Association Between A561C Polymorphism of E-Selectin Gene and Coronary Arterial Disease in Southeastern Iranian Population

Author(s):
Alireza NakhaeeAlireza NakhaeeAlireza Nakhaee ORCID1,*, Masoumeh AfzaliMasoumeh Afzali1, Seyed Peyman TabatabaeiSeyed Peyman Tabatabaei2, Kouroush Tirgar FakheriKouroush Tirgar Fakheri3, Mohammad HashemiMohammad Hashemi1
1Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran
2Department of Cardiology, School of Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran
3Department of Anesthesia, School of Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran

Health Scope:Vol. 2, issue 1; 47-51
Published online:May 11, 2013
Article type:Research Article
Received:Nov 28, 2012
Accepted:Mar 09, 2013
How to Cite:Nakhaee A, Afzali M, Tabatabaei SP, Tirgar Fakheri K, Hashemi M. Association Between A561C Polymorphism of E-Selectin Gene and Coronary Arterial Disease in Southeastern Iranian Population. Health Scope. 2013;2(1):47-51. doi: https://doi.org/10.17795/jhealthscope-9343

Abstract

Background:

Numerous factors including genetic factors play a role in pathogenesis of coronary atherosclerosis. It has been reported that polymorphisms of genes encoding adhesion molecules are associated with atherosclerosis.

Objectives:

The present research aimed to evaluate A561C polymorphism of the E-selectin gene in patients with coronary arterial diseases (CAD).

Materials and Methods:

Eighty seven CAD patients and 93 age- and sex-matched control subjects were enrolled in this research. The polymorphism of A561C in the E-selectin gene was defined by polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP).

Results:

The prevalence’s of AA, AC and CC genotypes were 55.2%, 24.1% and 20.7% in CAD patients and 51.6%, 40.9% and 7.5% in the control subjects, respectively. The frequencies of the C allele were significantly higher in CAD patients compared with control groups (P < 0.05). Logistic regression analysis revealed a significant association between the C allele and the risk of CAD (OR = 1.61, 95%CI = 1.03-2.51).

Conclusions:

Our results displayed that presence of C allele at position 561 E-selection gene is associated with increased risk of atherosclerosis disease in the southeastern Iranian population. This polymorphism may be able to affect leukocyte-endothelial interactions, which may account for the pathogenesis of atherosclerosis.

1. Background

Coronary artery disease (CAD), also entitled coronary heart disease is a multi-factorial disease that results from the interaction between genetic and environmental risk factors such as smoking, physical inactivity, obesity, high stress, hypertension, elevated level of LDL cholesterol and diabetes mellitus (1). Atherosclerosis is the major cause of CAD, in which atherosclerotic changes are present within the walls of the coronary arteries (2). Atherosclerosis seems to be a chronic inflammatory process that is converted to an acute clinical event by the induction of plaque rupture, which in turn leads to thrombosis (3, 4). The recruitment of leukocyte into the arterial wall intima is a principal stage in the formation of atherosclerotic plaques (5, 6). The process of leukocyte recruitment is a multistep cascade that involves leukocyte adhering followed by rolling, firm adhesion, and emigration from the circulatory system to the intima (7).
The numerous adhesion molecules including members of the selectins family (P, E, and L) play a role in early stages of leukocyte recruitment during the development of atherosclerosis (8, 9). P and E-selectin are expressed in cytokine-activated endothelium and directly attach leukocytes to endothelium (10). By contrast, L-selectin and one of its ligands, P-selectin glycoprotein ligand-1 (PSGL-1), are found solely on leukocyte surface and can mediate leukocyte–leukocyte interaction (11).
The selectins are transmembrane proteins that have three domains in their extracellular segment which include: N-terminal Ca2+ -dependent lectin domain that is analogous to domain of C-type lectin, a single epidermal growth factor-like (EGF-like) domain and 2-9 numbers of short consensus repeats homologous to the domains found in complement binding proteins (12). In humans, E-selectin is encoded by the 13 Kbp gene containing 14 exons. The several polymorphisms have been described within E-selectin gene which affects function of encoded protein. A Single nucleotide polymorphism (SNP) in the coding region of the gene (A561C) causes replacement of serine (S) with arginine (R) at codon 128 (13).

2. Objectives

Since E-selectin has a major role in inflammation and atherosclerosis; we aimed to explore the association between this polymorphism with CAD in a sample from southeastern Iranian population.

3. Material and Methods

3.1. Subjects

The study population was composed of 87 patients suffering from CAD and 93 age and sex-matched control subjects. The CAD patients were selected from subjects admitted at cardiology service of hospitals of Zahedan University of Medical Sciences. The CVD patients were defined by the presence of recognized myocardial infarction and coronary insufficiency (unstable angina with demonstrated ischemic electrocardiographic changes). The control group was selected from the Zahedan population who participated in a metabolic syndrome project and had normal blood pressure, normal triglycerides, normal blood glucose, normal body mass index, and no history of CAD or negative family history for CAD. The study was approved by local ethical comitte of Zahedan University of Medical Sciences.

3.2. Sampling and Methods

Following 12 hours of fasting, blood samples with/without EDTA were taken from subjects. Total cholesterol, triglycerides (TG) and HDL cholesterol (HDL-C) concentrations were measured by standard enzymatic methods using commercially available kits (Pars Azmoon Co, Iran). Low-density lipoprotein cholesterol (LDL-C) was calculated with the Friede¬wald formula.
DNA was extracted from EDTA blood using the standard salting out method (13). Primers were designed with Fast-PCR software and are identified as ESF: 5´ GCTGATGTCTCTGTTGCACACTG3´ and ESR: 5´CCATATGACACCATCTGCACCAG3´. The region of E-selectin gene containing A561C site was amplified from genomic DNA by polymerase chain reaction (PCR). PCR was performed using commercially available PCR premix (AccuPower PCR PreMix, BIONEER, Daejeon, Korea) based on manufacturer recommended protocol. PCR mixture contains lyophilised AccuPower PCR PreMix, 2 μL template DNA (∼80 ng/μL), 1 μL of each primer (10 μM) in total volume 20μL with DNase-free water. The reaction mixture was subjected to denaturation at 95°C for 5 minutes, followed by 30 cycles at 95°C for 45 seconds, 59°C for 45 seconds, 72°C for 45 seconds, then by a final extension at 72°C for 5 minutes in a My Cycler system (Bio Rad Co, USA). PCR product was confirmed by electrophoresis in 1.5% agarose gel prestain with ethidium bromide. Subsequently, 10 μL PCR product (323bp) was digested by 10 units Pst I and resulting fragments were separated by gel electrophoresis in a 2.5% agarose gel.

3.3. Statistical Analysis

Student’s t-test was used for analysis of the serum lipid levels and demographic characteristics. Genotype frequencies in patient and control groups were compared by Chi-Square test. Binary logistic regression was used to compute ORs and 95% CIs. Data were analyzed using SPSS 15 software and p value less than 0.05 was considered statistically significant.

4. Results

The demographic characteristics of the patients and age and gender-matched controls are summarized in Table 1. There was no significant difference in smoking between two groups (P = 0.18). Serum triglyceride, total cholesterol and LDL cholesterol were higher (P < 0.001), while HDL cholesterol concentration was lower (P < 0.001) in patients when compared with controls. The PCR product (323bp) following digestion yielded bands of 204 and 119bp in AA homozygote, and 323, 204, and 119bp in AC heterozygote. The PCR product in CC homozygote remained intact (Figure 1).
Table 1.Characteristics of Patients and Control Subjects (Mean ± SD)
CAD (n = 87)Control (n = 93)P-Value
Gender
Male/Female38/4951/420.053
Smoking
Yes/No14/646/540.180
Age, y59.3 ± 12.159.4 ± 10.60.900
Total cholesterol, mg/dl208.6 ± 39.0171.0 ± 27.0< 0.001
LDL cholesterol, mg/dl130.1 ± 30.9105.9 ± 31.4< 0.001
HDL cholesterol, mg/dl37.5±5.750.9 ± 7.5< 0.001
Triglyceride, mg/dl214.2 ± 40.2109.0 ± 37.4< 0.001
Abbreviations: M: DNA Marker; Lane 1: CC; Lane 2: AA; Lane 3: AC
Figure 1.

Abbreviations: M: DNA Marker; Lane 1: CC; Lane 2: AA; Lane 3: AC

The frequency of CC genotype was statistically different between CAD patients and controls: 20.7% versus 7.5%, OR = 2.96 [95% CI = 1.36–6.44, P < 0.01). The C allele frequency was also significantly different between patients with CAD and controls: 32.7% versus 27.9%, OR = 1.61 (95% CI = 1.03–2.51, P < 0.05) (Table 2). The genotypes in controls (χ2 = 0.052, P = 0.819) but not in cases were in HEW (χ2 = 17.78, P < 0.001).
Table 2.E-Selectin Genotypes and Alleles Frequencies in CAD Patients and Control Group
GenotypesCAD, No. (%)Control, No. (%)OR (95%CI)P-value
AA48 (55.20)48 (51.60)Ref.-
AC21 (24.10)38 (40.90)0.586 (0.30-1.147)0.120
CC18 (20.70)7 (7.50)2.96 (1.36-6.44)0.006
Alleles
A117 (67.30)134 (72.05)Ref.-
C57 (32.70)52 (27.95)1.61 (1.03-2.51)0.040

5. Conclusions

The various genetic factors including genetic variants (single nucleotide polymorphisms) may play a role in pathogenesis of atherosclerosis. The SNPs replace a nucleotide with another nucleotide in gene structure. When SNPs arise within a gene or in a regulatory region near a gene, they may play a direct role in disease by affecting the gene’s function (14, 15). If a SNP take place in coding regions of genes, it causes replacement of an amino acid in a protein structure with another amino acid, which results in the alteration of protein activity (16).
In the present study, we found that the frequency of AA genotype in the A561C polymorphism of the E-selectin gene was greater in CAD patients compared with control subjects. Whereas, the prevalence of and AC genotype was less in CAD patients than controls. However, these differences were not statistically significant (P > 0.05). In contrast, the prevalence of CC genotype in control groups was significantly less than CAD patients. The C allele was significantly less common in control subjects than in CAD patients, indicating that C allele in A561C polymorphism site of E-selectin gene may be a risk factor or coronary artery disease in southeastern Iran.
The relationship of between A561C polymorphism of E-selectin gene and CAD was evaluated in numerous studies (17-21). In contradiction with our results, Tripathi et al. reported that S128R polymorphism in E-selectin gene in Indian peoples has no relationship with CAD (17).
Moreover, in another study, it was observed that in subjects suffering from diabetes type 2 the E-selectin S128R polymorphism is not associated with CAD (18). Contrarily, Li et al. reported that the presence of allele C in A561C polymorphism was associated with CAD in a Chinese population (19). A significant association between C allele and CAD was observed in Arab patients (20).Furthermore, it was shown in a Japanese population that substitution of Ser with Arg in EGF domain of E-selectin may be a risk factor for severe atherosclerosis (21). Our results support conclusions of these two research studies.
The possible molecular mechanism that link A561C polymorphism with CAD may be the effect of substitution of Ser with Arg on selectin properties. The initial step in atherogenesis is attachment of leukocytes to endothelium that mediates by selectin molecules (22). The EGF-like domain of P- and E-selectin may play a direct role in ligand recognition and leukocyte adhesion (8, 9). The substitution of Arg instead of Ser at positions of 128 within either the E-selectin EGF domain can increase binding activity of these selectin to its ligand in leukocyte surface (23).
The consequence of S128R polymorphism on binding properties of E-selectin to its ligand was also evaluated by in vitro studies. Wenzel et al. showed that S128R polymorphism decreased attachment of E-selectin expressing COS cells to HL-60 cells (24), whereas their study on German population identified S128R polymorphism as risk factor for CAD (25). An in vitro study by Rao et al. showed that substitution of Ser with Arg in S128R polymorphism significantly increased affinity and specificity of lymphocyte binding to CHO cell line (26).
In summary, in spite of small sample size, we found out a relationship between A561C polymorphism of E-selectin gene and CAD in southeastern Iranian population. Our results revealed that presence of C nucleotide in position 561 of E-selectin gen may be a genetic risk factor for CAD.

Acknowledgments

Footnotes

References

  • 1.
    Gensini GF, Comeglio M, Colella A. Classical risk factors and emerging elements in the risk profile for coronary artery disease. Eur Heart J. 1998;19(A):A53-A61.
  • 2.
    Belay B, Belamarich P, Racine AD. Pediatric precursors of adult atherosclerosis. Pediatr Rev. 2004;25(1):4-16. [PubMed ID: 14702517].
  • 3.
    Fuster V, Badimon L, Badimon JJ, Chesebro JH. The pathogenesis of coronary artery disease and the acute coronary syndromes (2). N Engl J Med. 1992;326(5):310-8. [PubMed ID: 1728735]. https://doi.org/10.1056/NEJM199201303260506.
  • 4.
    Kruth HS. Subendothelial accumulation of unesterified cholesterol: an early event in the atherosclerotic lesion development. Atherosclerosis. 1985;57:337-341.
  • 5.
    Gerrity RG. The role of the monocyte in atherogenesis: I. Transition of blood-borne monocytes into foam cells in fatty lesions. Am J Pathol. 1981;103(2):181-90. [PubMed ID: 7234961].
  • 6.
    Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362(6423):801-9. [PubMed ID: 8479518]. https://doi.org/10.1038/362801a0.
  • 7.
    Mitchell DJ, Li P, Reinhardt PH, Kubes P. Importance of L-selectin-dependent leukocyte-leukocyte interactions in human whole blood. Blood. 2000;95(9):2954-9. [PubMed ID: 10779445].
  • 8.
    Mayadas TN, Johnson RC, Rayburn H, Hynes RO, Wagner DD. Leukocyte rolling and extravasation are severely compromised in P selectin-deficient mice. Cell. 1993;74(3):541-54. [PubMed ID: 7688665].
  • 9.
    Abbassi O, Kishimoto TK, McIntire LV, Anderson DC, Smith CW. E-selectin supports neutrophil rolling in vitro under conditions of flow. J Clin Invest. 1993;92(6):2719-30. [PubMed ID: 7504692]. https://doi.org/10.1172/JCI116889.
  • 10.
    Bargatze RF, Kurk S, Butcher EC, Jutila MA. Neutrophils roll on adherent neutrophils bound to cytokine-induced endothelial cells via L-selectin on the rolling cells. J Exp Med. 1994;180(5):1785-92. [PubMed ID: 7525838].
  • 11.
    Spertini O, Cordey AS, Monai N, Giuffre L, Schapira M. P-selectin glycoprotein ligand 1 is a ligand for L-selectin on neutrophils, monocytes, and CD34+ hematopoietic progenitor cells. J Cell Biol. 1996;135(2):523-31. [PubMed ID: 8896607].
  • 12.
    Ley K. The role of selectins in inflammation and disease. Trends Mol Med. 2003;9(6):263-8. [PubMed ID: 12829015].
  • 13.
    Kansas GS, Saunders KB, Ley K, Zakrzewicz A, Gibson RM, Furie BC, et al. A role for the epidermal growth factor-like domain of P-selectin in ligand recognition and cell adhesion. J Cell Biol. 1994;124(4):609-18. [PubMed ID: 7508943].
  • 14.
    Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi M, Bardestani GR, Kordi-Tamandani DM, et al. Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran. Genet Mol Res. 2010;9(1):333-9. [PubMed ID: 20198589]. https://doi.org/10.4238/vol9-1gmr728.
  • 15.
    Wang Z, Moult J. SNPs, protein structure, and disease. Hum Mutat. 2001;17(4):263-70. [PubMed ID: 11295823]. https://doi.org/10.1002/humu.22.
  • 16.
    Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31(13):3812-4. [PubMed ID: 12824425].
  • 17.
    Tripathi R, Singh PK, Tewari S, Tamhankar PM, Ramesh V, Agarwal S. Genetic predisposition of E-selectin gene (S128R) polymorphism in patients with coronary artery disease (CAD). Indian J Med Res. 2009;130(4):423-7. [PubMed ID: 19942746].
  • 18.
    Endler G, Exner M, Raith M, Marculescu R, Mannhalter C, Endler L, et al. The E-selectin S128R polymorphism is not a risk factor for coronary artery disease in patients with diabetes mellitus type 2. Thromb Res. 2003;112(1-2):47-50. [PubMed ID: 15013273]. https://doi.org/10.1016/j.thromres.2003.10.018.
  • 19.
    Li Y, Wei YS, Wang M, Zhang PA, Jiang XJ, Huang CX. Association between the Ser128Arg variant of the E-selectin and risk of coronary artery disease in the central China. Int J Cardiol. 2005;103(1):33-6. [PubMed ID: 16061120]. https://doi.org/10.1016/j.ijcard.2004.07.011.
  • 20.
    Abu-Amero KK, Al-Boudari OM, Mohamed GH, Dzimiri N. E-selectin S128R polymorphism and severe coronary artery disease in Arabs. BMC Med Genet. 2006;7(52):1-5.
  • 21.
    Yoshida M, Takano Y, Sasaoka T, Izumi T, Kimura A. E-selectin polymorphism associated with myocardial infarction causes enhanced leukocyte-endothelial interactions under flow conditions. Arterioscler Thromb Vasc Biol. 2003;23(5):783-8. [PubMed ID: 12649084]. https://doi.org/10.1161/01.ATV.0000067427.40133.59.
  • 22.
    Fan J, Watanabe T. Inflammatory reactions in the pathogenesis of atherosclerosis. J Atheroscler Thromb. 2003;10(2):63-71. [PubMed ID: 12740479].
  • 23.
    Revelle BM, Scott D, Beck PJ. Single amino acid residues in the E- and P-selectin epidermal growth factor domains can determine carbohydrate binding specificity. J Biol Chem. 1996;271(27):16160-70. [PubMed ID: 8663282].
  • 24.
    Wenzel K, Stahn R, Speer A, Denner K, Glaser C, Affeldt M, et al. Functional characterization of atherosclerosis-associated Ser128Arg and Leu554Phe E-selectin mutations. Biol Chem. 1999;380(6):661-7. [PubMed ID: 10430030]. https://doi.org/10.1515/BC.1999.082.
  • 25.
    Wenzel K, Felix S, Kleber FX, Brachold R, Menke T, Schattke S, et al. E-selectin polymorphism and atherosclerosis: an association study. Hum Mol Genet. 1994;3(11):1935-7. [PubMed ID: 7533025].
  • 26.
    Rao RM, Haskard DO, Landis RC. Enhanced recruitment of Th2 and CLA-negative lymphocytes by the S128R polymorphism of E-selectin. J Immunol. 2002;169(10):5860-5. [PubMed ID: 12421968].

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles