Investigation of Common Variations of ABCB4, ATP8B1 and ABCB11 Genes in Patients with Progressive Familial Intrahepatic Cholestasis

Author(s):
Mohammad ZarenezhadMohammad Zarenezhad1, Seyyed Mohsen DehghaniSeyyed Mohsen Dehghani2, Fardad EjtehadiFardad Ejtehadi2, Mohammad Reza FattahiMohammad Reza Fattahi2, Hasan DastsouzHasan Dastsouz3, 4, Majid FardaeiMajid Fardaei4,*, Mohammad Bagher TabeiMohammad Bagher Tabei5
1MD, PhD Candidate, Gastroentrohephatology Research Center, Shiraz University of Medical Sciences, Shiraz, IR Iran
2MD, Gastroentrohephatology Research Center, Shiraz University of Medical Sciences, Shiraz, IR Iran
3Master in Genetic, Department of Medical Genetics, School of Medicine, Shiraz University of Medical Sciences, Shiraz, IR Iran
4PhD, Department of Medical Genetics, Bioinformatics and Computational Biology Research Center, School of Medicine, Shiraz University of Medical Sciences, Shiraz, IR Iran
5PhD, Department of Medical Genetics, School of Medicine, Shiraz University of Medical Sciences, Shiraz, IR Iran

Hepatitis Monthly:Vol. 17, issue 2; e43500
Published online:Feb 04, 2017
Article type:Research Article
Received:Nov 01, 2016
Accepted:Jan 29, 2017
How to Cite:Zarenezhad M, Dehghani SM, Ejtehadi F, Fattahi MR, Dastsouz H, et al. Investigation of Common Variations of ABCB4, ATP8B1 and ABCB11 Genes in Patients with Progressive Familial Intrahepatic Cholestasis. Hepat Mon. 2017;17(2):e43500. doi: https://doi.org/10.5812/hepatmon.43500

Abstract

Background:

Progressive familial intrahepatic cholestasis (PFIC) is a heterogeneous group of hepatic disorders that can progress rapidly, leading to cirrhosis and death due to liver failure. Mutations and variations in three genes, including ATP8B1, ABCB11, and ABCB4, have been reported to be the main genetic cause of three subtypes of this disorder including PFIC1, PFIC2, and PFIC3, respectively.

Objectives:

Therefore, the aim of this study was to investigate more common mutations and variations associated with PFIC considering clinical and Para-clinical features of the disease.

Methods:

Thirty-five unrelated patients with PFIC from the south of Iran were selected randomly among all PFIC patients referring to Namazi hospital, affiliated to Shiraz University of Medical Sciences. Genomic DNA was extracted from the peripheral blood lymphocytes. Sequences related to these variations were then amplified by PCR in the 35 cholestasis patients and analyzed by Sanger® sequencing.

Results:

The results showed that there was no variation in interest exon of ABCB4. Moreover, in ATP8B1, there was no prevalent mutation and only an unknown significant variation (c.*1101 + 366G > A) was found. However, in the ABCB11 gene, different variations were found including c.1434 + 174G > A, c.1434 + 70C > T, c.1331T > C (p.Val444Ala, a common variant proposed to be associated with cholestasis), c.1309-93G > A, c.1309-165C > T. Also, 11 and 13 cases showed heterozygote and homozygote, respectively, for V444A variation of the ABCB11 gene.

Conclusions:

The allele frequency of V444A in this study was 52.8%. This variation has been previously implicated with higher frequencies in ICP and DIC than normal subjects, suggesting that this variation may become disease-relevant in certain conditions.

1. Background

Progressive familial intrahepatic cholestasis (PFIC) is a heterogeneous class of autosomal recessive hepatic disorders that begins in the neonatal period or first year of life and usually progresses to cirrhosis within the first decade of life (1, 2). PFIC can progress rapidly and result in cirrhosis during infancy, leading to death due to liver failure at ages usually between infancy and adolescence (1, 2).
Until now, genetic and molecular studies have identified three subtypes of PFIC, which include PFIC1 (the former Byler disease), PFIC2, and PFIC3 as a result of mutations in genes involved in bile formation. PFIC1 is due to ATP8B1 gene mutations, which can cause the milder phenotype (3). PFIC2 is caused by mutations in the ABCB11 gene (4, 5). This gene which is located on human chromosome 2q24 encodes the ATP-dependent canalicular bile salt export pump (BSEP) in liver and the loss of BSEP function responsible for the decreased biliary bile salt secretion resulting in the accumulation of bile salts inside the hepatocyte and finally severe hepatocellular cholestasis (6). PFIC3 results from diseases causing variants in the ABCB4 gene located on chromosome 7q21. This gene is translated into the protein MDR3 with an essential role in biliary phospholipid (phosphatidylcholine) excretion across the canalicular membrane (7-9). Bile from patients with PFIC3 is not inactivated by phospholipids (with very low concentrations of phospholipid) that results in bile canaliculi and biliary epithelium injuries, leading to cholangitis and cholestasis cholestatic liver disease (10). Given the fact that different ATP8B1, ABCB11, and ABCB4 variants have been associated with cholestasis, we made an attempt to investigate the most common variants reported in these genes among 35 patients with cholestasis.

2. Methods

2.1. Patients

Thirty-five unrelated patients with cholestasis from the south of Iran were enrolled in this study. All cholestasis patients were diagnosed by a group of gastroenterohepatology specialists in gastroenterohepatology ward of Namazi hospital, affiliated to Shiraz University of Medical Sciences, on the basis of characteristic symptoms such as jaundice, dark urine, light-colored stools, and generalized itchiness. The patients were selected randomly. All the patients gave informed consent before undergoing genetic analysis for common variations of ATP8B1, ABCB4, and ABCB11. Three-milliliter whole-blood samples were collected from the patients, drawn into EDTA tubes, and stored at -20ºC until use.

2.2. Preparation of Genomic DNA

Genomic DNA was extracted from the peripheral blood lymphocytes by QIAamp DNA Blood Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. The genomic DNA concentration was measured by NanoDrop (ND1000, USA) and stored at - 20ºC until use.

2.3. PCR and Sequencing

Sequences covering the variations of ATP8B1 (I661T, exon 18), ABCB4 (p.R652G, exon 16), and ABCB11 (p.V444A, exon 13) in 35 cholestasis patients were amplified by PCR primers given in Table 1. These primer pairs were designed and evaluated on the basis of the ATP8B1, ABCB4, and ABCB11 reference genomic sequences (ENSEMBLE) using NCBI-BLAST, UCSC (BLAT and In Silico PCR) and Allele ID 7.5 (Table 1). The total volume of the PCR was 50 μL containing 1 μL of each primer (20 pmol/μL), 1 μL DNA template (50 - 200 ng), 25 μL TEMPase Hot Start 2x Master Mix Blue (Ampicon, A290806), and 22 μL dH2O. The PCRs were carried out according to Amplicon TEMPase Hot Start protocol and programs given in Table 1. Ten microliters of the PCR products were visualized on 2% agarose gel containing SYBR Safe.
Table 1. Primers and PCR Protocols Used for Amplification of the Interest Exons of ATP8B1 (NI661T), ABCB4 (R652G) and, ABCB11 (V444A) Genes
Gene (Interest Variant)Primer SequencePCR ProgramPCR Product
ATP8B1 (NI661T)Forward: GGATGATAAAGCCAGACCTTGT95°C for 15 min, 35 cycles for: 95°C, 30 sec, 64°C, 30 sec, 72°C, 20 sec, and final extension 72°C, 7 min502 bp
Reverse: GTGCCAGTGTCAAATGCTGAA
ABCB4 (R652G)Forward: TCCTTGATTGAGAAGCAGTTAG95°C, 15 min, 35 cycles for: 95°C for 30 sec, 59°C for 30 sec, 72°C for 30 sec, and final extension 72°C for 7 min571 bp
Reverse: GCATCTCAGCGTAAAGACTAC
ABCB11 (V444A)Forward: TCTTGGTCATGGCTCTCATouch Down PCR, 95°C for 15 min, 20 cycles for: 95°C for 30 sec, 67°C for 30 sec (-0.5°C per cycle), 72°C for 20 sec, 15 cycles for:95°C 30 sec, 58°C 30 sec, 72°C for 25 sec, and final extension 72°C for 7 min626 bp
Reverse: ATCACTGACTGAAATGTTGC

2.4. DNA Sequencing

PCR products of interest exons and exon-intron boundaries of three mentioned genes in our 35 patients were analyzed by DNA sequencing. Sanger sequencing data were analyzed using NCBI BLAST and Codon Code Aligner software.

3. Results

A total of 35 patients (70 alleles) with progressive intrahepatic cholestasis were studied for detection of common variants associated with this disorder in interest exons of ATP8B1 (I661T), ABCB4 (p.R652G), and ABCB11 (p.V444A). There was not identified any variation in interest exon of ABCB4. Also, in ATP8B1, a prevalent mutation was not identified, and only an unknown significant variation (c.*1101 + 366G > A) was identified in patients 4, 9, 15, 21, 26, and 29 as heterozygote and patient 14 as homozygote. However, in ABCB11 gene, different variations were found including c.1434 + 174G > A, c.1434 + 70C > T, c.1331T > C (p.Val444Ala, common variant), c.1309-93G > A, and c.1309-165C > T. Since among these variations, only p.Val444Ala is important due to its susceptibility and association with intrahepatic cholestasis, its distribution in our patients are given in Table 2.
Table 2. Clinical and Para Clinical Sings of the Patients and Distribution of c.1331T > C (p.Val444Ala) in ABCB11 Gene among Our Patients
Case No. ABCB11ABCB4ATP8B1Clinical SignsPara Clinical FindingsTreatment
1.1NDJaundice, Itching, Bleeding Tendency, Fever, Tea Color UrineEnlarged Liver, Normal Echo, Intracellular and Intracalcinular Cholestasis, FibrosisLT
2.Hom.NDNDpruritus, Ascites, GI bleeding, encephalopathyincreased liver echo, cholestasis, giant cell formation, cirrhosisLT
3.NDNDNDPruritus, clay stool, itching, jaundice, hepatomegaly, irritabilityheterogeneous echo of the liver, enlarged spleen, destruction of lobular and vascular architecture, nodule formation, cirrhosisLT
4.Het.NDHet.poor growth, pruritus, encephalopathy, ascites, GI bleeding,enlarged liver, coarse echo, chronic hepatic parenchymal damage, focal steatosis and ballooning degeneration, fibrosisLT
5.Hom.NDNDJaundiceincreased echo, enlarged liver, enlarged spleen, cirrhosisLT
6.Het.NDNDpruritus, vomiting, diarrhea, fatty stool, tea color urine hepatomegaly, itchingenlarged liver, enlarged spleen, fibrosis, cirrhosisLT
7.Hom.NDNDjaundice, icteric sclera, itchingliver coarse echoLT
8.Het.NDNDJaundice, pruritus, encephalopathyliver prominent size, enlarged spleen, cirrhosis, giant cell hepatitisLT
9.Het.NDHet.JaundiceElevated liver enzymes, heterogeneous echo, relative destruction of lobular and vascular architecture, fibrosisLT
10.Hom.NDNDJaundiceElevated liver enzymes, splenomegaly, hepatomegaly, hyperechoic lesion, spotty necrosis, infiltration of lymphocytes, fibrosisLT
11.NDNDNDJaundiceenlarged liver, increased echo of hepatic biliary tree, infiltration of inflammatory cells, fibrosisLT
12.Hom.NDNDJaundice, Yellowish Skin, encephalopathy, GI bleeding, Ascites, Pruritusenlarged spleen, inhomogeneous echo, cirrhosisLT
13.Hom.NDNDPruritusmucosal thickening of Gall bladder, Ascites, fibrosisLT
14.Hom.NDHom.Pruritus, Pruritus Yellow Skin, And Sclera, Itching WoundAltered liver enzymesLT
15.Hom.NDHom.Pruritus, Ascites Jaundice, Encephalopathyirregular outline of liver, coarse echo, spleen prominent size ascites pleural effusion, Cirrhosis, chronic cholecystitisLT
16.NDNDNDNo data was availableNo data was available-
17.Hom.NDNDJaundiceenlarged liver, inhomogeneous echoLT
18.Het.NDNDItching, Jaundice, anorexia, pruritus encephalopathy, GI bleedingenlarged liver, Gall stone, duct proliferation, inflammation, Rosette formation, Feathery changesLT
19.NDNDNDItching, intractable pruritusAltered liver enzymesLT
20.NDNDNDItching, severe pruritusAltered liver enzymes, increased liver echoLT
21.Hom.NDHet.Jaundice, icterusliver prominent size, hyperechoic liver, spleen prominent size, Extensive Fibrosis, portal fibrosis, ductular proliferation, cholestasisLiver biopsy
22.Hom.NDNDJaundice, icterusElevated liver enzymes, Liver coarse echo, enlarged spleen, destruction of lobular and vascular architecture, nodule formation, fibrosisLT
23.Hom.NDNDJaundice, pruritus, encephalopathy, ascites, GI bleeding, palmar erythema, GI bleedingpatent spleen, giant cell formation, feathery degeneration, fibrosisLT
24.NDNDNDItching, Jaundice, generalized pruritusenlarged liver with homogenous echoBD, LT
25.NDNDNDItching, prurituscholestatic rosettes, fibrosisLT
26.NDNDHet.Altered liver enzymesirregular capsule, coarse echo, multifocal dilation of biliary ducts, cirrhosisLT
27.Het.NDNDItching, Jaundice, fever, tea color urine, GI bleeding, EncephalopathyEnlarged LiverLT
28.Het.NDNDItching, Jaundice, icteric, sever pruritus, irritability, jaundice, ecchymosis, bleeding tendencyenlarged liver, inhomogeneous echoLT
29.Het.NDHet.Jaundice, bleeding tendency,splenomegaly, hepatomegaly, relative destruction of lobular and vascular architecture, fibrosisLT
30.NDNDNDJaundice, yellowish skin, pruritusenlarged liver, coarse echoLT
31.Het.NDNDprolonged jaundicecholestatic rosettes, fibrosisLT
32.Hom.NDNDjaundicehepatomegaly, elevated LFTLT
33.NDNDNDNo data was availableNo data was available-
34.NDNDNDNo data was availableNo data was available-
35.Het.NDNDsever itching, encephalopathy, ascites, GI bleedingCirrhosis, increased echo, enlarged spleenLT

Abbreviations: BD: Biliary diversion; LT, Liver transplantation; Het, heterozygote; Hom, homozygote; ND, Non-detected.

It was found that there were 11 and 13 cases of heterozygote and homozygote, respectively, for V444A variation of ABCB11 gene. As mentioned above, this change results in a reduction in the quantity of BSEP protein in liver cells and may be associated with cholestasis in certain conditions, such as pregnancy and the use of ethinylestradiol and levonorgestrel. Among 35 patients involved in this study, 10 cases showed no mutation or variation in the investigated exons of the three genes and other exons should be investigated for their genetic origin. All data are given in Table 2.
Clinical presentation and signs observed in our patients were jaundice, itching, bleeding tendency, fever, tea-color urine, pruritus, ascites, gastrointestinal bleeding, encephalopathy, and itching wounds. Their Para clinical findings on the basis of ultrasonography and histopathological examination indicated enlarged liver, inhomogeneous liver echo, spleen prominent size ascites pleural effusion, cirrhosis, chronic cholecystitis, fibrosis, splenomegaly, hepatomegaly, giant cell formation, and intracalcinular cholestasis (Table 2).

4. Discussion

Molecular genetic testing to identify mutations and variations associated with cholestasis in ATP8B1, ABCB4, and ABCB11 genes is important to confirm PFIC2 diagnosis. Different mutations in these genes have been identified in Asian population (11, 12). The majority of them are different from those identified in other populations. Prevalent mutations that have been reported in Europe were not detected in other regions such as China. Therefore, mutations in these genes may be ethnicity-specific (13)
V444A is a highly prevalent variant of ABCB11 and its allele frequency has been reported in Japanese and Caucasian populations (14). The allele frequency of V444A in the current study was 52.8%. This variation has been previously implicated with higher frequencies in ICP and DIC than normal subjects, suggesting that this variation may become disease relevant in certain conditions (15, 16). However, further larger-scale studies are required to fully uncover the role of V444A variant.
Bile salt export pump (BSEP) is highly conserved during vertebrate evolution, and its expression is inhibited by PFIC type II mutations (17). PFIC type 2 is due to mutations in ABCB11, the gene encoding the BSEP protein. In our study, most of the patients (62.85%) had homozygote mutations in ABCB11 gene. Jaundice, itching, bleeding tendency, fever, tea-color urine, enlarged liver, normal echo, intracellular and intracalcinular cholestasis, cholestasis, pruritus, ascites, GI bleeding, encephalopathy, increased liver echo, cholestasis, giant cell formation fibrosis, and cirrhosis were some of the clinical and Para clinical features of the PFICII in our patients.
ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC) (18).
About 20% of our cases had homozygote and heterozygote mutations in their ATP8B1 genes. However, most of them had also mutations in their ABCB11 gene. Jaundice, poor growth, pruritus, encephalopathy, ascites, GI bleeding, enlarged liver, coarse echo, chronic hepatic parenchymal damage, focal steatosis and ballooning degeneration, fibrosis as well as elevated liver enzymes, heterogeneous echo, relative destruction of lobular and vascular architecture, fibrosis, splenomegaly, hepatomegaly, relative destruction of lobular and vascular architecture were clinical and Para clinical findings of the disease in our patients confirmed by the detection of the mutations.
Different molecular methods have been used to investigate mutations in genes associated with cholestasis such as single-strand conformation polymorphisms (SSCP) (19), denaturing high performance liquid chromatography (DHPLC), and DNA sequencing (20). The gold standard is DNA sequencing since it can reveal mutations and variations across three genes with 28 exons for each. However, this method is very expensive. Therefore, the current study tried to investigate common mutations and variations associated with cholestasis in three specific genes and their main exons.
Our study showed that while two common mutations were not identified in our patients, the other common variant, V444A, that previously has been proposed to be associated with cholestasis in certain condition such as pregnancy and the use of ethinylestradiol and levonorgestrel, was identified in a high frequency (37 chromosomes out of 70, 52.8%). The common V444A variant can be investigated in control samples to be concluded for its susceptibility and association with intrahepatic cholestasis in our patients since this variant leads to a reduction in the quantity of BSEP protein in liver cells and can be a good indicator in these patients (15).
In conclusion, the current study investigated common mutations and variations of ATP8B1, ABCB4, ABCB11 genes. V444A was a highly prevalent variation found in ABCB11 in the study. However, it is not fully clear that if they are associated with pediatric cholestatic diseases. More studies should be conducted to investigate this variation, identify the molecular mechanism of ABCB11 product and BSEP and therefore, determine its usefulness in the personalized management of special patients.
There are so many studies that have evaluated the variations in ABCB4, ABCB11 and ATP8B1 genes separately. However, no study investigated the mutations of three genes in each study patient. This is considerable because we found that a large number of our cases (17.14%) had mutations in both ABCB11 and ATP8B1 genes.
One of the limitations of the study was to find patients who voluntarily agreed to participate in this study and donate blood samples. On the other hand, more developed sequencing of related genes, for example whole exon sequencing, was needed to find underlying mutations in cases with no detected mutation using sanger sequencing. In our study, some of the patients had no mutation in interest areas of three mentioned genes, so they should be evaluated by further molecular investigations to find molecular basis of the disease.

Acknowledgments

Footnotes

References

  • 1.
    Jacquemin E. Progressive Familial Intrahepatic Cholestasis. Clin Liver Dis. 2000;4(4):753-63. https://doi.org/10.1016/s1089-3261(05)70139-2.
  • 2.
    Davit-Spraul A, Gonzales E, Baussan C, Jacquemin E. Progressive familial intrahepatic cholestasis. Orphanet J Rare Dis. 2009;4:1. [PubMed ID: 19133130]. https://doi.org/10.1186/1750-1172-4-1.
  • 3.
    Baussan C, Cresteil D, Gonzales E, Raynaud N, Dumont M, Bernard O, et al. Genetic cholestatic liver diseases: the example of progressive familial intrahepatic cholestasis and related disorders. Acta Gastroenterol Belg. 2004;67(2):179-83. [PubMed ID: 15285575].
  • 4.
    Thompson R, Strautnieks S. BSEP: function and role in progressive familial intrahepatic cholestasis. Semin Liver Dis. 2001;21(4):545-50. [PubMed ID: 11745042]. https://doi.org/10.1055/s-2001-19038.
  • 5.
    Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet. 1998;20(3):233-8. [PubMed ID: 9806540]. https://doi.org/10.1038/3034.
  • 6.
    Varma S, Revencu N, Stephenne X, Scheers I, Smets F, Beleza-Meireles A, et al. Retargeting of bile salt export pump and favorable outcome in children with progressive familial intrahepatic cholestasis type 2. Hepatology. 2015;62(1):198-206. [PubMed ID: 25847299]. https://doi.org/10.1002/hep.27834.
  • 7.
    Jacquemin E. Role of multidrug resistance 3 deficiency in pediatric and adult liver disease: one gene for three diseases. Semin Liver Dis. 2001;21(4):551-62. [PubMed ID: 11745043]. https://doi.org/10.1055/s-2001-19033.
  • 8.
    Espinosa Fernández MG, Navas López VM, Blasco Alonso J, Sierra Salinas C, Barco Gálvez A. Colestasis intrahepática familiar progresiva tipo 3. Defecto de MDR3. Anales de Pediatría. 2008;69(2):182-4. https://doi.org/10.1157/13124903.
  • 9.
    Delaunay JL, Durand-Schneider AM, Dossier C, Falguieres T, Gautherot J, Davit-Spraul A, et al. A functional classification of ABCB4 variations causing progressive familial intrahepatic cholestasis type 3. Hepatology. 2016;63(5):1620-31. [PubMed ID: 26474921]. https://doi.org/10.1002/hep.28300.
  • 10.
    Jacquemin E, De Vree JM, Cresteil D, Sokal EM, Sturm E, Dumont M, et al. The wide spectrum of multidrug resistance 3 deficiency: from neonatal cholestasis to cirrhosis of adulthood. Gastroenterology. 2001;120(6):1448-58. [PubMed ID: 11313315].
  • 11.
    Treepongkaruna S, Gaensan A, Pienvichit P, Luksan O, Knisely AS, Sornmayura P, et al. Novel ABCB11 mutations in a Thai infant with progressive familial intrahepatic cholestasis. World J Gastroenterol. 2009;15(34):4339-42. [PubMed ID: 19750581].
  • 12.
    Goto K, Sugiyama K, Sugiura T, Ando T, Mizutani F, Terabe K, et al. Bile salt export pump gene mutations in two Japanese patients with progressive familial intrahepatic cholestasis. J Pediatr Gastroenterol Nutr. 2003;36(5):647-50. [PubMed ID: 12717091].
  • 13.
    Ananthanarayanan M, Li Y. PFIC2 and ethnicity-specific bile salt export pump (BSEP, ABCB11) mutations: where do we go from here? Liver Int. 2010;30(6):777-9. [PubMed ID: 20214736]. https://doi.org/10.1111/j.1478-3231.2010.02227.x.
  • 14.
    Lang T, Haberl M, Jung D, Drescher A, Schlagenhaufer R, Keil A, et al. Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export pump (ABCB11). Drug Metab Dispos. 2006;34(9):1582-99. [PubMed ID: 16763017]. https://doi.org/10.1124/dmd.105.008854.
  • 15.
    Meier Y, Zodan T, Lang C, Zimmermann R, Kullak-Ublick GA, Meier PJ, et al. Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump. World J Gastroenterol. 2008;14(1):38-45. [PubMed ID: 18176959].
  • 16.
    Lang C, Meier Y, Stieger B, Beuers U, Lang T, Kerb R, et al. Mutations and polymorphisms in the bile salt export pump and the multidrug resistance protein 3 associated with drug-induced liver injury. Pharmacogenet Genomics. 2007;17(1):47-60. [PubMed ID: 17264802]. https://doi.org/10.1097/01.fpc.0000230418.28091.76.
  • 17.
    Cai SY, Wang L, Ballatori N, Boyer JL. Bile salt export pump is highly conserved during vertebrate evolution and its expression is inhibited by PFIC type II mutations. Am J Physiol Gastrointest Liver Physiol. 2001;281(2):G316-22. [PubMed ID: 11447010].
  • 18.
    van der Woerd WL, Mulder J, Pagani F, Beuers U, Houwen RH, van de Graaf SF. Analysis of aberrant pre-messenger RNA splicing resulting from mutations in ATP8B1 and efficient in vitro rescue by adapted U1 small nuclear RNA. Hepatology. 2015;61(4):1382-91. [PubMed ID: 25421123]. https://doi.org/10.1002/hep.27620.
  • 19.
    Strautnieks SS, Byrne JA, Pawlikowska L, Cebecauerova D, Rayner A, Dutton L, et al. Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families. Gastroenterology. 2008;134(4):1203-14. [PubMed ID: 18395098]. https://doi.org/10.1053/j.gastro.2008.01.038.
  • 20.
    Liu LY, Wang ZL, Wang XH, Zhu QR, Wang JS. ABCB11 gene mutations in Chinese children with progressive intrahepatic cholestasis and low gamma glutamyltransferase. Liver Int. 2010;30(6):809-15. [PubMed ID: 19845854]. https://doi.org/10.1111/j.1478-3231.2009.02112.x.

Similar Articles

2
Aug
2016

Progressive Familial Intrahepatic Cholestasis and its Subtypes: The First Report From Iran

Parnia Torfenejad,
Bita Geramizadeh,
Mahmoud Haghighat,
Seyed Mohsen Dahghani,
Mojgan Zahmatkeshan,
Naser Honar
,et al.

Torfenejad P, Geramizadeh B, Haghighat M, Dahghani SM, Zahmatkeshan M, et al. Progressive Familial Intrahepatic Cholestasis and its Subtypes: The First Report From Iran. Inn J Pediatr. 2016;26(6):e6497. doi: https://doi.org/10.5812/ijp.6497

15
Oct
2017

The Identification of Two New ABCB11 Gene Mutations and the Treatment Outcome in a Young Adult with Benign Recurrent Intrahepatic Cholestasis: A Case Report

Haibing Gao,
Shenglong Lin,
Xujiang Lv,
Huaxi Ma,
Xiangmei Wang,
Jiankai Fang
,et al.

Gao H, Lin S, Lv X, Ma H, Wang X, et al. The Identification of Two New ABCB11 Gene Mutations and the Treatment Outcome in a Young Adult with Benign Recurrent Intrahepatic Cholestasis: A Case Report. Hepat Mon. 2017;17(10):e55087. doi: https://doi.org/10.5812/hepatmon.55087

17
Oct
2021
Iran J Pediatr

Liver Transplantation in Progressive Familial Intrahepatic Cholestasis with Normal Gamma-Glutamyl Transferase: Evaluation of Post-transplant Steatosis and Steatohepatitis

Mohammad Hossein Anbardar,
Seyed Mohsen Dehghani,
Maryam Poostkar,
Seyed Ali Malek-Hosseini

Anbardar MH, Dehghani SM, Poostkar M, Malek-Hosseini SA. Liver Transplantation in Progressive Familial Intrahepatic Cholestasis with Normal Gamma-Glutamyl Transferase: Evaluation of Post-transplant Steatosis and Steatohepatitis. Inn J Pediatr. 2021;31(5):e117380. doi: https://doi.org/10.5812/ijp.117380

27
Dec
2020

The Frequency of Genetic Alleles of Alpha-1 Antitrypsin in Infants and Children with the Cholestatic Idiopathic Hepatic Disease in Khorasan Razavi- Iran

Sara Gholami,
Saeedeh Vahedi,
Hamidreza Kianifar,
Tayebeh Hamzehloei

Gholami S, Vahedi S, Kianifar H, Hamzehloei T. The Frequency of Genetic Alleles of Alpha-1 Antitrypsin in Infants and Children with the Cholestatic Idiopathic Hepatic Disease in Khorasan Razavi- Iran. Shiraz E-Med J. 2021;22(1):e95872. doi: https://doi.org/10.5812/semj.95872

21
Jul
2013

Alpha 1 Antitrypsin Deficiency in Infants with Neonatal Cholestasis

Maryam Monajemzadeh,
Reza Shahsiah,
Mohammad Vasei,
Parin Tanzifi,
Nima Rezaei,
Mehri Najafi
,et al.

Monajemzadeh M, Shahsiah R, Vasei M, Tanzifi P, Rezaei N, et al. Alpha 1 Antitrypsin Deficiency in Infants with Neonatal Cholestasis. Inn J Pediatr. 2013;23(5):. doi:


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles