Study the Cross-talk Between Hepatitis B Virus Infection and Interferon Regulatory Factors in Liver Transplant Patients

Author(s):
Sahar JanfeshanSahar JanfeshanSahar Janfeshan ORCID1, Ramin YaghobiRamin YaghobiRamin Yaghobi ORCID2,*, Akram EidiAkram Eidi1, Mohammad Hossein KarimiMohammad Hossein Karimi2, Bita GeramizadehBita Geramizadeh2, Seyed Ali MalekhosseiniSeyed Ali Malekhosseini3, Farshid KafilzadehFarshid Kafilzadeh4
1Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, IR Iran
2Shiraz Transplant Research Center, Shiraz University of Medical Sciences, Shiraz, IR Iran
3Transplant Center, Shiraz University of Medical Sciences, Shiraz, IR Iran
4Department of Microbiology, Jahrom Branch, Islamic Azad University, Jahrom, IR Iran

Hepatitis Monthly:Vol. 17, issue 11; e12426
Published online:Oct 28, 2017
Article type:Research Article
Received:Oct 24, 2016
Accepted:Oct 07, 2017
How to Cite:Janfeshan S, Yaghobi R, Eidi A, Karimi MH, Geramizadeh B, et al. Study the Cross-talk Between Hepatitis B Virus Infection and Interferon Regulatory Factors in Liver Transplant Patients. Hepat Mon. 2017;17(11):e12426. doi: https://doi.org/10.5812/hepatmon.12426

Abstract

Background:

Interferon regulatory factors (IRFs) as immunoregulatory molecules have a determinative antiviral role in liver transplantation outcomes and graft rejection. Hepatitis B virus (HBV) and its antigen derivatives also choose some strategies to escape from innate immune responses.

Objectives:

The current study aimed at evaluating inflammatory cross-talks between pattern recognition receptors (PRRs) signaling components such as IRF3 and IRF7 with HBV infection in mRNA levels in patients undergoing liver transplantation.

Methods:

The 46 HBV infected liver recipients were divided into rejection experienced (20) and not experienced (26) groups and a healthy control group was also considered. Peripheral mononuclear cells (PBMCs) were isolated form each studied patient on the days 1, 4, and 7 in post-transplant period. After RNA extraction and cDNA synthesis from each collected sample, the expression levels of IRF3 and IRF7 genes were evaluated using in-house SYBER Green based the real-time polymerase chain reaction (PCR) protocols.

Results:

The overexpression of mRNA levels of IRF3 (3.37 folds) and IRF7 (1.74 folds) on the day 1 were found in patients experiencing rejection, compared with non-rejected ones, based on initial ischemia/reperfusion (I/R) injuries. But, the mRNA levels of IRF3 (0.53 folds) and IRF7 (0.74 folds) on the day 4 were downregulated in patients with rejected transplantation, compared with non-rejected ones. Finally, reducing the expression of IRF3 (0.54 fold) on the day 7 and upregulation of IRF7 (2.38 fold) on the day 7 were found in rejected liver recipients, compared with non-rejected ones in post-transplant period.

Conclusions:

Downregulation of IRF3 expression in patients with HBV infection, who experienced rejection episodes in the first week post-liver transplantation indicated that they may be at higher risk for acute rejection; the hypothesis, which should be investigated in further studies.

1. Background

Inflammation is the innate immunity response to infection, stress, and tissue injury. Inflammatory cells have pattern recognition receptors (PRRs), which recognize either pathogen-associated molecular patterns (PAMPs) such as viral nucleic acids and bacterial lipopolysaccharide or damage-associated molecular patterns (DAMPs). PRRs such as toll like receptors (TLRs) induce the production of proinflammatory cytokines by the activation of transcription factors such as NF-KB (nuclear factor kappa-light-chain-enhancer of activated B-cells), activator protein 1 (AP1), and interferon regulatory factors (IRFs) (1).
Liver inflammation occurs in acute and chronic liver diseases such as viral hepatitis, alcoholic liver disease, drug-induced liver injury, ischemia/reperfusion (I/R) injury, and other diseases, which may associate with liver damage and fibrosis (2). Among viral hepatitis such as chronic HBV infection, the liver transplant is also considered as the final treatment method, which leads to rejection or acceptance of liver graft (3-7). Accordingly, activation of inflammatory signaling pathways is reported in allograft rejection. It appears that inflammatory responses play key roles in transplant clinical outcomes. Initial I/R injury in allograft recipients leads to the production of reactive oxygen and nitrogen species. Activated innate immune cells release chemokines and other proinflammatory factors that cause further oxidative stress, increased inflammation, and finally organ loss (2, 8). It is necessary to study the cross-talk between viral infections and inflammatory responses in liver graft recipients. Therefore, early prognosis of any change in immune factors such as IRFs leads to better management of post-liver transplant outcomes.
IRF family has 9 identified members in mammals: (IRF 1 - 9) (9). IRFs are the regulatory transcription factors with critical role in innate and acquired immunity responses against microbial infection, cell growth regulation, apoptosis, oncogenes, and blood cell differentiation (10). IRFs have a conserved DNA binding domain (DBD) in N-terminal area that has a helix-turn-helix structure and recognize interferon stimulated response element (ISRE) sequence in target DNA. All IRFs except IRF1 and IRF2 have an IRF-association domain (IAD) in C-terminal area, which performs homomeric and heteromeric interactions with other IRFs for gene regulation (10, 11). After infection and induction of the PRR signaling pathways, the inactivated form of IRF3 and IRF7 in cytosol are phosphorylated; they form (homomeric or heteromeric) dimmers, then translocate into nucleus and induce target gene expression (9, 11). IRF3 is activated by TLR3, TLR4, and RIG-1/MDA5 signaling pathways and (10-13) induces the expression of IFN-4α/β, IFN-related genes (ISGs), and inflammatory chemokines with critical roles in innate immunity responses, inflammation, and activation of acquired immunity (10, 14).IRF7 also induces IFN1 production in relation to the activation of TLR7, TLR9, and RIG1/MDA5 signaling pathways post-microbial infections (9, 11).
Viruses have some strategies to escape from innate immune responses. On the other hand, components of innate immunity such as IRFs are affected by viruses. Viruses interfere in IRFs activation and activity, or downregulation of IRF genes (15); most of the cell types IRF3 and IRF7 phosphorylated by TBK1 and IKKε kinases (10, 15, 16). Phosphorylated forms of these transcription factors are required to interact with themselves or other proteins (16, 17). Some viral proteins target TBK1 and IKKε to decrease the ability of innate immune system. Viral proteins inhibit or reduce function of host kinases by direct binding to TBK1, IKKε, atypical phosphorylation of IRFs, deubiquitination of kinases and competition with IRF molecules to bind to kinases (15). In the review of earlier reports, N1L protein in vaccinia virus (VACV) associated with TBK1 complex of host cell inhibited the IRF3 and IRF7 activities (18). ORF47 (open reading frame 47) in varicella-zoster virus (VZV) inhibited TBK1 by atypical phosphorylation of IRF3 (19). Deubiquitinase activity of BPLF-1 protein in Epstein-bar virus (EBV) degrades IKKα to inhibit IRF7 activity (20). The BGLF4 in EBV bound directly to IRF3 and inhibited the interaction of IRF3 with target promoters (21). KbZIP protein in the Kaposi sarcoma-associated herpesvirus (KSHV) bound to IFN-β promoter and inhibited IRF3 interaction with this promoter and formation of enhanceosome (22). Some viral proteins such as Npros in classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV) promoted proteosomal degradation of inactivated forms of IRF molecules (23, 24). In spite of possible determinative association between pathogenesis of chronic hepatitis B virus (HBV) infection with IRFs, limited studies were accomplished (15). Chronic HBV infection can lead to the end-stage liver diseases such as hepatocellular carcinoma and cirrhosis (3-6, 25-27). Therefore, early prognosis of any change in immune factors such as IRFs molecules leads to better management of post-liver transplant outcomes and raises the possibility of graft survival. The effects of HBV proteins on the IRF3 and IRF7 functions are investigated in few studies. HBV surface antigen (HBsAg) in viral infected cells inhibited TLR9-dependent expression of IRF7 and nuclear translocation (28). Downregulation of IRF7 gene in HBV infected patients was indicated earlier (29). HBV infection also led to reduced IFN-α production, which is the target gene in IRF7 signaling pathway (30). HBV polymerase blocked phosphorylation, dimerization, and activation of IRF3 and consequently reduced the production and antiviral effect of IFN-β (31, 32). HBx as a deubiquitinating enzyme also promoted proteasome degradation of RIG-1, TRAF3, and IRF3 factors (33). Modification in IRF3 and IRF7 mRNA is not yet investigated in human or animal models of transplantation. The role of IRF3 and IRF7, as components of inflammatory signaling pathway, is important due to the early activation of innate immune system, which occurs after the liver transplantation (34).

2. Objectives

The current study aimed at evaluating the mRNA expression levels of IRF3 and IRF7 in patients with HBV infection undergone liver transplantation with and without experiencing rejection, compared with healthy individuals.

3. Methods

3.1. Patients

The current study investigated 46 patients with chronic HBV infection undergone liver transplant surgery at Transplant Unit of Namazi hospital affiliated to Shiraz University of Medical Science, Shiraz, Iran. The candidates received liver graft according to their ABO blood group compatibility. EDTA (ethylenediaminetetraacetic acid)-treated blood samples were collected from each studied patient on the days 1, 4, and 7 post-transplantation. The presence of HBV immunologic markers were analyzed in plasma sample of all patients using the enzyme-linked immunosorbent assay (ELISA) technique prior to transplantation. The HBV recipients understudy were divided into rejection (20) and non-rejection (26) patient groups, based on the pathological result. A healthy control group including 13 subjects was enrolled. All graft rejected patients were experienced rejection episodes in the first week post-transplantation. Additionally, HBV copy number was calculated based on the quantitative real-time polymerase chain reaction (PCR) protocol. All HBV infected recipients used tenofovir (300 mg oral/day) or lamivudine (50 - 100 mg oral/day) in order to prevent recurrence of HBV infection. All studied patients were negative for human immunodeficiency virus (HIV) and hepatitis C virus (HCV) infections pre-transplantation and active cytomegalovirus (CMV) infection post-transplantation. The current study was supported by the ethical committee of Shiraz University of Medical Sciences based on the ethical guidelines of the 1975 Helsinki declaration.

3.2. RNA Extraction and cDNA Synthesis

Total RNA was isolated from patients' buffy coats using RNX plus (CinnaGen, Iran). The cDNA was synthesized using PrimeScript RT Reagent Kit (Takara Bio, Otsa, Shiga, Japan) according to manufacturer’s instructions. The purity and concentration of total RNA was measured using NanoDrop™ (Thermo Scientific™, USA) at 260/280 nm.

3.3. Real-Time Polymerase Chain Reaction

The expression levels of IRF3 and IRF7 were analyzed in HBV infected liver recipients with and without experiencing rejection and in healthy controls using in-house SYBR Green real-time PCR protocols by StepOnePlus™ Real-Time PCR System (ABI, StepOnePlus™, USA). To synchronize data and omit test errors of the mRNA, expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was evaluated as an internal control. The primer sequences were designed for the amplification of IRF3, IRF7, and GAPDH transcripts (NM_001197122.1; NM_001572.3, NM_001289745.1,). The PCR mix ingredients, primer sequences, product lengths, and thermocycling conditions are presented in Table 1. Melting point curves of target and internal control genes were analyzed to confirm the specificity of PCR reactions.
Table 1.PCR Mix Ingredients and Real-Time PCR Programs
GenePrimerPrimer Sequences (5' - 3')PCR Product Length, bpThermocycling ConditionsPCR Mix, µL; C
IRF3IRF-3:R5´TCCAGAATGTCTTCCTGGGT3´8295°C/30 s, 40 cycles of 95°C/15 s, 62°C/20 s, and 72°C/30 sSYBR Green Premix (5 µL; 2X), SYBR Green Dye (0.2 µL; 50X). Forward primers (0.4 µL; 5 pM), Reverse primers (0.4 µL; 5 pM)
IRF-3:F5´TTGGGGACTTTTCCCAGCC3´
IRF7IRF-7:R5´TCGTCATAGAGGCTGTTGGC 3´7395°C/30 s, 40 cycles of 95°C/15 s, 61°C/20 s, and 72°C/30 s
IRF-7:F5´GTGAGGGTGTGTCTTCCCTG3´
GAPDHGAPDH:R5´CCAGTAGAGGCAGGGATGAT3´19995°C/30 s, 40 cycles of 95°C/15 s, 57.5°C/20 s, and 72°C/30 s
GAPDH:F5´GGACTCATGA7CCACAGTCCA3´

3.4. Molecular and Antigenic Analysis of CMV Infection

CMV genome was extracted from plasma samples of HBV infected recipients who rejected or non-rejected transplant using Invisorb® Spin Virus RNA Mini Kit (Invitek, Birkenfeld, Germany) according to the manufacturer’s instruction. CMV genomic DNA load was evaluated using gensig® quantitative real-time PCR kit (Primer Design, Advanced kit, UK) according to the manufacturer’s instruction. Sensitivity of the real-time PCR assay to diagnose CMV infection was as few as 10 copies of the viral genome per milliliter of sample. Detection of active cytomegalovirus infection was performed for both groups of the studied patients using antigenemia technique using CMV Brite Turbo kit (IQ Products, Groningen, the Netherlands) according to the manufacturer’s instruction (35).

3.5. Statistical Analysis

Evaluation of the expression levels of IRF3 and IRF7 genes was performed by intragroup and intergroup analyses on HBV infected recipients who rejected or non-rejected liver-transplant and controls during 3 times follow-up using the 2-ΔΔCT (Livak) method. Statistical analysis was performed with SPSS version 16 (IBM Corporation, Armonk, NY, USA). P < 0.05 was considered significant.

4. Results

4.1. Patients

There were 26 patients in the non-rejected group with the mean age of 51.62 ± 10.6 years the age ranging 26 to 74 out of which 73% (n = 19) were male and 23% (n = 7) female. In the rejected group, there were 20 patients with the mean age of 50.95 ± 10.6 years ranging 27 to 69 out of which 85% (n = 17) were male and 15% (n = 3) female. Distribution of blood grouping in the rejected patients comprised of A+ (20%), B+ (25%), AB+ (5%) , O+ (45%), and A- (5%). In the non-rejected group the distribution consisted of A+ (30.76%), B+ (26.92%), AB+ (3.84%), O+ (34.61%), and O- (3.84%). The most frequent blood group in both studied liver recipients was O+.

4.2. The Expression Levels of IRF3 and IRF7 Genes in HBV Infected Liver Recipients with and Without Experiencing Rejection

The mRNA expression levels of the IRF3 and IRF7 genes were compared between and within the 2 liver recipient groups on the days 1, 4, and 7 post-transplantation.
Comparison within non-rejected group showed that the mRNA level of IRF3 decreased on the day 4 and increased on the day 7, but vice versa the mRNA level of IRF7 increased on the day 4 and decreased on the day 7 post-liver transplants without any statistical significance (Figure 1).
Comparison of the Expression Levels ofIRF3 and IRF7 Genes on the Days 1, 4, and 7 Post-Liver Transplant Period in the HBV Infected Non-Rejected Group (HBV-NR).
Figure 1.

Comparison of the Expression Levels ofIRF3 and IRF7 Genes on the Days 1, 4, and 7 Post-Liver Transplant Period in the HBV Infected Non-Rejected Group (HBV-NR).

In the rejected group, the IRF3 mRNA levels increased significantly (P = 0.012) during 3 follow-up days post-transplantation. The IRF7 mRNA levels did not significantly decrease on the day 4 and increased on the day 7 post-transplantation (Figure 2).
Comparison of the Expression Levels of IRF3 and IRF7 Genes on the Days 1, 4, and 7 Post-Liver Transplant Period in the HBV Infected Rejected Group (HBV-R).
Figure 2.

Comparison of the Expression Levels of IRF3 and IRF7 Genes on the Days 1, 4, and 7 Post-Liver Transplant Period in the HBV Infected Rejected Group (HBV-R).

4.3. Comparison of the Expression Levels of IRF3 and IRF7 Genes Between the Liver Recipients with HBV Infection Who Rejected or Non-Rejected the Transplant

The expression levels of IRF3 and IRF7 genes were compared between the rejected and non-rejected liver recipients. The expression level of IRF3 in the rejected patients showed a significant upregulation (3.37 folds) on the day 1 (P = 0.049); however, downregulation on the days 4 (0.53 folds) and 7 (0.54 folds) was insignificant, compared with the non-rejected patients (Figure 3). The expression levels of IRF7 in the rejected patients showed insignificant upregulation on the days 1 (1.74 folds) and 7 (2.38 folds), but a significant downregulation (P = 0.017) was observed on the day 4 (0.74 folds), compared with non-rejected patients (Figure 4).
Comparison of the Expression Levels of IRF3 gene on the Day 1, 4, and 7 Post-Liver Transplant Period in the HBV Infected, Rejected and Non-Rejected Groups.
Figure 3.

Comparison of the Expression Levels of IRF3 gene on the Day 1, 4, and 7 Post-Liver Transplant Period in the HBV Infected, Rejected and Non-Rejected Groups.

Comparison of the expression levels of IRF7 gene on the day 1, 4, and 7 post-liver transplant period in the HBV infected, rejected and non-rejected groups.
Figure 4.

Comparison of the expression levels of IRF7 gene on the day 1, 4, and 7 post-liver transplant period in the HBV infected, rejected and non-rejected groups.

4.4. Comparison of the Expression Levels of IRF3 and IRF7 Genes Between the HBV Infected Recipients Who Rejected or Non-Rejected the Transplant and the Healthy Controls

The expression levels of IRF3 and IRF7 genes in HBV infected recipients who rejected or non-rejected the transplant were compared with those of the healthy controls. In rejected group, the mRNA levels of IRF3 showed upregulation on the day 1, but downregulation on the days 4 and 7 compared with those of the healthy controls. Modifications in mRNA expression were not significant on the days 1 and 7, but significant on the day 4 (P = 0.03) (Figure 5).
Comparison of the Expression Levels of IRF3 on the Day 1, 4, and 7 Post-Liver Transplant Period in Patients with Rejection and Healthy Controls.
Figure 5.

Comparison of the Expression Levels of IRF3 on the Day 1, 4, and 7 Post-Liver Transplant Period in Patients with Rejection and Healthy Controls.

The mRNA expression levels of IRF7 in the rejected patients showed downregulation during all 3 follow-up periods, compared with those of the healthy controls. Modifications were significant on the days 1 (P = 0.002) and 4 (P = 0.017), but insignificant on the day 7 (Figure 6). Expression levels of IRF3 in non-rejected group showed a significant downregulation on the day 1 (P = 0.039), but insignificant upregulation on the days 4 and 7, compared with those of the healthy controls (Figure 7). The mRNA expression levels of IRF7 in non-rejected patients showed a significant downregulation in all 3 follow-up time periods (P = 0.003, P = 0.023, and P = 0.003, respectively), compared with those of the healthy controls (Figure 8).
Comparison of the Expression Levels of IRF7 on the Days 1, 4, and 7 Post-Liver Transplant Period in Patients with Rejection and Healthy Controls.
Figure 6.

Comparison of the Expression Levels of IRF7 on the Days 1, 4, and 7 Post-Liver Transplant Period in Patients with Rejection and Healthy Controls.

Comparison of the Expression Levels of IRF3 on the Days 1, 4, and 7 Post-Liver Transplant Period in Non-Rejected Patients and Healthy Controls.
Figure 7.

Comparison of the Expression Levels of IRF3 on the Days 1, 4, and 7 Post-Liver Transplant Period in Non-Rejected Patients and Healthy Controls.

Comparison of the Expression Levels of IRF7 on the Days 1, 4, and 7 Post-Liver Transplant Period in Non-Rejected Patients and Healthy Control.
Figure 8.

Comparison of the Expression Levels of IRF7 on the Days 1, 4, and 7 Post-Liver Transplant Period in Non-Rejected Patients and Healthy Control.

5. Discussion

Transplantation is the final treatment of choice for chronic HBV infection, which causes the end-stage liver diseases (3-6, 25-27). Therefore, any changes in IFN production as an inflammatory response may influence the result of liver transplantation. The studies on the HBV infection in chimpanzees and transgenic mice showed that non-induction of intrahepatic genes such as type I and II interferon, early after HBV infection cause pervasive increase of HBV particles in liver (36-40).
In other studies, in HBV infected transgenic mouse model and in hepatoma cell line, IFN genes were induced and HBV replication was inhibited (40, 41). The expression of adaptor proteins such as TRIF and MyD88 in hepatoma cell line and activation of TLR signaling in transgenic mouse restrict and suppress HBV replication, respectively. In addition, other cytokines such as IL-12 and IL-18 controlled HBV replication mediated by IFN-γ and IFNα/β, respectively (41). These researches indicated the relationship between HBV infection and IFN production.
IRFs as components of innate immunity have antiviral effects including PRR-dependent IFN gene expression. IRF1 induces IFNα/β gene expression in cell type and time definite approach. Expression of the inflammatory chemokine by IRF5 induces IFN α/β genes in plasmacytoid dendritic cells. The antiviral effects of IRF1, IRF3, and IRF7 stimulate IFN production followed by overexpression of ISGs genes. IRF9 is one of the components of triplicate complex known as IFN-stimulated gene factor 3 (ISGF3) and induces the expression of ISGs genes (10-13, 15). Inflammation is one of the important complications occurs following the liver transplant and leads to destruction of liver graft if cannot be controlled (2). PRR-mediated inflammation increases mRNA levels of innate immune components such as IRF3 and IRF7 genes, which induce IFN α/β production (1, 10).
On the other hand, chronic HBV infection as the main reason of liver transplant in Iran (42, 43) causes tissue inflammation and dysfunction (8) and may modify the IRF gene expression post-surgery. Viruses discipline to escape from innate immune systems involving IRFs such as IRF3 and IRF7 by managing their antiviral effect by PRR-mediated IFN gene induction (15).
It is documented that HBV proteins such as HBV polymerase, HBx, and HBsAg interfered in IRF3 and IRF7 functions to deal with innate immune responses (28, 31-33). Despite the fact, the innate immune system reduces HBV replication and HBV-mRNA stability (44, 45). In other words, HBV and innate immunity counter with each other (15). Activation of PRR signaling pathways induce inflammation and upregulation of the mRNA levels of innate immune components such as IRFs and induce IFN production, subsequently. It is likely that, among IRF molecules, IRF3, and IRF7 play key roles to induce IFN production following inflammation (1, 10). In this regard, initial activation of inflammatory response following liver transplant may cause acute graft rejection (2). Hence, evaluation of the expression levels of inflammatory molecules in transplant recipients, early post-transplant period, may help to the better management of acute liver rejection. Thus, the current study mainly aimed at evaluating the mRNA levels of IRF3 and IRF7 in HBV infected liver recipients with and without experiencing acute rejection.
There was no direct study on cross-talk between the expression levels of IRF3 and post-transplant inflammation yet. Previous studies on TLR4, a receptor of IRF3 signaling pathway, in transplant animal models showed that mice with knockout TLR4 gene were protected from ischemia-reperfusion (I/R) injuries in liver graft (46). In another research, activation of innate immune system by the upregulation of IRF3 and TLR4 genes was detected in I/R injuries of hepatic acute rejection (47). In other words, IRF3 may amplify inflammatory response in liver transplant.
The current study results demonstrated that modifications in IRF3 mRNA levels were not significant in non-rejected and rejected recipients, separately. According to the previous studies on cross-talk between IRF3 and HBV (31-33), it seems that in the non-rejected patient group, lower levels of HBV may be the cause of IRF3 downregulation on the day 4, but use of anti-HBV drugs cause the reduction of HBV viral load and upregulation of the IRF3 on the day 7 post-surgeries. It seems that, in liver recipients experiencing acute rejection, HBV presence and I/R injuries encounter each other to decrease or increase the expression levels of IRF3, respectively. In other words, they led to change the inflammatory response following the liver transplant in HBV infected recipients. These results showed that HBV downregulated the expression of IRF3 gene during all 3 follow-up time periods, and promoted acute rejection in the patients.
In patients with liver rejection, the expression of IRF3 was upregulated on the day 1 (3.37 folds) by the effect of initial I/R injuries and downregulated on the day 4 (0.53 folds), and on the day 7 (0.54 folds) for the presence of HBV infection, compared with the none-rejected ones. Comparing the expression levels of IRF3 between patients with acute rejection and healthy controls revealed the role of I/R injuries in the upregulation of this factor on the day 1 and downregulation for the presence of HBV infection on the days 4 and 7 post-liver transplantation. The HBV infection in non-rejected patients decreased the expression of IRF3 during 3 follow-up time periods, compared with the healthy controls.
IRF7 also induces the expression of IFN in innate immune signaling pathways (12). No relationship was observed between IRF7 and any human or animal models of transplantation yet, but the cross-talk between IRF7 and HBV infection was reported in a few studies (29, 30). In a research focused on the expression levels of TLR signaling molecules such as IRF7, IRAK1, IRAK4, and TRAF3 in chronic HBV infected patients, results indicated that IRF7 gene was downregulated (29). In other research, defective production of IFN-α, induced by IRF7, was found in chronic HBV infected patients (30).
In the current report, the expression of IRF7 was upregulated on the day 4 in non-rejected recipients after using anti-HBV drugs and activation of immune system. But, acceptance of liver graft and reduction of innate immune responses was followed by the downregulation of IRF7 on the day 7 post-surgery.
HBV infection and I/R injuries encountered each other and affected IRF7 expression in recipients who experienced rejection. In such patients, the HBV interaction with immune system leads to the downregulation of IRF7 on the day 4 post-surgery. But, initial I/R injuries promoted rejection and increased inflammation and caused overexpression of IRF7 on the day 7 post-transplants.
The comparison of expression levels of IRF7 between rejected and non-rejected patient groups and also within patients experiencing rejection showed that initial I/R injuries induced inflammatory response and overexpression of IRF7 in the rejected group especially in the day 1 (1.74 fold). However, the presence of HBV infection downregulated IRF7 mRNA levels on the day 4 (0.74 fold), promoted the rejection, increased the inflammation, and caused overexpression of IRF7 on the day 7 (2.38 folds) post-transplant. The expression of IRF7 downregulated in rejected and non-rejected liver recipients during all 3 follow-up time periods, based on the presence of HBV infection, compared with healthy controls.
Consequently, results of the current study demonstrated that the presence of HBV infection and I/R injuries can lead to decrease and increase of inflammatory responses following the liver transplantation. Evaluation of the expression levels of IRF3 and IRF7, as components of innate immune system in PBMCs of liver recipients showed different patterns in patients with and without experiencing acute rejection, but confirmed the role of HBV infection and I/R injuries during inflammatory signaling pathways in such patients. All in all, down regulation of the IRF3 gene expression, early post-transplant, in rejected patient group can present suitable candidates for acute rejection biomarker; the hypothesis requires confirmation in future studies.

Acknowledgments

References

  • 1.
    Newton K, Dixit VM. Signaling in innate immunity and inflammation. Cold Spring Harb Perspect Biol. 2012;4(3). [PubMed ID: 22296764]. https://doi.org/10.1101/cshperspect.a006049.
  • 2.
    Barker CE, Ali S, O'Boyle G, Kirby JA. Transplantation and inflammation: implications for the modification of chemokine function. Immunology. 2014;143(2):138-45. [PubMed ID: 24912917]. https://doi.org/10.1111/imm.12332.
  • 3.
    Cholongitas E, Papatheodoridis GV. Review of the pharmacological management of hepatitis B viral infection before and after liver transplantation. World J Gastroenterol. 2013;19(48):9189-97. [PubMed ID: 24409047]. https://doi.org/10.3748/wjg.v19.i48.9189.
  • 4.
    Ghaziani T, Sendi H, Shahraz S, Zamor P, Bonkovsky HL. Hepatitis B and liver transplantation: molecular and clinical features that influence recurrence and outcome. World J Gastroenterol. 2014;20(39):14142-55. [PubMed ID: 25339803]. https://doi.org/10.3748/wjg.v20.i39.14142.
  • 5.
    Mutimer D. Review article: hepatitis B and liver transplantation. Aliment Pharmacol Ther. 2006;23(8):1031-41. [PubMed ID: 16611263]. https://doi.org/10.1111/j.1365-2036.2006.02855.x.
  • 6.
    Shakiba E, Yaghobi R, Ramzi M. Prevalence of viral infections and hemorrhagic cystitis in hematopoietic stem cell transplant recipients. Exp Clin Transplant. 2011;9(6):405-12. [PubMed ID: 22142049].
  • 7.
    Mirzaee M, Yaghobi R, Ramzi M, Roshan Nia M. The prevalence of molecular and immunologic infective markers of hepatitis viruses in patients with hematological malignancies. Mol Biol Rep. 2012;39(2):1217-23. [PubMed ID: 21598110]. https://doi.org/10.1007/s11033-011-0851-x.
  • 8.
    Szabo G, Mandrekar P, Dolganiuc A. Innate immune response and hepatic inflammation. Semin Liver Dis. 2007;27(4):339-50. [PubMed ID: 17979071]. https://doi.org/10.1055/s-2007-991511.
  • 9.
    Savitsky D, Tamura T, Yanai H, Taniguchi T. Regulation of immunity and oncogenesis by the IRF transcription factor family. Cancer Immunol Immunother. 2010;59(4):489-510. [PubMed ID: 20049431]. https://doi.org/10.1007/s00262-009-0804-6.
  • 10.
    Tamura T, Yanai H, Savitsky D, Taniguchi T. The IRF family transcription factors in immunity and oncogenesis. Annu Rev Immunol. 2008;26:535-84. [PubMed ID: 18303999]. https://doi.org/10.1146/annurev.immunol.26.021607.090400.
  • 11.
    Honda K, Taniguchi T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol. 2006;6(9):644-58. [PubMed ID: 16932750]. https://doi.org/10.1038/nri1900.
  • 12.
    Solis M, Goubau D, Romieu-Mourez R, Genin P, Civas A, Hiscott J. Distinct functions of IRF-3 and IRF-7 in IFN-alpha gene regulation and control of anti-tumor activity in primary macrophages. Biochem Pharmacol. 2006;72(11):1469-76. [PubMed ID: 16846591]. https://doi.org/10.1016/j.bcp.2006.06.002.
  • 13.
    Paun A, Pitha PM. The IRF family, revisited. Biochimie. 2007;89(6-7):744-53. [PubMed ID: 17399883]. https://doi.org/10.1016/j.biochi.2007.01.014.
  • 14.
    Li Y, Hu X, Song Y, Lu Z, Ning T, Cai H, et al. Identification of novel alternative splicing variants of interferon regulatory factor 3. Biochim Biophys Acta. 2011;1809(3):166-75. [PubMed ID: 21281747]. https://doi.org/10.1016/j.bbagrm.2011.01.006.
  • 15.
    Marsili G, Perrotti E, Remoli AL, Acchioni C, Sgarbanti M, Battistini A. IFN Regulatory Factors and Antiviral Innate Immunity: How Viruses Can Get Better. J Interferon Cytokine Res. 2016;36(7):414-32. [PubMed ID: 27379864]. https://doi.org/10.1089/jir.2016.0002.
  • 16.
    Chen W, Royer WJ. Structural insights into interferon regulatory factor activation. Cell Signal. 2010;22(6):883-7. [PubMed ID: 20043992]. https://doi.org/10.1016/j.cellsig.2009.12.005.
  • 17.
    Battistini A. Interferon regulatory factors in immune cell development and host response to infections. New York: Nova Science Publishers, Inc; 2012.
  • 18.
    DiPerna G, Stack J, Bowie AG, Boyd A, Kotwal G, Zhang Z, et al. Poxvirus protein N1L targets the I-kappaB kinase complex, inhibits signaling to NF-kappaB by the tumor necrosis factor superfamily of receptors, and inhibits NF-kappaB and IRF3 signaling by toll-like receptors. J Biol Chem. 2004;279(35):36570-8. [PubMed ID: 15215253]. https://doi.org/10.1074/jbc.M400567200.
  • 19.
    Vandevenne P, Lebrun M, El Mjiyad N, Ote I, Di Valentin E, Habraken Y, et al. The varicella-zoster virus ORF47 kinase interferes with host innate immune response by inhibiting the activation of IRF3. PLoS One. 2011;6(2). e16870. [PubMed ID: 21347389]. https://doi.org/10.1371/journal.pone.0016870.
  • 20.
    van Gent M, Braem SG, de Jong A, Delagic N, Peeters JG, Boer IG, et al. Epstein-Barr virus large tegument protein BPLF1 contributes to innate immune evasion through interference with toll-like receptor signaling. PLoS Pathog. 2014;10(2). e1003960. [PubMed ID: 24586164]. https://doi.org/10.1371/journal.ppat.1003960.
  • 21.
    Wang JT, Doong SL, Teng SC, Lee CP, Tsai CH, Chen MR. Epstein-Barr virus BGLF4 kinase suppresses the interferon regulatory factor 3 signaling pathway. J Virol. 2009;83(4):1856-69. [PubMed ID: 19052084]. https://doi.org/10.1128/JVI.01099-08.
  • 22.
    Lefort S, Soucy-Faulkner A, Grandvaux N, Flamand L. Binding of Kaposi's sarcoma-associated herpesvirus K-bZIP to interferon-responsive factor 3 elements modulates antiviral gene expression. J Virol. 2007;81(20):10950-60. [PubMed ID: 17652396]. https://doi.org/10.1128/JVI.00183-07.
  • 23.
    Bauhofer O, Summerfield A, Sakoda Y, Tratschin JD, Hofmann MA, Ruggli N. Classical swine fever virus Npro interacts with interferon regulatory factor 3 and induces its proteasomal degradation. J Virol. 2007;81(7):3087-96. [PubMed ID: 17215286]. https://doi.org/10.1128/JVI.02032-06.
  • 24.
    Seago J, Hilton L, Reid E, Doceul V, Jeyatheesan J, Moganeradj K, et al. The Npro product of classical swine fever virus and bovine viral diarrhea virus uses a conserved mechanism to target interferon regulatory factor-3. J Gen Virol. 2007;88(Pt 11):3002-6. [PubMed ID: 17947522]. https://doi.org/10.1099/vir.0.82934-0.
  • 25.
    Zare A, Karimi MH, Rashki A, Geramizadeh B, Afshari A, Miri HR, et al. Association of the Interleukin-27 Gene Expression and Hepatitis B Virus Infection in Liver Transplanted Patients. Exp Clin Transplant. 2017;15(5):554-60. [PubMed ID: 26925776]. https://doi.org/10.6002/ect.2015.0243.
  • 26.
    Afshari A, Yaghobi R, Karimi MH, Darbooie M, Azarpira N. Interleukin-17 gene expression and serum levels in acute rejected and non-rejected liver transplant patients. Iran J Immunol. 2014;11(1):29-39. [PubMed ID: 24632586].
  • 27.
    Janfeshan S, Yaghobi R, Eidi A, Karimi MH, Geramizadeh B, Malekhosseini SA, et al. Expression Profile of Interferon Regulatory Factor 1 in Chronic Hepatitis B Virus-Infected Liver Transplant Patients. Exp Clin Transplant. 2016. [PubMed ID: 27310137]. https://doi.org/10.6002/ect.2015.0302.
  • 28.
    Xu Y, Hu Y, Shi B, Zhang X, Wang J, Zhang Z, et al. HBsAg inhibits TLR9-mediated activation and IFN-alpha production in plasmacytoid dendritic cells. Mol Immunol. 2009;46(13):2640-6. [PubMed ID: 19501403]. https://doi.org/10.1016/j.molimm.2009.04.031.
  • 29.
    Momeni M, Zainodini N, Bidaki R, Hassanshahi G, Daneshvar H, Khaleghinia M, et al. Decreased expression of toll like receptor signaling molecules in chronic HBV infected patients. Hum Immunol. 2014;75(1):15-9. [PubMed ID: 24120739]. https://doi.org/10.1016/j.humimm.2013.09.015.
  • 30.
    Vincent IE, Zannetti C, Lucifora J, Norder H, Protzer U, Hainaut P, et al. Hepatitis B virus impairs TLR9 expression and function in plasmacytoid dendritic cells. PLoS One. 2011;6(10). e26315. [PubMed ID: 22046272]. https://doi.org/10.1371/journal.pone.0026315.
  • 31.
    Wang H, Ryu WS. Hepatitis B virus polymerase blocks pattern recognition receptor signaling via interaction with DDX3: implications for immune evasion. PLoS Pathog. 2010;6(7). e1000986. [PubMed ID: 20657822]. https://doi.org/10.1371/journal.ppat.1000986.
  • 32.
    Yu S, Chen J, Wu M, Chen H, Kato N, Yuan Z. Hepatitis B virus polymerase inhibits RIG-I- and Toll-like receptor 3-mediated beta interferon induction in human hepatocytes through interference with interferon regulatory factor 3 activation and dampening of the interaction between TBK1/IKKepsilon and DDX3. J Gen Virol. 2010;91(Pt 8):2080-90. [PubMed ID: 20375222]. https://doi.org/10.1099/vir.0.020552-0.
  • 33.
    Jiang J, Tang H. Mechanism of inhibiting type I interferon induction by hepatitis B virus X protein. Protein Cell. 2010;1(12):1106-17. [PubMed ID: 21213104]. https://doi.org/10.1007/s13238-010-0141-8.
  • 34.
    Kreisel D, Goldstein DR. Innate immunity and organ transplantation: focus on lung transplantation. Transpl Int. 2013;26(1):2-10. [PubMed ID: 22909350]. https://doi.org/10.1111/j.1432-2277.2012.01549.x.
  • 35.
    Afshari A, Yaghobi R, Karimi MH, Darbouy M, Azarpira N, Geramizadeh B, et al. IL-17 mRNA expression and cytomegalovirus infection in liver transplant patients. Exp Clin Transplant. 2015;13 Suppl 1:83-9. [PubMed ID: 25894133].
  • 36.
    Wieland S, Thimme R, Purcell RH, Chisari FV. Genomic analysis of the host response to hepatitis B virus infection. Proc Natl Acad Sci U S A. 2004;101(17):6669-74. [PubMed ID: 15100412]. https://doi.org/10.1073/pnas.0401771101.
  • 37.
    Wieland SF, Chisari FV. Stealth and cunning: hepatitis B and hepatitis C viruses. J Virol. 2005;79(15):9369-80. [PubMed ID: 16014900]. https://doi.org/10.1128/JVI.79.15.9369-9380.2005.
  • 38.
    Guidotti LG, Borrow P, Hobbs MV, Matzke B, Gresser I, Oldstone MB, et al. Viral cross talk: intracellular inactivation of the hepatitis B virus during an unrelated viral infection of the liver. Proc Natl Acad Sci U S A. 1996;93(10):4589-94. [PubMed ID: 8643448].
  • 39.
    Wieland SF, Guidotti LG, Chisari FV. Intrahepatic induction of alpha/beta interferon eliminates viral RNA-containing capsids in hepatitis B virus transgenic mice. J Virol. 2000;74(9):4165-73. [PubMed ID: 10756029].
  • 40.
    Chisari FV, Isogawa M, Wieland SF. Pathogenesis of hepatitis B virus infection. Pathol Biol (Paris). 2010;58(4):258-66. [PubMed ID: 20116937]. https://doi.org/10.1016/j.patbio.2009.11.001.
  • 41.
    Busca A, Kumar A. Innate immune responses in hepatitis B virus (HBV) infection. Virol J. 2014;11:22. [PubMed ID: 24507433]. https://doi.org/10.1186/1743-422X-11-22.
  • 42.
    Alavian SM, Fallahian F, Lankarani KB. The changing epidemiology of viral hepatitis B in Iran. J Gastrointestin Liver Dis. 2007;16(4):403-6. [PubMed ID: 18193122].
  • 43.
    Merat S, Malekzadeh R, Rezvan H, Khatibian M. Hepatitis B in Iran. Arch Iran Med. 2000;3(4):192-201.
  • 44.
    Guo H, Jiang D, Ma D, Chang J, Dougherty AM, Cuconati A, et al. Activation of pattern recognition receptor-mediated innate immunity inhibits the replication of hepatitis B virus in human hepatocyte-derived cells. J Virol. 2009;83(2):847-58. [PubMed ID: 18971270]. https://doi.org/10.1128/JVI.02008-08.
  • 45.
    Pei RJ, Chen XW, Lu MJ. Control of hepatitis B virus replication by interferons and Toll-like receptor signaling pathways. World J Gastroenterol. 2014;20(33):11618-29. [PubMed ID: 25206268]. https://doi.org/10.3748/wjg.v20.i33.11618.
  • 46.
    Zhai Y, Shen XD, O'Connell R, Gao F, Lassman C, Busuttil RW, et al. Cutting edge: TLR4 activation mediates liver ischemia/reperfusion inflammatory response via IFN regulatory factor 3-dependent MyD88-independent pathway. J Immunol. 2004;173(12):7115-9. [PubMed ID: 15585830].
  • 47.
    Testro AG, Visvanathan K, Skinner N, Markovska V, Crowley P, Angus PW, et al. Acute allograft rejection in human liver transplant recipients is associated with signaling through toll-like receptor 4. J Gastroenterol Hepatol. 2011;26(1):155-63. [PubMed ID: 21175809]. https://doi.org/10.1111/j.1440-1746.2010.06324.x.

Similar Articles

5
Apr
2020
Jundishapur Journal of Microbiology

The Role of Autophagy in Interferon/Ribavirin Responders and Non-Responders with Hepatitis C Virus Infection

Fahimeh Abbasi,
Taravat Bamdad,
Abdolkarim Ghadimi-Moghadam,
Hamzeh Chubin,
Marzieh Jamalidoust

Abbasi F, Bamdad T, Ghadimi-Moghadam A, Chubin H, Jamalidoust M. The Role of Autophagy in Interferon/Ribavirin Responders and Non-Responders with Hepatitis C Virus Infection. Jundishapur J Microbiol. 2020;13(3):e92560. doi: https://doi.org/10.5812/jjm.92560

7
Jun
2014

Expression Profiles of Circulating Cytokines, Chemokines, and Immune Cells in Patients With Hepatitis B Virus Infection

Jian Qi Lian,
Xiao Fei Yang,
Rong Rong Zhao,
Yan Yan Zhao,
Yu Li,
Ye Zhang
,et al.

Qi Lian J, Fei Yang X, Rong Zhao R, Yan Zhao Y, Li Y, et al. Expression Profiles of Circulating Cytokines, Chemokines, and Immune Cells in Patients With Hepatitis B Virus Infection. Hepat Mon. 2014;14(6):e18892. doi: https://doi.org/10.5812/hepatmon.18892

23
May
2016

Intrahepatic Toll-Like Receptor 3 in Chronic HBV Infection Subjects: Asymptomatic Carriers, Active Chronic Hepatitis, Cirrhosis, and Hepatocellular Carcinoma

Jia Wen Yin,
Mao Ping Huang,
Bei Zhong

Yin JW, Ping Huang M, Zhong B. Intrahepatic Toll-Like Receptor 3 in Chronic HBV Infection Subjects: Asymptomatic Carriers, Active Chronic Hepatitis, Cirrhosis, and Hepatocellular Carcinoma. Hepat Mon. 2016;16(6):e34432. doi: https://doi.org/10.5812/hepatmon.34432

1
Feb
2017

Higher Serum Levels of Type I Interferon Receptor in Adults with Chronic Hepatitis B Leading to Hepatitis B Surface Antigen Clearance

Ashraf Mohamadkhani,
Sima Besharat,
Golnosh Gol-Jah Rad,
Akbar Pour Dadash Asiabar,
Gholamreza Roshandel,
Akram Pourshams
,et al.

Mohamadkhani A, Besharat S, Gol-Jah Rad G, Pour Dadash Asiabar A, Roshandel G, et al. Higher Serum Levels of Type I Interferon Receptor in Adults with Chronic Hepatitis B Leading to Hepatitis B Surface Antigen Clearance. Jundishapur J Microbiol. 2017;10(3):e41319. doi: https://doi.org/10.5812/jjm.41319

7
Nov
2024
Hepat Mon

Sirtuin 1 Dynamic Interplay of IFI16 and STING Interferon-Stimulated Gene Regulate Hepatitis B Virus Replication

Di Li,
Qing Hua Yu,
Sha Sha Li

Li D, Yu QH, Li SS. Sirtuin 1 Dynamic Interplay of IFI16 and STING Interferon-Stimulated Gene Regulate Hepatitis B Virus Replication. Hepat Mon. 2024;24(1):e145628. doi: https://doi.org/10.5812/hepatmon-145628


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles