± 0.030.8 ± 0.09
489II0.7 ± 0.060.8 ± 0.060.7 ± 0.03
309III0.8 ± 0.030.7 ± 0.040.7 ± 0.05
13710I0.7 ± 0.060.8 ± 0.060.7 ± 0.07
910II0.8 ± 0.040.7 ± 0.050.7 ± 0.03
9710III0.7 ± 0.030.8 ± 0.030.8 ± 0.04
2210IV0.8 ± 0.040.7 ± 0.020.7 ± 0.06
3523II0.8 ± 0.060.7 ± 0.070.6 ± 0.05
1326II0.8 ± 0.060.7 ± 0.060.8 ± 0.06
3143IV0.7 ± 0.020.6 ± 0.090.8 ± 0.01
10348III0.6 ± 0.080.7 ± 0.070.6 ± 0.06
128118I0.7 ± 0.030.8 ± 0.050.8 ± 0.04
114118II0.6 ± 0.030.6 ± 0.050.7 ± 0.01
126118IV0.8 ± 0.020.08 ± 0.010.7 ± 0.06
17135IV0.9 ± 0.060.8 ± 0.090.7 ± 0.05
131173II0.8 ± 0.010.7 ± 0.080.7 ± 0.09
94238III0.8 ± 0.060.9 ± 0.030.8 ± 0.05
29494II0.5 ± 0.070.7 ± 0.030.6 ± 0.09

Abbreviations: ST, sequence type; SCCmec, Staphylococcal chromosome cassette mec.

a No significant difference P > 0.05 with two-way ANOVA test was found.

Table 5.The Relative Expression of sdr Genes From Healthy Skin a
Healthy skin and StrainsSTSCCmecmRNA Relative Expression
sdrGsdrFsdrH
172I0.8 ± 0.080.8 ± 0.030.7 ± 0.03
222II0.9 ± 0.030.8 ± 0.080.9 ± 0.01
32III0.8 ± 0.020.9 ± 0.020.8 ± 0.07
602IV0.6 ± 0.010.7 ± 0.040.6 ± 0.03
529I0.7 ± 0.030.7 ± 0.080.7 ± 0.02
5723I0.7 ± 0.050.7 ± 0.040.8 ± 0.02
5823II0.7 ± 0.070.8 ± 0.010.7 ± 0.08
37189I0.8 ± 0.030.8 ± 0.040.7 ± 0.02
7189III0.7 ± 0.040.6 ± 0.090.8 ± 0.06
47370II0.7 ± 0.030.7 ± 0.080.7 ± 0.07
51370II0.7 ± 0.030.8 ± 0.020.7 ± 0.09
9481II0.9 ± 0.010.8 ± 0.030.8 ± 0.06

Abbreviations: ST, sequence type; SCCmec, Staphylococcal chromosome cassette mec.

a No significant difference P > 0.05 with two-way ANOVA test was found.

4.2. Genomic Detection of sdr Genes

Strains corresponding to healthy skin showed the presence of sdrG, sdrF, and sdrH genes with frequencies of 100%, 84.6%, and 100%, respectively. In strains corresponding to healthy conjunctiva, the gene frequencies were 92.8% for sdrG, 92.8% for sdrF, and 92.8% for sdrH. Finally, sdrG, sdrF, and sdrH genes were found for ocular infection strains with frequencies of 100%, 88.8%, and 100%, respectively. No significant difference was observed in the presence of sdr genes based on the isolation source (P > 0.05, Fisher's exact test).

4.3. Relative mRNA Expression of sdr Genes

The relative expression of sdrG, sdrF, and sdrH genes from the ocular infection strain group showed similar values ranging from 0.7 to 0.8 (Table 3), with no significant difference observed among the strains (P > 0.05; two-way ANOVA test). The same pattern was observed for the healthy conjunctiva and skin strain groups, with relative mRNA expression values ranging from 0.6 to 0.8 and no significant difference found among the strains (P > 0.05; two-way ANOVA test; Tables 4 and 5). Relative values obtained were less than 1, indicating that expression was lower than that of the reference gene 16S rRNA, suggesting weak expression of the sdr genes.

5. Discussion

The level of expression of Sdr proteins in clinical and commensal isolates is previously unestablished. In this study, we compared the presence and expression of mRNA from sdr genes between isolates from ocular infections and healthy samples of conjunctiva and skin.
The presence of sdr genes was high in both ocular infection and commensal strains, with no difference between the isolation sources, suggesting that sdr genes are essential for the adhesion of S. epidermidis regardless of virulence capacity. This indicates that in medical devices contaminated with S. epidermidis and used in hospital patients, the bacterium has the potential to adhere to the extracellular matrix of the host tissue. In surgeries for medical implants, S. epidermidis isolates from orthopedic and catheter-associated infections have been found to have the sdrG gene present in 78% to 91% of cases (20). These results are very similar to those obtained in our study. Arrecubieta et al. indicate that sdr genes are present in most species of the Staphylococcus genus (15); with our data, this suggests that these genes are a fundamental component of the S. epidermidis genome and the potential for tissue attachment. Additionally, they could be considered therapeutic targets to reduce this bacterium's contamination of medical devices.
We did not find significant differences in sdr gene expression among the three isolation sources. This indicates that any individual (hospital staff or patient) may carry S. epidermidis on their skin with the potential to express Sdrs at a low level. This could result in contamination of medical devices and subsequent infection. Therefore, the expression of the sdr gene, regardless of the source of isolation, suggests a potential risk in the initial adhesion of S. epidermidis to host tissue and the establishment of infection. As a result, using strategies to block or inhibit the Sdr proteins could help prevent infection.
Several strategies to block Sdr proteins have been documented for controlling S. epidermidis infections. One of these is using antibodies against SdrG, which has been shown to prevent S. epidermidis adherence to catheters (21). Another related approach is immunization with a subdomain of SdrG to induce antibody production; this has been shown to prevent S. epidermidis infection in a mouse model (14). Regarding medical devices, an effective strategy for combating infection is using biomaterials coated with antimicrobial compounds specific to S. epidermidis. One approach is to coat catheters with osteopontin under shear flow, which prevents early bacterial adhesion and subsequent biofilm formation (22). Another is to use polymer blends of polyvinyl chloride (PVC) and polystyrene-ethylene-butylene-styrene (SEBS) in catheter tips (23). Another option is using silver nanoparticles in chitosan nanogel (24), which inhibits S. epidermidis infection.
Another option is to change the type of material used in medical devices. Materials with highly hydrophobic surfaces, such as dacron or polystyrene, increase sdrF gene expression, resulting in a notable enhancement in bacterial adhesion (15). Consequently, contaminated medical devices made with these materials may promote bacterial adhesion and contribute to infection. These measures to reduce S. epidermidis infections in hospitals are currently being developed. It is anticipated that these strategies will help resolve the issues associated with S. epidermidis infection in the near future.
Although this work focused on ocular infection isolates, the results suggest that it may also occur in other S. epidermidis infections related to the use of medical devices such as shunts (5), catheters (6), and prosthetic joints (7). In these cases, the presence and expression of sdrs genes will also be involved in the initial adhesion process for subsequent biofilm formation.

5.1. Conclusions

The relative mRNA expression of the sdrG, sdrF, and sdrH genes in ocular infection and commensal isolates of S. epidermidis is homogeneous and weak in each case. This suggests that, in human health, the skin of healthy individuals carries S. epidermidis with the potential to infect the eye, as it presents and expresses Sdr proteins (which are involved in adhesion to host tissue). Moreover, healthy individuals are also a source of S. epidermidis contamination for medical devices. Introducing these devices into the patient can cause infections due to the bacteria's adhesion via Sdr proteins and its difficult removal due to biofilm formation. Therefore, from a public health perspective, it is important to avoid hand-eye contact, especially in immunocompromised individuals. Additionally, medical staff should be educated about the risks of contact between medical devices and their skin.
On the other hand, Sdr proteins could be therapeutic targets to prevent the contamination of medical devices by S. epidermidis through the use of catheters coated with anti-adhesion molecules. Immunization with Sdr antigens may also be an alternative prevention strategy for diseases caused by S. epidermidis.

Acknowledgments

Footnotes

References

  • 1.
    Nakamizo S, Egawa G, Honda T, Nakajima S, Belkaid Y, Kabashima K. Commensal bacteria and cutaneous immunity. Semin Immunopathol J. 2015;37(1):73-80. [PubMed ID: 25326105]. https://doi.org/10.1007/s00281-014-0452-6.
  • 2.
    Nguyen T, Park MD, Otto M. Host Response to Staphylococcus epidermidis Colonization and Infections. Front Cell Infect Microbiol. 2017;7. https://doi.org/10.3389/fcimb.2017.00090.
  • 3.
    Pomputius WF, Kilgore SH, Schlievert PM. Probable enterotoxin-associated toxic shock syndrome caused by Staphylococcus epidermidis. BMC Pediatr. 2023;23(1):108. [PubMed ID: 36882717]. [PubMed Central ID: PMC9989563]. https://doi.org/10.1186/s12887-023-03914-5.
  • 4.
    Flores-Paez LA, Zenteno JC, Alcantar-Curiel MD, Vargas-Mendoza CF, Rodriguez-Martinez S, Cancino-Diaz ME, et al. Molecular and Phenotypic Characterization of Staphylococcus epidermidis Isolates from Healthy Conjunctiva and a Comparative Analysis with Isolates from Ocular Infection. PLoS One. 2015;10(8). e0135964. [PubMed ID: 26275056]. [PubMed Central ID: PMC4537226]. https://doi.org/10.1371/journal.pone.0135964.
  • 5.
    Amelot A, Bouazza S, George B, Bresson D. Causative role of infection in chronic non-thromboembolic pulmonary hypertension following ventriculo-atrial shunt. Br J Neurosurg. 2014;28(4):559-61. [PubMed ID: 24175581]. https://doi.org/10.3109/02688697.2013.854311.
  • 6.
    Pouget C, Chatre C, Lavigne JP, Pantel A, Reynes J, Dunyach-Remy C. Effect of Antibiotic Exposure on Staphylococcus epidermidis Responsible for Catheter-Related Bacteremia. Int J Mol Sci. 2023;24(2). [PubMed ID: 36675063]. [PubMed Central ID: PMC9863639]. https://doi.org/10.3390/ijms24021547.
  • 7.
    Clemente A, Cavagnaro L, Russo A, Chiarlone F, Masse A, Burastero G. Spacer exchange in persistent periprosthetic joint infection: microbiological evaluation and survivorship analysis. Arch Orthop Trauma Surg. 2023;143(3):1361-70. [PubMed ID: 35028707]. https://doi.org/10.1007/s00402-021-04300-5.
  • 8.
    Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis. 2004;39(3):309-17. [PubMed ID: 15306996]. https://doi.org/10.1086/421946.
  • 9.
    Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Sci J. 1999;284(5418):1318-22. [PubMed ID: 10334980]. https://doi.org/10.1126/science.284.5418.1318.
  • 10.
    Severn MM, Horswill AR. Staphylococcus epidermidis and its dual lifestyle in skin health and infection. Nat Rev Microbiol. 2023;21(2):97-111. [PubMed ID: 36042296]. [PubMed Central ID: PMC9903335]. https://doi.org/10.1038/s41579-022-00780-3.
  • 11.
    Sharifinejad M, Shokatpour N, Farnaghi F, Abedinyfar Z, Amoli FA, Doustdar F. Different Genotypes of Adhesion Operon Genes in Staphylococcus epidermidis Isolates From Various Ocular Infections. Eye Contact Lens. 2018;44 Suppl 2:S277-80. [PubMed ID: 29280751]. https://doi.org/10.1097/ICL.0000000000000464.
  • 12.
    Bowden MG, Chen W, Singvall J, Xu Y, Peacock SJ, Valtulina V, et al. Identification and preliminary characterization of cell-wall-anchored proteins of Staphylococcus epidermidis. Microbiol J (Reading). 2005;151(Pt 5):1453-64. [PubMed ID: 15870455]. https://doi.org/10.1099/mic.0.27534-0.
  • 13.
    Mack D, Rohde H, Harris LG, Davies AP, Horstkotte MA, Knobloch JK. Biofilm formation in medical device-related infection. Int J Artif Organs. 2006;29(4):343-59. [PubMed ID: 16705603]. https://doi.org/10.1177/039139880602900404.
  • 14.
    Sellman BR, Timofeyeva Y, Nanra J, Scott A, Fulginiti JP, Matsuka YV, et al. Expression of Staphylococcus epidermidis SdrG increases following exposure to an in vivo environment. Infect Immun J. 2008;76(7):2950-7. [PubMed ID: 18426874]. [PubMed Central ID: PMC2446701]. https://doi.org/10.1128/IAI.00055-08.
  • 15.
    Arrecubieta C, Toba FA, von Bayern M, Akashi H, Deng MC, Naka Y, et al. SdrF, a Staphylococcus epidermidis surface protein, contributes to the initiation of ventricular assist device driveline-related infections. PLoS Pathog J. 2009;5(5). e1000411. [PubMed ID: 19412528]. [PubMed Central ID: PMC2670519]. https://doi.org/10.1371/journal.ppat.1000411.
  • 16.
    Ortega-Pena S, Vargas-Mendoza CF, Franco-Cendejas R, Aquino-Andrade A, Vazquez-Rosas GJ, Betanzos-Cabrera G, et al. sesA, sesB, sesC, sesD, sesE, sesG, sesH, and embp genes are genetic markers that differentiate commensal isolates of Staphylococcus epidermidis from isolates that cause prosthetic joint infection. Infect Dis J(Lond). 2019;51(6):435-45. [PubMed ID: 31010363]. https://doi.org/10.1080/23744235.2019.1597276.
  • 17.
    Velazquez-Guadarrama N, Martinez-Aguilar G, Galindo JA, Zuniga G, Arbo-Sosa A. Methicillin-resistant S. aureus colonization in Mexican children attending day care centres. Clin Invest Med. 2009;32(1):E57-63. [PubMed ID: 19178880]. https://doi.org/10.25011/cim.v32i1.5088.
  • 18.
    Garcia-Gomez E, Miranda-Ozuna JFT, Diaz-Cedillo F, Vazquez-Sanchez EA, Rodriguez-Martinez S, Jan-Roblero J, et al. Staphylococcus epidermidis lipoteichoic acid: Exocellular release and ltaS gene expression in clinical and commensal isolates. J Med Microbiol. 2017;66(7):864-73. [PubMed ID: 28639932]. https://doi.org/10.1099/jmm.0.000502.
  • 19.
    Sierra-Mondragon E, Gomez-Chavez F, Murrieta-Coxca M, Vazquez-Sanchez EA, Martinez-Torres I, Cancino-Diaz ME, et al. Low expression of IL-6 and TNF-alpha correlates with the presence of the nuclear regulators of NF-kappaB, IkappaBNS and BCL-3, in the uterus of mice. Mol Immunol J. 2015;68(2 Pt A):333-40. [PubMed ID: 26442662]. https://doi.org/10.1016/j.molimm.2015.09.020.
  • 20.
    Arciola CR, Campoccia D, Gamberini S, Donati ME, Montanaro L. Presence of fibrinogen-binding adhesin gene in Staphylococcus epidermidis isolates from central venous catheters-associated and orthopaedic implant-associated infections. Biomaterial J. 2004;25(19):4825-9. [PubMed ID: 15120529]. https://doi.org/10.1016/j.biomaterials.2003.11.056.
  • 21.
    Rennermalm A, Nilsson M, Flock JI. The fibrinogen binding protein of Staphylococcus epidermidis is a target for opsonic antibodies. Infect Immun J. 2004;72(5):3081-3. [PubMed ID: 15102827]. [PubMed Central ID: PMC387914]. https://doi.org/10.1128/IAI.72.5.3081-3083.2004.
  • 22.
    Kristensen MF, Zeng G, Neu TR, Meyer RL, Baelum V, Schlafer S. Osteopontin adsorption to Gram-positive cells reduces adhesion forces and attachment to surfaces under flow. J Oral Microbiol. 2017;9(1):1379826. [PubMed ID: 29081915]. [PubMed Central ID: PMC5646589]. https://doi.org/10.1080/20002297.2017.1379826.
  • 23.
    Zampino DC, Samperi F, Mancuso M, Ferreri T, Ferreri L, Dattilo S, et al. Polymer Blends Based on 1-Hexadecyl-3-methyl Imidazolium 1,3-Dimethyl 5-Sulfoisophthalate Ionic Liquid: Thermo-Mechanical, Surface Morphology and Antibacterial Properties. Polymer J (Basel). 2023;15(4). [PubMed ID: 36850254]. [PubMed Central ID: PMC9965557]. https://doi.org/10.3390/polym15040970.
  • 24.
    Lopez-Carrizales M, Mendoza-Mendoza E, Peralta-Rodriguez RD, Perez-Diaz MA, Portales-Perez D, Magana-Aquino M, et al. Characterization, antibiofilm and biocompatibility properties of chitosan hydrogels loaded with silver nanoparticles and ampicillin: an alternative protection to central venous catheters. Colloids Surf B Biointerfaces. 2020;196:111292. [PubMed ID: 32777661]. https://doi.org/10.1016/j.colsurfb.2020.111292.

Similar Articles

1
Jul
2019
fig

Biofilm Formation in Staphylococcus epidermidis Isolated from Hospitalized Patients

Hamzeh Hasanvand,
Fathollah Teymouri,
Elnaz Ohadi,
Azadeh Azadegan,
Behrooz Sadeghi Kalani

Hasanvand H, Teymouri F, Ohadi E, Azadegan A, Sadeghi Kalani B. Biofilm Formation in Staphylococcus epidermidis Isolated from Hospitalized Patients. Arch Clin Infect Dis. 2019;14(3):e64496. doi: https://doi.org/10.5812/archcid.64496

13
Feb
2016

Prevalence of Virulence-Related Determinants in Clinical Isolates of Staphylococcus epidermidis

Shahin Najar Peerayeh,
Ali Jazayeri Moghadas,
Mehrdad Behmanesh

Najar Peerayeh S, Jazayeri Moghadas A, Behmanesh M. Prevalence of Virulence-Related Determinants in Clinical Isolates of Staphylococcus epidermidis. Jundishapur J Microbiol. 2016;9(8):e30593. doi: https://doi.org/10.5812/jjm.30593

8
Jan
2017

Molecular Characterization of Staphylococcus epidermidis Isolates Recovered from Patients Admitted to a Referral Hospital in Iran

Amirmorteza Ebrahimzadeh Namvar,
Seyed Asghar Havaei,
Masoumeh Douraghi

Ebrahimzadeh Namvar A, Havaei SA, Douraghi M. Molecular Characterization of Staphylococcus epidermidis Isolates Recovered from Patients Admitted to a Referral Hospital in Iran. Arch Clin Infect Dis. 2017;12(2):e38675. doi: https://doi.org/10.5812/archcid.38675

6
Dec
2016

Overview of Genetic Background Beyond Polysaccharide Intercellular Adhesion Production in Staphylococcus epidermidis

Mohamed Amine Mekni,
Wafa Achour,
Assia Ben Hassen

Mekni MA, Achour W, Ben Hassen A. Overview of Genetic Background Beyond Polysaccharide Intercellular Adhesion Production in Staphylococcus epidermidis. Jundishapur J Microbiol. 2017;10(1):e36008. doi: https://doi.org/10.5812/jjm.36008

3
Oct
2016

Molecular Characterization of Staphylococcus epidermidis Isolates Collected From an Intensive Care Unit

Amirmorteza Ebrahimzadeh Namvar,
Seyed Asghar Havaei,
Leila Azimi,
Abdolaziz Rastegar Lari,
Ramazan Rajabnia

Ebrahimzadeh Namvar A, Havaei SA, Azimi L, Rastegar Lari A, Rajabnia R. Molecular Characterization of Staphylococcus epidermidis Isolates Collected From an Intensive Care Unit. Arch Pediatr Infect Dis. 2017;5(2):e36176. doi: https://doi.org/10.5812/pedinfect.36176


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles