Antibody against Interferon-α 2b in Serum of the Patients with Chronic Hepatitis C and its Clinical Significance: A Clinical Trial

Author(s):
wangjian wangjianwangjian wangjian, Wang PingpingWang Pingping, Xiang GuijuXiang Guiju, wangjian wangjianwangjian wangjian1,*, Wang PingpingWang Pingping1, Xiang GuijuXiang Guiju1
1Department of Aetiology and Immunology, Medical College, Anhui University of Science and Technology, Huainan 232001, Anhui, China
*Corresponding Author: Department of Aetiology and Immunology, Medical College, Anhui University of Science and Technology, Huainan 232001, Anhui, China Email: [email protected]

Hepatitis Monthly:Vol. 9, issue 2; e92963
Published online:May 31, 2009
Article type:Research Article
Received:May 05, 2019
Accepted:May 31, 2009
How to Cite:wangjian W, Pingping W, Guiju X, wangjian W, Pingping W, et al. Antibody against Interferon-α 2b in Serum of the Patients with Chronic Hepatitis C and its Clinical Significance: A Clinical Trial. Hepat Mon. 2009;9(2):e92963. doi:

Abstract

suppresses HCV replication are not well-known; only limited benefits are achieved with the therapy because the virus in turn, directs some mechanisms to resist the host IFN-α response. The present study was undertaken to determine the therapeutic effects of IFN-α 2b and to measure the serum level of antibody against IFN-α 2b (anti-IFN-α 2b) after treatment with IFN-α 2b in patients with chronic hepatitis C.

Methods: The levels of HCV antibody (anti-HCV), HCV-RNA and anti-IFN-α 2b immunoglobulin G (IgG) in serum of 94 patients with chronic hepatitis C who were treated with IFN-α 2b (three 3-MU injections per week for 3 months), were measured in different courses of treatment.

Results: The total negative rates for anti-HCV and HCV-RNA were 33% (31/94) and 38% (36/94) in patients treated with IFN-α 2b, respectively. The rates for those treated with routine medications were 10% (4/40), 15% (6/40), respectively (P<0.01). After the first, second and third course of treatment with IFN-α 2b, the negative rates of anti-HCV, HCV-RNA in serum were 0% (0/94), 15% (14/94) and 21% (20/94), 23% (22/94) and 33% (31/94), 38% (36/94), respectively. After the treatment with IFN-α 2b, the total positive rate of anti-IFN-α 2b IgG was 5% (5/94). There was no significant difference between the two treatment groups (P>0.05). Among them, after treatment with IFN-α 2b for three, six and 12 months, the positive rates of anti-IFN-α 2b IgG were 0% (0/94), 2% (2/94), 5% (5/94), respectively. The productive ability of anti-IFN-α2b IgG was similar during the different courses of treatment with IFN-α 2b (P>0.05).

Conclusions: IFN-α 2b has curative effect for patients with chronic hepatitis C and its therapeutic efficacy is better than that of routine treatments. Although IFN-α 2b has certain antigenicity, anti-IFN-α 2b IgG production is seen in only a few of patients during the course of treatment; the restrain effect of anti-IFN-α 2b IgG on the further treatment with IFN-α 2b is weak.

Fulltext

Introduction
Viral hepatitis C is an important and common infectious disease in China. It is a health burden to our people and can become chronic easily. Conservative figures indicate that greater than 170 million people are persistently infected with hepatitis C virus (HCV) worldwide. Epidemiologic studies have identified the virus as a major cause of chronic hepatitis and liver disease in human. Infection with HCV is currently treated with alpha interferon (IFN-a). Although the treatment outcome is variable among the six major HCV genotypes, only about half of all the treated patients respond to the therapy, suggesting that the virus encodes proteins that may directly or indirectly attenuate the antiviral actions of IFN-a. Although the mechanisms of IFN-a action against HCV replication have not yet been completely known, several recent studies suggest that that IFN-a has a better effect in the treatment of chronic hepatitis C. After treatment with IFN-a, the duplication of HCV in serum is restrained, its transaminase activity in serum is decreased, and the liver function of the patient is recovered (1-3). At least three distinct cellular pathways of translational control are responsive to IFN-a and virus infection; those include the 2'-5' oligoadenylate synthetase (2'-5' OAS)/RNase L pathway, the protein kinase R (PKR)-eukaryotic initiation factor 2 alpha subunit (eIF2) pathway, and the P56-eIF3 pathway (4).
IFN-a 2b, a new antiviral medicine, has a better effect on immunoregulation, antiviral immunity and immune clearance of virus (5-11). After subcutaneous administration, IFN-a specifically binds to high-affinity receptors at the surface of target cells. As IFN-a binds to surface receptors of immune cells, it has multiple immunomodulatory effects. IFN-a binding to various cells and induces numerous proteins and enzymatic pathways involved in establishing a non-virus specific antiviral state through distinct but complementary mechanisms. Specific IFN-a binding site to human hepatocytes and subsequent activation of IFN-a-induced genes leading to the establishment of an antiviral state have not yet been documented (12, 13). We conducted this study to determine the curative effect of IFN-a 2b and to measure the level of antibody against IFN-a 2b (anti-IFN-a 2b) during the treatment with IFN-a 2b and its influence on the further treatment of patients with IFN-a 2b.
Materials And Methods
Materials
Ninety-four patients with chronic hepatitis C (66 men and 28 women), aged between 22 and 56 years (mean: 34.5), were selected from the Department of Infectious Diseases of the Second Miner's Hospital of Huainan, the Department of Infectious Diseases of the First People's Hospital of Huainan, the Department of Infectious Diseases of Chaoyang Hospital of Huainan from June 2000 to December 2001. The clinical diagnosis of chronic hepatitis C was based on the modified diagnosis criteria being affirmed on the Chinese Viral Hepatitis Conference in Xian (2000). The immunoglobulin G antibody of HCV (anti-HCV IgG) or anti-HCV IgM in serum of patients was identified by enzyme-linked immunosorbent assay (ELISA); the HCV-RNA in serum was detected by reverse transcriptase polymerase chain reaction (RT-PCR). All the sera taken from patients with chronic hepatitis C had been found clear from co-infection with hepatitis A, B, D, E and human immunodeficiency virus (HIV) viruses. None of them had been treated with immunosuppressants for more than one year.
IFN-a 2b was produced by Anke Biology, High Science and Technology Company of Anhui Province. One course of the treatment consisted of three months; the total course of treatment was one year. Treatment with IFN-a 2b included three 3-MU intramuscular injection of the drug per week. Before and after the treatment, the level of transaminase, anti-HCV, HCV-RNA and anti-IFN-a 2b IgG in serum were measured. A group of 40 (27 male and 13 female) patients with chronic hepatitis C were served as the control group. They aged from 24 to 60 (mean: 36.2) years ad were treated with routine medications. The total of 20 normal blood donors were also included in the study as normal controls (14 men, and 6 women); they aged from 20 to 36 (mean: 24.3) year; their ALT was normal. They also had no active infection with hepatitis A, B, C, D, E, and had received no treatment with immunomodulator. All participants provided informed consent.
Reagent and instrument
The diagnostic ELISA kit for measurement of anti-IFN-a 2b was purchased from Hepatology Institute of Beijing Medical University, Centre of Study and Production of Diagnostic Reagent of Hepatitis of Beijing, No: 991215, 000620, 010310. The ELISA kits used for the quantitative measurement of anti-HCV was purchased from Huamei Biologic Engineering Company of Shanghai, No: 0000415. The diagnostic reagents for measurement of HCV-RNA with RT-PCR were purchased from Zhongya Gene Institute of Shanghai, No: 000520, 010114, 010722. The instruments of automatic enzyme-linked immune assay (EXL808) and automatic microplate washer (ELX-50) were purchased from Bio-Tek Co., USA. The quantitative PCR instrument (Takara-2000) was purchased from Takara Co., Japan.
Methods
Detection of anti-IFN-a 2b IgG in serum: Three mL of fasting venous blood was taken from patients with chronic hepatitis C, before and after
the treatment, and put in a sterile Eppendorf test tube. After the fresh serum of the patients being isolated by routine method, the anti-IFN-a 2b IgG in serum of the patients was measured. Polystyrene 96-well plates were coated with specific antigen of HCV, diluted in carbonate buffer, as capture antigens. The specific antibodies bound horseradish peroxidases were visualized with tetramethylbenzidine and H2O2 diluted in sodium acetate buffer at pH 6.0. The color reaction was stopped by addition of 1.2 mole of H2SO4; the absorbance was read at 450 nm. The concentration of antibodies against anti-IFN-a 2b was derived from the standard curves using standard samples in the kits. The controls of anti-IFN-a 2b with two pores of blank, two pores of negative, two pores of positive were made each time. The total optical density (OD) was detected by an automated enzyme-linked immune assay (EXL808) (450 nm) with every titer of OD being recorded for two times. A "positive" result was that the average titer of OD of sample ≥ (0.15 + the average titer of OD of "negative" control).
Detection of anti-HCV in serum: Before and after each course of the treatment, the venous blood (3 mL) of patients with chronic hepatitis C were collected in the morning and put in a sterile Eppendorf test tube. After the fresh serum of the patients was isolated by routine method, the anti-HCV in serum of patients was detected. Polystyrene 96-well plates were coated with different anti-HCV McAb, diluted in carbonate buffer, as capture antibodies. Bound horseradish peroxidase was visualized with tetramethylbenzidine and H2O2 diluted in sodium acetate buffer at pH 6.0. The color reaction was stopped by addition of 1.2 mole of H2SO4; the absorbance was read at 450 nm. The concentration of antibodies against HCV was derived from the standard curves using standard samples in the kits. The controls of anti-HCV with two pores of blank, two pores of negative, two pores of positive were made each time. Every titer was measured twice by EXL808 (Bio-Teck) analysis instrument and the final average OD of titer was calculated. A "positive" result was that the average titer of OD of sample divided by the average titer of OD of "negative" control ≥ 2.1.
Detection of HCV-RNA in serum: The controls of HCV-RNA with one negative pore, and one positive pore were made for every detection. The HCV-RNA in serum was isolated with equal quantity routine extract liquid. The primers were selected from the 5'-non-coded region and part of C region of HCV. The sequence of primers of duplication was P9a (-) TCGCAAGCACCCTATCAG-GCAG, P9a (+) GGAACTACTGTCTTCACGCAGA respectively, which yielded a 248-bp specific PCR product. The reverse transcription parameters for HCV were preheated for 4 min at 94 °C, followed by 30 cycles of heating at 94 °C for 40 sec, 55 °C for 40 sec, 72 °C for 1 min, and a final elongation for 5 min at 72 °C, then cooling to 4 °C until the next step. The cycling conditions for HCV cDNA were preheated for 4 min at 94 °C, followed by 35 cycles of heating at 94 °C for 50 sec, 55 °C for 40 sec, 72 °C for 90 sec, and a final elongation for 5 min at 72 °C, then cooling to 4 °C until electrophoresis. The duplication product was gel electrophoresed and stained with 2% ethidium bromide.
Statistical analysis
The data in our study were expressed as percentages. Differences between groups were assessed by c2 test. A P value <0.05 was considered statistically significant.
Results
After treatment with IFN-a 2b, the level of anti-HCV and HCV-RNA in serum of patients with chronic hepatitis C were obviously decreased. The negative rates of anti-HCV and HCV-RNA were all higher in the IFN-a 2b-treated group than in those received the routine treatment (Table 1). No anti-IFN-a 2b IgG was detected in serum of normal blood donors and in patients with chronic hepatitis C before treatment with IFN-a 2b. However, anti-IFN-a 2b IgG were observed during the treatment with IFN-a 2b (Table 2). After treatment with IFN-a 2b, five patients positive for anti-IFN-a 2b IgG remained also positive for anti-HCV and HCV-RNA (Table 3). The level of HCV-RNA before and after the treatment was significantly different (Fig. 1).
Table 1. The negative rate of anti-HCV, HCV-RNA in serum of patients with chronic hepatitis C before and after treatment with IFN-a 2b.

Group

n

Negative rate of anti-HCV %(n)

Negative rate of HCV-RNA %(n)

Before treatment

After treatment

Before treatment

After treatment

IFN-α 2b group

94

0 (0.94)

33 (31.94)

0 (0.94)

38 (36.94)

Three months

94

0 (0.94)

0 (0.94)

0 (0.94)

15 (14.94)

Six months

94

0 (0.94)

21 (20.94)

0 (0.94)

23 (22.94)

Twelve months

94

0 (0.94)

33 (31.94)

0 (0.94)

38 (36.94)

Routine treatment group

40

0 (0.40)

10 (4.40)

0 (0.40)

15 (6.40)

c2=7.6826, P<0.01
c2=7.0830, P<0.01
Table 2. The frequency of patients positive for anti-IFN-a 2b IgG.

Group

n

Before treatment

After treatment

number

%

number

%

IFN-α 2b group

94

0

0

5

5

Three months

94

-

-

0

0

Six months

94

-

-

2

2

Twelve months

94

-

-

5

5

Routine treatment group

40

0

0

0

0

c2=1.6634, P>0.05
 c2=5.5745, P>0.05
Table 3. The results of anti-IFN-a 2bIgG in serum of the patients after treatment of IFN-a 2b with still anti-HCV (+) and HCV-RNA.

Group

N

anti-IFN-IgG

Positive number

Positive rate

Anti-HCV(+)、HCV-RNA(+) after treatment of α2b-IFN

63

5

7.94

Anti-HCV(+)、HCV-RNA(+) after treatment of routine medicine

36

0

0.00

vs routine medicine group, c2=1.5854, P>0.05
Figure 1. Expression of HCV-RNA before and after treatment with IFN-a 2b [Lanes 1,3,5 (before treatment) and lanes 2,4,6 (after treatment)].
Discussion
Interferons including IFN-a, IFN-b, and IFN-g are potent biologically active proteins synthesised and secreted by somatic cells of all mammals. Among the three kinds of IFN, the biological effects of IFN-a against viruses are the highest; its principal effect is through preventing the duplication of virus in body. The antiviral activity of IFN is mediated via cell receptors and depends on the activation of signalling pathways, the expression of specific gene products, and the development of antiviral mechanisms. Sensitivity of cells to IFN-mediated antiviral activity is variable and depends on a number of factors including cell type, expression of IFN receptors and downstream effector response elements (14), neutralization antibody against IFN, effectiveness of antiviral mechanisms, the type of virus used to infect cells, etc. Although intracellular virus cannot be directly eliminated by IFN, protein kinase and 2',5'-oligo-adenylate synthetase (2', 5'-OAS) can be induced by IFN. A kind of endogenous endonuclease which can degrade virus-RNA is induced by 2', 5'-OAS and the necessary enzyme of ribosome can be inactivated by protein kinase so that the synthesis of protein decreases and the growth of virus is restrained. Detection of anti-HCV is the main method for the diagnosis of HCV infection and is regarded as one of the markers for following the treatment of hepatitis C. The specific core antigens-NS3 and NS4 antigen-are in the second generation diagnostic kits of anti-HCV. Therefore, different antibodies against antigens of HCV can be detected which makes the kits highly specific and sensitive (5, 15). The level of HCV-RNA is an important index to evaluate the level of infection of the virus; it is one of direct evidences of HCV infection (6, 7). The actual duplication level of HCV can be accurately determined by detection of anti-HCV and HCV-RNA in serum of patients.
Although the total curative effect of IFN is not enough high, it is still an effective antiviral medicine for the treatment of hepatitis C. It aims at HCV-RNA and interferes with the biosynthesis of HCV. Its curative effect is associated with the immune response of patients to the virus (8, 9). After three courses of treatment of 94 patients with IFN-a 2b, the negative rates of anti-HCV and HCV-RNA in serum were 33%(31/94) and 38%(36/94). The curative effect of IFN-a 2b was batter than that of routine treatments (P<0.01). It is shown that IFN combines with IFN receptor (IFN-R) on the surface of the target cells infected by HCV, and a lot of antiviral protein, such as 2', 5'-OAS, and dsRNA-dependent protein kinase (DDPK) are induced so that HCV-RNA is decomposed, translation of HCV mRNA is restrained (10), and the duplication of HCV and single transmission of mRNA in the target cells are restrained. IFN has also immunoregulatory effects and can induce cellular immune response of HCV-CTL so that HCV particles are wiped out. The expression of HLA-antigens on surface of liver cells IFN can be induced so that the transmission effect of virus antigen and the eliminative effect of virus will all increase (11, 16, 17).
It was shown that the conjugated antibody and neutralizing antibody against IFN appear after two or three months of treatment and a high positive rate of anti-IFN is observed after treatment and persisted for three to six months. The highest and lowest type of anti-IFN in frequency was anti-IFN-a 2a and anti-IFN-a 1, respectively. The highest positive rate of anti-IFN was anti-IFN-a 2b (18, 19). Anti-IFN was easily induced by a little dose and a long course of treatment. The positive rate of conjugated antibody against IFN was from 5% to 20%. Different levels of conjugated antibody had various clinical manifestations. The positive rate of neutralizing antibody of IFN is less than 5%. If the conjugated antibody against IFN was produced in early treatment, the curative effect of IFN must be decreased. The results of our study showed that little anti-IFN is produced in early treatment. However, the low level of anti-IFN-a 2b IgG could be produced in a few of patients with extending the treatment course; though its positive rate was only 5% (5/94), which is lower than that reported by Li, et al. (20). The results showed that the antigenicity of IFN is weak so that only in a few patients a low level of anti-IFN response would be observed. IFN is still a safe and effective medicine for the treatment of the patients with chronic hepatitis C.
IFN are well-known to up-regulate various immune responses. It is thought that it does so largely by increased expression of cell surface molecules (21); for example, b2-microglobulin, class I MHC antigens, and IgG-Fc receptor (FcR) which involves in immune recognition. After treatment with IFN-a 2b for nine months, the positive rate of anti-HCV, and HCV-RNA in serum of patients with chronic hepatitis C was still 67% (63/94) and 62% (58/94), respectively. The results showed that the curative effect of IFN, low negative rate of anti-HCV, and HCV-RNA in serum were not satisfactory enough for most people. A possible reason is that after IFN entered the body, it would easily be decomposed by protease in kidney. The distribution of IFN is not even in different tissues-most of IFN is in blood, liver, kidney, and less is in other tissues. After HCV invades peripheral blood mononuclear cells (PBMC), the cellular immune response of the patient is obviously malfunctions and the antiviral response is restrained (22, 23). In PBMC, some antigen synthesis of HCV is restrained by IFN and therefore cleaning of infected PBMCs from HCV becomes more difficult (7). During the course of antiviral treatment, the immune system must be activated. The ratio of helper to suppressor T cells (Th/Ts) and the level of interleukin-2-receptor (IL-2R) must be increased. Because of the disorder in cellular immune response in patients and lower level of membrane IL-2R, the antiviral effect of IFN would be limited to a certain extent. The data in our study confirmed that the positive rate of anti-IFN IgG in serum of patients with chronic hepatitis C who were treated with IFN-a 2b for three courses of treatment was only 8% (5/63). There was no statistically significant difference between the group of anti-HCV+, HCV-RNA+ treated with IFN-a 2b and those anti-HCV+, HCV-RNA+ treated with routine treatments (P>0.05). The possible reason was that IFN has a weak immunogenicity and a low level of anti-IFN-a 2b IgG can be induced during the treatment course. It is not confirmed that the low level of anti-IFN IgG is best direct and important reason for the therapy effect of IFN-a 2b with not enough satisfied for most people. During the treatment with IFN, little amount of anti-IFN IgG can neutralize even a high dose of IFN injected. Fever and general malaise can be induced by a high level of IFN. The cellular immune function of patients with chronic hepatitis C is damaged to a certain extent so that the induced reaction to IFN is light and the antiviral effect is weak (24-26). The number of samples in our study was not enough and further studies on larger samples are needed so that the trend of anti-IFN IgG level can be identified in more detail. After treatment of patients with routine medications for nine months, few patients had positive anti-IFN IgG. The results showed that the anti-IFN IgG induced by IFN coming from autoimmune T lymphocytes was more difficult.
In conclusion, IFN-a 2b has a high curative effect for patients with chronic hepatitis C and with viremia. The negative rates of HCV-RNA and anti-HCV in serum of patients with chronic hepatitis C were higher after treatment with IFN with three 3-MU injections per week. If the course of treatment of IFN were long enough, the negative rates of HCV-RNA and anti-HCV in serum would be even higher. Although IFN-a 2b has certain antigenicity levels, the rate of anti-IFN-a 2b IgG production during the course of treatment and the restrain effect of anti-IFN-a 2b IgG on the treatment are low. If high level of anti-IFN-a 2b is produced during the treatment with IFN-a 2b, other effective antivirals should be used.
Acknowledgments
This study has been supported by the grant from Natural Science Foundation of Anhui Province (No. 090413138), and the grant from Natural Science Foundation of the Department of Education of Anhui Province (No. KJ2009A032).

References

  • 1.

    Akyuz F, Polat N, Kaymakoglu S, et al. Intrahepatic and peripheral T-cell responses in genotype 1b hepatitis C virus-infected patients with persistently normal and elevated aminotransferase levels. World J Gastroenterol. 2005;11(45):7188-91. [PubMed]

    .
  • 2.

    Hung CH, Lee CM, Lu SN, et al. Is delayed normalization of alanine aminotransferase a poor prognostic predictor in chronic hepatitis C patients treated with a combined interferon and ribavirin therapy? J Gastroenterol Hepatol. 2002;17(12):1307-11. [PubMed]

    .
  • 3.

    Kasahara A, Hayashi N, Mochizuki K, et al. Clinical characteristics of patients with chronic hepatitis C showing biochemical remission, without hepatitis C virus eradication, as a result of interferon therapy. The Osaka Liver Disease Study Group. J Viral Hepat. 2000;7(5):343-51. [PubMed]

    .
  • 4.

    Wang C, Pflugheber J, Sumpter R, Jr., et al. Alpha interferon induces distinct translational control programs to suppress hepatitis C virus RNA replication. J Virol. 2003;77(7):3898-912. [PubMed]

    .
  • 5.

    Bouvier-Alias M, Patel K, Dahari H, et al. Clinical utility of total HCV core antigen quantification: a new indirect marker of HCV replication. Hepatology. 2002;36(1):211-8. [PubMed]

    .
  • 6.

    Mangia A, Santoro R, Piattelli M, et al. High doses of interferon in combination with ribavirin are more effective than the standard regimen in patients with HCV genotype 1 chronic hepatitis. J Hepatol. 2002;37(1):109-16. [PubMed]

    .
  • 7.

    Chapel HM, Christie JM, Peach V, Chapman RW. Five-year follow-up of patients with primary antibody deficiencies following an outbreak of acute hepatitis C. Clin Immunol. 2001;99(3):320-4. [PubMed]

    .
  • 8.

    Fujimoto T, Tomimatsu M, Iga D, Endo H, Otsuka K. Changes in the Th1/Th2 ratio during a 24-week course of an interferon alpha-2b plus ribavirin combination therapy for patients with chronic hepatitis C. J Gastroenterol Hepatol. 2008;23(8 Pt 2):e432-7. [PubMed]

    .
  • 9.

    Uka K, Suzuki F, Akuta N, et al. Efficacy of interferon monotherapy in young adult patients with chronic hepatitis C virus infection. J Gastroenterol. 2006;41(5):470-5. [PubMed]

    .
  • 10.

    Murashima S, Kumashiro R, Ide T, et al. Effect of interferon treatment on serum 2',5'-oligoadenylate synthetase levels in hepatitis C-infected patients. J Med Virol. 2000;62(2):185-90. [PubMed]

    .
  • 11.

    Penna A, Missale G, Lamonaca V, et al. Intrahepatic and circulating HLA class II-restricted, hepatitis C virus-specific T cells: functional characterization in patients with chronic hepatitis C. Hepatology. 2002;35(5):1225-36. [PubMed]

    .
  • 12.

    Castet V, Fournier C, Soulier A, et al. Alpha interferon inhibits hepatitis C virus replication in primary human hepatocytes infected in vitro. J Virol. 2002;76(16):8189-99. [PubMed]

    .
  • 13.

    Zhang T, Lin RT, Li Y, et al. Hepatitis C virus inhibits intracellular interferon alpha expression in human hepatic cell lines. Hepatology. 2005;42(4):819-27. [PubMed]

    .
  • 14.

    Meager A. Biological assays for interferons. J Immunol Methods. 2002;261(1-2):21-36. [PubMed]

    .
  • 15.

    Soler M, Pellerin M, Malnou CE, Dhumeaux D, Kean KM, Pawlotsky JM. Quasispecies heterogeneity and constraints on the evolution of the 5' noncoding region of hepatitis C virus (HCV): relationship with HCV resistance to interferon-alpha therapy. Virology. 2002;298(1):160-73. [PubMed]

    .
  • 16.

    Pan CH, Yang PM, Hwang LH, et al. T-cell antigenic determinants within hepatitis C virus nonstructural protein 3 and cytokine production profiles in hepatitis C. J Viral Hepat. 2002;9(4):258-64. [PubMed]

    .
  • 17.

    Bacosi M, De Angelis A, Ursitti A, et al. Association of circulating CD8(+) lymphocytes to a spontaneous and interferon-alpha induced clearance of HCV. Hepatol Res. 2002;23(3):163-6. [PubMed]

    .
  • 18.

    Qureshi H, Arif A, Ahmed W, et al. Role of interferon anti body in predicting the response to interferon therapy in HCV patients. J Pak Med Assoc. 2007;57(12):581-3. [PubMed]

    .
  • 19.

    Depraetere S, Van Kerschaever E, Van Vlierberghe H, et al. Long term response to interferon treatment in chronic hepatitis C patients is associated with a significant reduction in anti-E1 envelope antibody titers. J Med Virol. 2000;60(2):126-32. [PubMed]

    .
  • 20.

    Li ZW, Liu P, Bai H, Sun GJ, Sun J, Ma YM. [Study on the relationship between the efficacy of IFN and ribavirin on chronic hepatitis C and the anti-IFN antibodies]. Chinese Journal of Practical Internal Medicine. 2002;22(7):399-400.

    .
  • 21.

    Caraglia M, Marra M, Pelaia G, et al. Alpha-interferon and its effects on signal transduction pathways. J Cell Physiol. 2005;202(2):323-35. [PubMed]

    .
  • 22.

    Wang J, Xiang GJ, Liu BX. Effect of alpha 2b interferon on inducement of mIL-2R and treatment of HCV in PBMC from patients with chronic viral hepatitis C. World J Gastroenterol. 2003;9(4):751-4. [PubMed]

    .
  • 23.

    Chen L, Chen P, Fan G, Li L, Liu C. [Localization of hepatitis C virus core protein in the nucleus of peripheral blood mononuclear cells of hepatitis C patients]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 2002;16(1):37-9. [PubMed]

    .
  • 24.

    Li CP, Wang KX, Wang J, Pan BR. mIL-2R, T cell subsets & hepatitis C. World J Gastroenterol. 2002;8(2):298-300. [PubMed]

    .
  • 25.

    Dominguez-Villar M, Munoz-Suano A, Anaya-Baz B, et al. Hepatitis C virus core protein up-regulates anergy-related genes and a new set of genes, which affects T cell homeostasis. J Leukoc Biol. 2007;82(5):1301-10. [PubMed]

    .
  • 26.

    Della Bella S, Crosignani A, Riva A, et al. Decrease and dysfunction of dendritic cells correlate with impaired hepatitis C virus-specific CD4+ T-cell proliferation in patients with hepatitis C virus infection. Immunology. 2007;121(2):283-92. [PubMed]

    .

Copyright

© 2009, Author(s). This open-access article is available under the Creative Commons Attribution 4.0 (CC BY 4.0) International License (https://creativecommons.org/licenses/by/4.0/), which allows for unrestricted use, distribution, and reproduction in any medium, provided that the original work is properly cited.

Similar Articles

31
May
2012

Hepatitis B Virus Genotype B and High Expression of Interferon Alpha Receptor ? Subunit are Associated With Better Response to Pegylated Interferon Alpha 2a in Chinese Patients With Chronic Hepatitis B Infection

Ya-Bin Guo,
You-Fu Zhu,
An-Shen Chen,
Mu-Xiu Zhou,
Zhi Li,
Li-Tong Xu
,et al.

Guo Y, Zhu Y, Chen A, Zhou M, Li Z, et al. Hepatitis B Virus Genotype B and High Expression of Interferon Alpha Receptor ? Subunit are Associated With Better Response to Pegylated Interferon Alpha 2a in Chinese Patients With Chronic Hepatitis B Infection. Hepat Mon. 2012;12(5):. doi: https://doi.org/10.5812/hepatmon.6173

1
Mar
2014

Interferon Alpha-2b Therapy in Chronic Hepatitis Delta

Maryam Keshvari,
Seyed Moayed Alavian,
Heidar Sharafi,
Gharib Karimi,
Mohammad Gholami Fesharaki

Keshvari M, Alavian SM, Sharafi H, Karimi G, Gholami Fesharaki M. Interferon Alpha-2b Therapy in Chronic Hepatitis Delta. Hepat Mon. 2014;14(3):e15729. doi: https://doi.org/10.5812/hepatmon.15729

31
Mar
2015

Pegylated Interferon α Therapy in Chronic Delta Hepatitis: A One-Center Experience

Ibrahim Halil Bahcecioglu,
Murat Ispiroglu,
Ulvi Demirel,
Mehmet Yalniz

Bahcecioglu IH, Ispiroglu M, Demirel U, Yalniz M. Pegylated Interferon α Therapy in Chronic Delta Hepatitis: A One-Center Experience. Hepat Mon. 2015;15(3):e24366. doi: https://doi.org/10.5812/hepatmon.24366

1
Feb
2017

Higher Serum Levels of Type I Interferon Receptor in Adults with Chronic Hepatitis B Leading to Hepatitis B Surface Antigen Clearance

Ashraf Mohamadkhani,
Sima Besharat,
Golnosh Gol-Jah Rad,
Akbar Pour Dadash Asiabar,
Gholamreza Roshandel,
Akram Pourshams
,et al.

Mohamadkhani A, Besharat S, Gol-Jah Rad G, Pour Dadash Asiabar A, Roshandel G, et al. Higher Serum Levels of Type I Interferon Receptor in Adults with Chronic Hepatitis B Leading to Hepatitis B Surface Antigen Clearance. Jundishapur J Microbiol. 2017;10(3):e41319. doi: https://doi.org/10.5812/jjm.41319

31
Jan
2011

Hepatitis B Virus DNA Level as Predictor of Response to Therapy with Interferon-alpha-2b (PDferon) in Chronic Hepatitis B Infection

Seyed Moayed Alavian,
Seyed Mohammad Miri,
Mohammad Javad Behzadnia

Alavian SM, Miri SM, Behzadnia MJ. Hepatitis B Virus DNA Level as Predictor of Response to Therapy with Interferon-alpha-2b (PDferon) in Chronic Hepatitis B Infection. Arch Clin Infect Dis. 2011;6(1):. doi:

Download PDF131.54 KB
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles