Biochemical and Molecular Markers Among Prediabetic and Type 2 Diabetes Mellitus Patients

Author(s):
Danya Omed GhareebDanya Omed GhareebDanya Omed Ghareeb ORCID1, Heshu Sulaiman RahmanHeshu Sulaiman RahmanHeshu Sulaiman Rahman ORCID2,*
1Department of Medical Laboratory Sciences, College of Science, Charmo University, Chamchamal, Sulaimaniyah, Iraq
2Branch of Basic Medical Sciences, College of Medicine, University of Sulaimani, Sulaimaniyah, Iraq
*Corresponding Author: Branch of Basic Medical Sciences, College of Medicine, University of Sulaimani, Sulaimaniyah, Iraq. Email: [email protected]

International Journal of Endocrinology and Metabolism:Vol. 24, issue 4; e171089
Published online:Jun 13, 2026
Article type:Research Article
Received:Mar 19, 2026
Accepted:May 24, 2026
How to Cite:Ghareeb DO, Rahman HS. Biochemical and Molecular Markers Among Prediabetic and Type 2 Diabetes Mellitus Patients. Int J Endocrinol Metab. 2026;24(4):e171089. doi: https://doi.org/10.5812/ijem-171089

Abstract

Background:

Type 2 diabetes mellitus (T2DM) progresses through prediabetes (PD), which is characterized by insulin resistance and β-cell dysfunction. More than 50% of T2DM cases remain undiagnosed, underscoring the need for specific molecular markers beyond standard diagnostic tests.

Objectives:

This study aimed to compare sociodemographic, biochemical, and molecular profiles among groups to improve risk stratification.

Methods:

This cross-sectional study recruited 90 participants, including healthy controls (HC), individuals with PD, and patients with T2DM (n = 30 each), at Smart Health Tower, Sulaymaniyah, Iraq, from January to June 2025. Approximately 6.0 mL of blood was collected from each participant and analyzed for glycated hemoglobin (HbA1C), random blood glucose (RBG), C-peptide, lipid profile, urea, and creatinine, as well as molecular markers, including micro-ribonucleic acids (miRNAs) such as miRNA-126 and miRNA-132. Variables were subsequently compared among the groups.

Results:

Glycemic markers differed markedly among groups, with HbA1C and RBG highest in T2DM (P < 0.050). In PD, C-peptide (3.04 ± 1.33 ng/mL, P < 0.010) and high-density lipoprotein (HDL) (48.2 ± 12.3 mg/dL, P = 0.028) were highest. Renal markers showed the lowest creatinine level in T2DM (0.72 ± 0.18 mg/dL, P < 0.010), whereas urea levels were comparable among groups (P > 0.05). In patients with T2DM, correlations were observed between RBG and HbA1C (r = 0.792, P < 0.001), C-peptide and triglycerides (r = 0.598, P < 0.001), and HbA1C and creatinine (r = -0.452, P = 0.012). In the PD group, RBG correlated with C-peptide (r = 0.387, P = 0.035). In contrast, miRNA-132 expression was lowest in HC (0.90 ± 0.63; 95% CI, 0.67 - 1.14), significantly increased in PD (2.50 ± 1.86; 95% CI, 1.74 - 3.26), and highest in T2DM (3.56 ± 2.04; 95% CI, 2.80 - 4.32), with highly significant differences between HC and PD and between HC and T2DM (P < 0.001), as well as between PD and T2DM (P = 0.045). Additionally, miRNA-126 expression was lowest in HC (1.22 ± 0.52; 95% CI, 1.03 - 1.42), moderately elevated in T2DM (1.29 ± 0.85; 95% CI, 0.97 - 1.61), and highest in PD (1.70 ± 0.74; 95% CI, 1.41 - 1.98), with significant differences between PD and HC (P = 0.021) and between PD and T2DM (P = 0.029), while no significant difference was observed between HC and T2DM (P = 0.252).

Conclusions:

The identified interconnections among glycemic, lipid, and renal indicators underscore the importance of early identification, comprehensive biochemical evaluation, and timely care during the PD phase to prevent progression to overt DM and its associated complications.

Highlights

1. Background

Type 2 diabetes mellitus (T2DM) is characterized by persistently high blood glucose (BG), particularly after carbohydrate intake. Unlike type 1 diabetes mellitus (T1DM), which involves insulin deficiency, most patients with T2DM have elevated fasting or post-glucose insulin levels unless beta (β)-cell failure occurs. Insulin resistance (IR) explains the persistence of high glucose levels despite sufficient insulin (1). Globally, approximately 50% of people aged 20 - 79 years with diabetes mellitus (DM) are unaware of their condition; this varies by region, with approximately one-third undiagnosed in high-income countries and more than 75% undiagnosed in low-income countries (2). Prediabetes (PD) is an intermediate stage between normal glucose tolerance (normoglycemia) and T2DM (3), with a high risk of progression to T2DM (4). Prediabetes is identified using fasting blood glucose (FBG), glycated hemoglobin (HbA1C), or 2-hour post-load BG (2h-PBG) tests, and it indicates a high risk of developing DM (5). A better understanding of PD enables earlier identification and intervention, potentially reducing the development of DM. However, varying definitions and screening criteria across guidelines lead to wide differences in prevalence estimates (6). Type 2 diabetes mellitus, the most prevalent form of DM, accounts for approximately 90% of all DM cases worldwide. Although it primarily affects middle-aged and older adults, its incidence is increasing in younger populations because of rising rates of obesity, physical inactivity, and unhealthy dietary habits (7). Alarmingly, more than 50% of T2DM cases are estimated to be undiagnosed. Therefore, identifying reliable biochemical and molecular markers is essential for facilitating early diagnosis of both PD and T2DM. This would enable the development of noninvasive, sensitive, and cost-effective screening tools, ultimately supporting timely intervention and reducing the risk of complications (8).
Micro-ribonucleic acids (miRNAs) are short noncoding RNAs (21 - 23 nucleotides) that regulate gene expression post-transcriptionally. In DM, many miRNAs are dysregulated, making them potential markers for T2DM risk (9). Micro-ribonucleic acids regulate cell growth, differentiation, proliferation, and death and act as novel signaling molecules for intercellular communication. Some are improved in individuals with PD. When combined with HbA1C, plasma miRNA levels may help assess early T2DM risk and prevent progression (10). MicroRNA-126 is significantly downregulated in DM compared with PD, with the highest levels in nondiabetic individuals, suggesting strong potential as a diagnostic biomarker for PD and DM (11). Modulating the amount of miR-132 in the body could be used to treat DM. In vivo tests show that antagomir-132 administration lowers BG levels and increases insulin production. RNA-based treatments, such as antagomirs targeting miR-132, control glucose metabolism and enhance β-cell activity. These findings indicate that miR-132 could be a promising target for improving BG control in patients with diabetes (12). Traditional markers range from qualitative to quantitative and include random blood glucose (RBG), FBG, HbA1C, and the 2-hour oral glucose tolerance test (OGTT) as primary markers, and C-peptide, lipid profile, and renal function tests as secondary markers. However, these markers have limitations, including moderate sensitivity and specificity. Therefore, combining several markers may more precisely identify individuals at high risk of developing PD and subsequently progressing to DM (10, 13).

2. Objectives

This study aimed to compare sociodemographic characteristics, glycemic markers, lipid profiles, and renal function markers among the HC, PD, and T2DM groups. It also aimed to quantify the expression of circulating miRNA-126 and miRNA-132 and compare their profiles across glycemic stages.

3. Methods

3.1. Study Design and Setting

This prospective cross-sectional study was conducted among 90 individuals who visited Smart Health Tower, Sulaymaniyah, Iraq, for routine medical checkups, treatment, or regular follow-up. Data collection and experimental procedures were conducted sequentially from January to June 2025, in accordance with the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) guidelines.

3.2. Participant Selection and Sampling Technique

A total of 90 participants, including HC individuals, individuals with PD, and patients diagnosed with T2DM (n = 30 each), were enrolled using a consecutive sampling method. According to the American Diabetes Association criteria (14), HC individuals were defined by fasting plasma glucose (FPG) of < 100 mg/dL, 2hppBS of < 140 mg/dL, HbA1C of < 5.7%, and a postprandial glucose level of 70 - 90 mg/dL approximately 5 hours after a meal. Prediabetes was defined by FPG of 100 - 125 mg/dL, 2hppBS of 140 - 199 mg/dL, and HbA1C of 5.7% - 6.4%. Finally, T2DM was defined by RBG of ≥ 200 mg/dL, FBG of ≥ 126 mg/dL on 2 separate tests, OGTT of 200 mg/dL, and HbA1C of ≥ 6.5% (14).

3.3. Inclusion Criteria

Eligible participants were aged 30 - 60 years and were either HC individuals, individuals with PD, or patients with T2DM. Participants received clinical diagnoses from a competent physician, which were subsequently validated using conventional laboratory procedures.

3.4. Exclusion Criteria

Individuals with T1DM; a history of significant comorbidities, including hypertension, epilepsy, cancer, end-stage renal disease, liver failure, or autoimmune disorders; pregnant, breastfeeding, or postpartum women; and individuals receiving continuous pharmaceutical treatment for diseases not linked to DM control were excluded.

3.5. Questionnaire

A self-developed questionnaire, validated by 5 experts in the field to improve accuracy, accessibility, and reliability, was used to collect participants’ sociodemographic data (age, gender, marital status, occupation, and residency), clinical characteristics (family history of diabetes, disease duration, symptoms, chronic conditions, and diabetes therapies), BG monitoring frequency, and biochemical parameters (glycemic markers, lipid profile, and renal function tests).

3.6. Blood Sample Collection and Laboratory Analysis

Approximately 6.0 mL of venous blood was collected from each participant. Of this, 2 mL was placed into plain tubes and centrifuged at 3000 revolutions for 10 minutes to obtain plasma, which was aliquoted and stored at -20°C for molecular analysis. Another 3 mL of blood was placed in a serum separation tube to obtain serum, which was used to assess C-peptide, the lipid profile (triglyceride, total cholesterol, low-density lipoprotein, and high-density lipoprotein), and renal function tests (urea and creatinine) using a biochemical analyzer (Cobas e 402 and c 503, Switzerland). The remaining 1.0 mL of blood was used immediately to assess BG levels and HbA1C.

3.7. Molecular Study

Total RNA was extracted using the NZY miRNA Isolation & RNA Clean-up Kit (NZYtech, catalog No. MB45801, Germany), which enables purification of all types of RNA, including miRNA, while allowing simultaneous removal of protein and DNA contaminants. Briefly, frozen plasma samples were thawed gradually on ice to avoid thermal damage to RNA. Samples were then centrifuged at 10000 × g for 10 - 15 minutes at room temperature to remove residual platelets and cellular debris. Several modifications were made to optimize the RNA extraction protocol for plasma samples because the kit was primarily intended for cells and tissues. A starting volume of 200 μL of plasma was used, and extraction was performed according to the manufacturer’s protocol. To enhance RNA concentration, the elution volume was reduced to 25 μL. In addition, the eluate was reapplied to the silica membrane column, followed by an additional centrifugation step, to increase the concentration of recovered total RNA, including miRNAs. RNA concentration and purity were subsequently evaluated using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). U6 small nuclear RNA (snRNA) served as the endogenous reference gene for normalization in reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) assays. U6 is a spliceosomal component known for stable expression under various physiological conditions and has been shown to provide reliable, consistent expression in miRNA biomarker studies (15). PCR amplification was performed using the one-step NZYSpeedy RT-qPCR Green Kit (NZYtech), which enables reverse transcription within a single tube. The 2× master mix contains SYBR Green dye, dNTPs, DNA polymerase, and optimized reaction buffer components in a total volume of 20 μL (Table 1), along with self-developed reverse and forward primers obtained from Bioneer Corporation, South Korea (Table 2). The PCR cycling conditions included reverse transcription at 45°C for 10 minutes, polymerase activation at 95°C for 5 minutes, denaturation at 95°C for 10 seconds, and annealing with extension at 60°C for 45 seconds. Finally, relative miRNA expression was quantified using the Pfaffl method, which provides an efficiency-corrected framework for comparing gene expression levels between test and reference samples.
Table 1.Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) Components
MaterialReaction (μL)
One-step NZYSpeedy qPCR Green master mix (2×)10
10 μM forward primer0.8
10 μM reverse primer0.8
NZYRT mix0.8
Adapter0.8
Sample1 - 5
Deionized distilled water5
Final volume20
Table 2.Primer Sequence Used for the Reverse Transcription-Quantitative Polymerase Chain Reaction Assay a
Primer namePrimer sequence
hsa-miR-126b-5p F5'TCTACCGTTCATTACTCTAA3'
hsa-miR-126b-5p R5'GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATAAC3'
hsa-miR-132 - 5p F5'TAA TGC TTG CCT ACG3'
hsa-miR-132 - 5p R5'GTGCAGGGTCCGAGGT3'

a Abbreviation: miR, Micro-ribonucleic acid.

3.8. Statistical Analysis

The Statistical Package for the Social Sciences (IBM, Chicago, USA, version 26) was used for data analysis. Data normality was assessed using the Kolmogorov-Smirnov test. Continuous variables were expressed as mean ± standard deviation (SD), and categorical variables were expressed as number and percentage. Analysis of variance (ANOVA) was used for comparisons between groups (HC, PD, and T2DM) when data were normally distributed (such as age), whereas categorical variables were compared using the chi-square test (such as gender, marital status, occupation, and residency). For nonparametric comparisons between groups, the Kruskal-Wallis test was applied (such as BMI), along with the Mann-Whitney U test (such as disease duration, HbA1C, RBG, C-peptide, lipid profile, renal biomarkers, and molecular biomarkers). Correlations between biochemical markers (HbA1C, RBG, C-peptide, TG, TC, HDL, LDL, urea, and creatinine) and molecular markers (miRNA-126 and miRNA-132) were evaluated using Spearman’s rank correlation coefficient (ρ). A P value of < 0.050 was considered statistically significant, while P < 0.001 was considered highly significant.

4. Results

4.1. Sociodemographic and Clinical Characteristics

The mean age was 48.97 ± 8.48 years in HC, 53.87 ± 9.08 years in PD, and 51.20 ± 8.73 years in T2DM; the difference among groups was not significant (P = 0.102). Females accounted for 56.7% of the HC group, 60% of the PD group, and 66.7% of the T2DM group. Mean BMI was 27.40 ± 2.47 kg/m2 in HC, 28.45 ± 3.56 kg/m2 in PD, and 29.12 ± 5.01 kg/m2 in T2DM; the difference among groups was not significant. Most participants were married: 80% in the HC group, 93.3% in the PD group, and 96.7% in the T2DM group. Employment was reported by 50% of HC, 46.7% of PD, and 36.7% of T2DM participants. Urban residence predominated across all groups (86.7% in HC, 93.3% in PD, and 80% in the T2DM group) (Table 3).
Table 3.Sociodemographic Characteristics of the Study Participants a
SociodemographicHC (n = 30)PD (n = 30)T2DM (n = 30)P-Value
Age (y)0.102
Mean ± SD48.97 ± 8.4853.87 ± 9.0851.20 ± 8.73
Minimum/maximum35/6636/6934/68
95% CI45.8 - 52.1350.48 - 57.2647.94 - 54.46
Gender0.828
Female13 (56.7)18 (60.0)20 (66.7)
Male17 (43.3)12 (40.0)9 (33.3)
Male: female ratio17:282:31:2.33
BMI (kg/m2)0.187
Mean ± SD27.40 ± 2.4728.45 ± 3.5629.12 ± 5.01
Minimum/maximum23.5/34.3822.3/36.420.34/46.87
95% CI26.48 - 28.3227.22 - 29.8827.24 - 30.99
Marital status, frequency (%)0.075
Married24 (80.0)28 (93.3)29 (96.7)
Single6 (20.0)2 (6.7)1 (3.3)
Occupation0.557
Employed15 (50.0)14 (47.7)11 (37.6)
Unemployed15 (50.0)16 (53.3)19 (63.3)
Residency0.315
Urban26 (86.7)28 (93.3)24 (80.0)
Rural4 (13.3)2 (6.7)6 (20.0)

a Values are expressed as No. (%) unless otherwise indicated. Abbreviations: BMI, Body Mass Index; CI, confidence interval; HC, healthy control; PD, prediabetic; T2DM, type 2 diabetes mellitus. Age was analyzed using ANOVA, BMI using the Kruskal-Walli’s test, and categorical variables (gender, marital status, occupation, and residency) using the chi-square test.

In addition, a family history of DM was reported by 10 HC participants (33.3%), 11 PD participants (36.7%), and 12 T2DM patients (40.0%) (P = 0.866). Regarding disease duration, no value was applicable to HC, whereas PD had a mean duration of 2.27 ± 3.86 years (range, 1 month to 11 years; 95% CI, -0.33 to 4.86), and T2DM patients had a mean duration of 7.61 ± 5.86 years (range, 3 months to 20 years; 95% CI, 5.42 - 9.80), indicating a significant difference (P = 0.002). Symptoms were more frequent in the T2DM group, with 20 patients (66.7%) reporting symptoms compared with 12 individuals (40.0%) in the PD group (P = 0.038). Similarly, chronic conditions were significantly more prevalent in T2DM patients, with 21 (70%) affected versus 9 (30%) among individuals with PD (P = 0.002). Pharmacological management indicated that only 6 individuals with PD (20%) were taking oral hypoglycemics, compared with 23 T2DM patients (76.7%) (P < 0.001). Insulin therapy was exclusive to the T2DM group, with 8 patients (26.7%) using insulin (Table 4).
Table 4.Clinical Characteristics Among Study Groups a
Clinical CharacteristicsHC (n = 30)PD (n = 30)T2DM (n = 30)P-Value
Family history of diabetes0.866
No20 (66.7)19 (63.3)18 (60.0)
Yes10 (33.3)11 (36.7)12 (40.0)
Duration0.002 b
Mean ± SD (y)-2.27 ± 3.867.61 ± 5.86
Minimum/maximum-1 month/11 years3 months/20 years
95% CI--0.33 - 4.865.42 - 9.80
Symptoms0.038
No-18 (60.0)10 (33.3)
Yes-12 (40.0)20 (66.7)
Chronic conditions0.002 b
No-21 (70.0)9 (30.0)
Yes-9 (30.0)21 (70.0)
Taking diabetes pills< 0.001 b
No-24 (80.0)7 (23.3)
Yes-6 (20.0)23 (76.7)
Using insulin injections0.002 b
No-30 (100.0)22 (73.3)
Yes-0 (0.0)8 (26.7)

a Values are expressed as No. (%) unless otherwise indicated. Abbreviations: CI, confidence interval; HC, healthy control; T2DM, type 2 diabetes mellitus.

b Significant differences were assessed using the Mann–Whitney U test for duration and the chi-square test for categorical variables.

4.2. Blood Glucose Monitoring and Biochemical Parameters

The frequency of BG monitoring differed markedly between individuals with PD and those with T2DM. Among PD participants, most (n = 21, 70%) reported not checking their BG at all, whereas none of the T2DM patients fell into this category. In contrast, daily monitoring was reported by 8 T2DM patients (26.7%), compared with only 1 individual with PD (3.3%). Patients with T2DM demonstrated significantly more frequent and structured monitoring behaviors than those with PD (P < 0.001) (Figure 1).
Frequency of Blood Glucose Monitoring Among Individuals with Prediabetes and Type 2 Diabetes Mellitus (T2DM). T2DM patients showed significantly more blood glucose monitoring behaviors than individuals with PD (P &lt; 0.001).
Figure 1.

Frequency of Blood Glucose Monitoring Among Individuals with Prediabetes and Type 2 Diabetes Mellitus (T2DM). T2DM patients showed significantly more blood glucose monitoring behaviors than individuals with PD (P < 0.001).

Markers of glycemic control differed significantly across groups, with HbA1C levels increasing progressively from 5.39 ± 0.26% in HC to 6.11 ± 0.22% in PD and 9.21 ± 2.29% in T2DM patients; all pairwise comparisons were highly significant (Pa < 0.001; Pb < 0.001; Pc < 0.001). Similarly, mean RBG values were 98 ± 9 mg/dL in HC, 108 ± 25.59 mg/dL in PD, and 185 ± 101 mg/dL in T2DM (P < 0.001). C-peptide levels were highest in the PD group (3.04 ± 1.33 ng/mL), followed by HC (2.82 ± 0.72 ng/mL), and lowest in T2DM (2.60 ± 1.82 ng/mL). No significant difference was observed between HC and PD (Pa = 0.712); however, significant reductions were noted in T2DM compared with both HC (Pb = 0.012) and PD (Pc = 0.025). Lipid profile parameters showed no significant differences in total cholesterol (TC) (HC, 188.30 ± 27.18 mg/dL; PD, 190.52 ± 46.79 mg/dL; T2DM, 199.53 ± 43.04 mg/dL), with Pa = 0.842, Pb = 0.151, and Pc = 0.412, respectively. Triglyceride (TG) levels followed a similar pattern (144.30 ± 59.63, 135.05 ± 71.22, and 157.51 ± 150.04 mg/dL in HC, PD, and T2DM, respectively), with no significant differences across comparisons (Pa = 0.264, Pb = 0.228, and Pc = 0.340, respectively). LDL concentrations were also comparable: 124.30 ± 25.64 mg/dL in HC, 121.64 ± 42.63 mg/dL in PD, and 127.72 ± 31.24 mg/dL in T2DM, with nonsignificant differences (Pa = 0.771, Pb = 0.644, and Pc = 0.531, respectively). In contrast, HDL levels were significantly lower in HC (42.38 ± 10.64 mg/dL) than in PD (48.49 ± 11.51 mg/dL, Pa = 0.028). No significant differences were found between HC and T2DM (Pb = 0.061) or between PD and T2DM (Pc = 0.695). Urea levels were relatively consistent: 29.82 ± 8.01 mg/dL in HC, 30.61 ± 6.86 mg/dL in PD, and 27.54 ± 6.68 mg/dL in T2DM, with no significant differences across comparisons (Pa = 0.686, Pb = 0.236, and Pc = 0.085, respectively). Creatinine levels showed a declining trend from HC (0.82 ± 0.19 mg/dL) to PD (0.74 ± 0.15 mg/dL) and T2DM (0.65 ± 0.14 mg/dL). The difference between HC and PD was not significant (Pa = 0.088). Patients with T2DM had significantly lower creatinine values than both HC (Pb < 0.001) and PD (Pc = 0.021) (Table 5).
Table 5.Comparison of Glycemic, Lipid, and Renal Biomarkers Among Study Groups a, b
Biochemical ParametersHC (n = 30)PD (n = 30)T2DM (n = 30)PAPBPC
Glycemic control markers
HbA1C (mmol/mol)5.39 ± 0.266.11 ± 0.229.21 ± 2.29< 0.001 c< 0.001 c< 0.001 c
RBG (mg/dL)98.39 ± 9.25108.53 ± 25.59185.31 ± 101.290.019 c< 0.001 c< 0.001 c
C-peptide (ng/mL)2.82 ± 0.723.04 ± 1.332.60 ± 1.820.7120.012 c0.025 c
Lipid profile (mg/dL)
Total cholesterol188.30 ± 27.18190.52 ± 46.79199.53 ± 43.040.8420.1510.412
Triglycerides144.30 ± 59.63135.05 ± 71.22157.51 ± 150.040.2640.2280.340
LDL124.30 ± 25.64121.64 ± 42.63127.72 ± 31.240.7710.6440.531
HDL42.38 ± 10.6448.49 ± 11.5147.10 ± 10.360.028 c0.0610.695
Renal function test (mg/dL)
Urea29.82 ± 8.0130.61 ± 6.8627.54 ± 6.680.6860.2360.085
Creatinine0.82 ± 0.190.74 ± 0.150.65 ± 0.140.088< 0.001 c0.021 c

a Data are expressed as mean ± SD. Abbreviations: HbA1C, Glycated hemoglobin; HC, healthy control; HDL, high-density lipoprotein; LDL, low-density lipoprotein; PD, prediabetic; RBG, random blood glucose; T2DM, type 2 diabetes mellitus.

b P values were defined as follows: PA for comparisons between HC and PD, PB for HC and T2DM, and PC for PD and T2DM groups. HbA1C, RBG, C-peptide, total cholesterol, triglyceride, LDL, HDL, urea, and creatinine were analyzed using the Mann-Whitney U test.

c Significant difference.

4.3. Correlation of Variables Among Patients with T2DM

A strong positive correlation was observed between HbA1C and RBG (ρ = 0.773, P < 0.001). However, C-peptide did not significantly correlate with either HbA1C or RBG. C-peptide showed a significant positive correlation with TG (ρ = 0.573, P = 0.001) and TC (ρ = 0.387, P = 0.035), suggesting that β-cell activity may be associated with lipid dysregulation in T2DM. Additionally, a strong positive correlation was found between TG and LDL levels (ρ = 0.751, P < 0.001), and a significant positive association was observed between TG and TC (ρ = 0.387, P = 0.035). In contrast, a significant inverse correlation was identified between HDL and LDL (ρ = -0.432, P = 0.017). C-peptide also showed a significant negative correlation with HDL (ρ = -0.407, P = 0.026), with no significant correlation with LDL. Creatinine levels were significantly positively correlated with both C-peptide (ρ = 0.431, P = 0.019) and HDL (ρ = 0.431, P = 0.019), whereas creatinine was not significantly correlated with other parameters. Urea did not significantly correlate with any variables (Table 6).
Table 6.Correlation Between Glycemic, Lipid, and Renal Markers in Type 2 Diabetes Mellitus Patients a
CorrelationsGlycemic Control MarkersLipid ProfileRenal Function Test
HbA1CRBSC-peptideTCTGLDLHDLUreaCreatinine
Glycemic control markers
HbA1C
ρNANA
P- ValueNANA
RBS
ρ0.773 cNA
P- Value< 0.001
C-peptide
ρ-0.154-0.010
P- Value0.4170.960
Lipid profile
TC
ρ0.0820.101-0.004
P- Value0.6660.5940.985
TG
ρ-0.114-0.0610.573 c0.387 b
P- Value0.5470.7510.0010.035
LDL
ρ-0.0290.054-0.1250.751 c0.249
P- Value0.5470.7780.510<0.0010.185
HDL
ρ-0.0190.168-0.407 b0.254-0.432 b0.151
P- Value0.9220.3740.0260.1760.0170.425
Renal function test
Urea
ρ0.2500.131-0.0640.044-0.015-0.0130.151
P- Value0.1830.4900.7370.8160.9370.9470.427
Creatinine
ρ0.0130.0120.0130.0760.1320.114-0.1960.431 b
P- Value0.9470.9520.9840.6940.9490.5550.3070.019

a Abbreviations: HbA1C, Glycated hemoglobin; HDL, high-density lipoprotein; LDL, low-density lipoprotein; NA, not available; RBG, random blood glucose; TC, total cholesterol; TG, triglyceride; ρ, Spearman's rank correlation coefficient. Duration was analyzed using Spearman's rank correlation test.

b Correlation is significant at the 0.05 level (2-tailed).

c Correlation is significant at the 0.01 level (2-tailed).

4.4. Molecular Analysis

Quantitative analysis of circulating miRNA-132 and miRNA-126 expression levels is presented in Table 7. Expression values were normalized to U6 snRNA and calculated using the Pfaffl method (2-ΔΔCt), with statistical comparisons between groups. MicroRNA-132 exhibited a progressive increase across the glycemic spectrum. Healthy controls showed the lowest expression (0.90 ± 0.63; 95% CI, 0.67 - 1.14), followed by individuals with PD (2.50 ± 1.86; 95% CI, 1.74 - 3.26), with expression peaking in patients with T2DM (3.56 ± 2.04; 95% CI, 2.80 - 4.32). The differences were highly significant between HC and PD and between HC and T2DM (P < 0.001). A modest but significant elevation was also observed between PD and T2DM (P = 0.045) (Table 7 and Figure 2).
Table 7.Comparative Analysis of miRNA-126 and miRNA-132 Across Study Groups (N = 30) a
Study Groups and StatisticsmiRNA-126miRNA-132
HC
95% CI1.03 - 1.420.67 - 1.14
Mean ± SD1.22 ± 0.520.90 ± 0.63
PD
95% CI1.41 - 1.981.74 - 3.26
Mean ± SD1.70 ± 0.742.50 ± 1.86
T2DM
95% CI0.97 - 1.612.80 - 4.32
Mean ± SD1.29 ± 0.853.56 ± 2.04
P-value
HC vs PD0.021 b< 0.001 c
HC vs T2DM0.252< 0.001 c
PD vs T2DM0.029 b0.045 b

a Abbreviations, CI, Confidence interval; HC, healthy control; miRNA, micro-ribonucleic acid; PD, prediabetic; T2DM, type 2 diabetes mellitus.

b Significant difference.

c Highly significant difference. Determined using the Mann-Whitney U test.

Comparative fold expression of circulating miRNA-132 across treated groups. miRNA-132 was gradually and significantly expressed (elevated) across HC, PD, and T2DM groups. HC: Healthy controls; miRNA: micro-ribonucleic acid; PD: prediabetic; T2DM: type 2 diabetes mellitus. Data were analyzed using the Mann-Whitney U test.
Figure 2.

Comparative fold expression of circulating miRNA-132 across treated groups. miRNA-132 was gradually and significantly expressed (elevated) across HC, PD, and T2DM groups. HC: Healthy controls; miRNA: micro-ribonucleic acid; PD: prediabetic; T2DM: type 2 diabetes mellitus. Data were analyzed using the Mann-Whitney U test.

In addition, the mean expression level of miRNA-126 was lowest in the HC group (1.22 ± 0.52; 95% CI, 1.03 - 1.42), moderately elevated in T2DM patients (1.29 ± 0.85; 95% CI, 0.97 - 1.61), and highest in the PD group (1.70 ± 0.74; 95% CI, 1.41 - 1.98). A significant increase was observed in individuals with PD compared with HC (P = 0.021) and between the PD and T2DM groups (P = 0.029), while no significant differences (P = 0.252) were observed between the HC and T2DM groups (Table 7 and Figure 3).
Comparative expression of circulating miRNA-126 across studied groups. A significant increase was observed in individuals with PD compared with either HC (P = 0.021) or T2DM groups (P = 0.029), while no significant differences were noted between HC and T2DM groups (P = 0.252). HC: Healthy control; miRNA: micro-ribonucleic acid; PD: prediabetic; T2DM: type 2 diabetes mellitus. Data were analyzed using the Mann-Whitney U test.
Figure 3.

Comparative expression of circulating miRNA-126 across studied groups. A significant increase was observed in individuals with PD compared with either HC (P = 0.021) or T2DM groups (P = 0.029), while no significant differences were noted between HC and T2DM groups (P = 0.252). HC: Healthy control; miRNA: micro-ribonucleic acid; PD: prediabetic; T2DM: type 2 diabetes mellitus. Data were analyzed using the Mann-Whitney U test.

5. Discussion

This study provides a comprehensive comparison of sociodemographic, clinical, and biochemical characteristics among healthy individuals, individuals with PD, and patients with T2DM. The results indicate gradual metabolic changes during the progression from normoglycemia to PD and ultimately to overt DM, with biochemical and clinical indicators proving more discriminatory than sociodemographic variables.

5.1. Sociodemographic and Clinical Characteristics

Sociodemographic factors were largely similar across the 3 groups. Age and sex distributions were not substantially different, suggesting that these characteristics were not primary predictors of glycemic status in this cohort. Body Mass Index showed a progressive, albeit insignificant, increase from healthy individuals to those with T2DM, indicating that although adiposity contributes to IR, the deterioration in glycemic control is influenced by other interacting factors beyond body weight alone. Marital status, occupation, and residency were comparable across groups, with most participants living in metropolitan regions. These findings suggest that sociodemographic factors did not affect glycemic categorization within this cohort, underscoring the greater diagnostic relevance of clinical and biochemical indicators. Kalra et al. also reported that gender, education, employment, socioeconomic status, BMI, and lifestyle factors are not consistently associated with DM risk, corroborating the absence of substantial sociodemographic differences observed in this study (16). Moreover, anthropometric and biochemical profiles have been reported to be comparable between urban and rural populations, further supporting the observed consistency in residency patterns across the study groups (16).
Furthermore, clinical characteristics clearly differentiated the glycemic groups. A family history of DM was prevalent across all groups, indicating its widespread occurrence in the general population. Although family history is a recognized independent risk factor for T2DM, its high prevalence suggests that it serves more as a background risk factor than as a differentiating clinical feature across glycemic categories (17). Disease duration was a significant distinguishing factor. Individuals with PD had a relatively recent onset of dysglycemia, whereas individuals with T2DM reported a much longer disease course. This trend aligns with longitudinal studies indicating that PD is an early, often transient phase, with many individuals progressing to overt DM over time (18). Symptom burden and comorbidities increased markedly from PD to T2DM. Chronic hyperglycemia in T2DM was associated with greater symptomatology and a higher prevalence of chronic comorbidities, indicating disease progression and the emergence of complications. Evidence suggests that PD substantially increases the likelihood of developing DM and related complications, whereas multimorbidity becomes more prevalent with longer T2DM duration (19, 20). Medication use corresponded with disease severity. Most individuals with PD were not receiving pharmacological treatment, whereas oral glucose-lowering medications were widely used in T2DM (21), with insulin therapy restricted to this cohort. This is consistent with clinical evidence indicating that PD is primarily managed with lifestyle modification, whereas more severe T2DM often requires pharmacological intervention because of progressive β-cell dysfunction (22).

5.2. Blood Glucose Monitoring and Biochemical Parameters

Distinct differences were observed in self-monitoring behavior. Most individuals with PD did not consistently check their BG levels, indicating limited engagement in preventive health measures. In contrast, individuals with T2DM reported frequent monitoring, consistent with treatment protocols and professional guidelines. These findings highlight a substantial gap in early disease management, as PD is a potentially reversible phase in which enhanced surveillance may facilitate timely intervention. Previous research indicates that individuals using insulin or combination therapy show greater adherence to glucose self-monitoring; nevertheless, overall adherence remains inadequate, corroborating the observed differences between PD and T2DM (23). In addition, RBG and HbA1C values increased significantly from healthy individuals to those with PD and T2DM, confirming worsening glycemic control across disease stages. Susairaj et al. reported similar incremental increases in glycemic indicators corresponding to elevated DM risk (24). C-peptide levels demonstrated a distinct pattern. Individuals with PD had elevated levels, presumably reflecting compensatory hyperinsulinemia due to IR (25). Conversely, individuals with T2DM had decreased C-peptide levels, indicating declining β-cell secretory capacity as the disease progresses (26). This pattern supports the conclusion that early dysglycemia is characterized by increased insulin secretion, whereas advanced T2DM is associated with progressive β-cell dysfunction (25).
Most lipid measures, including TC, LDL, and TG, showed no significant differences across groups. This may reflect variable lipid responses during early dysglycemia or the influence of cholesterol-lowering medication in individuals with T2DM. Similar findings have been reported in studies comparing normoglycemic, PD, and diabetic cohorts (27). High-density lipoprotein levels were higher in the PD cohort than in HC, whereas no significant differences were observed between PD and T2DM. Variability in high-density lipoprotein may be influenced by lifestyle factors, hormonal effects, or early metabolic adaptations rather than by glycemic status alone (27).
Urea levels were comparable across groups, indicating preserved renal function. Creatinine levels decreased gradually from healthy individuals to those with T2DM. This decrease may reflect lower muscle mass rather than enhanced renal clearance, as sarcopenia commonly occurs in chronic metabolic diseases. Findings from the Korean Sarcopenic Obesity Study support this hypothesis, reporting an increased prevalence of sarcopenia in individuals with T2DM (28).

5.3. Correlation Patterns Among Patients with T2DM

A strong positive correlation between RBG and HbA1C confirmed that higher daily glucose levels contribute to increased long-term glycemic burden. C-peptide showed no significant correlation with glycemic indicators, suggesting that residual β-cell activity does not directly reflect current glycemic control in established T2DM (29, 30). Triglyceride levels correlated positively with LDL and TC, consistent with diabetic dyslipidemia. C-peptide showed significant associations with TC and TG and a negative correlation with HDL, suggesting that residual insulin secretion may contribute to lipid abnormalities through IR-related pathways. The negative correlation between HDL and LDL reflects established atherogenic patterns. Aruna reported similar correlations between C-peptide levels and atherogenic lipid ratios in inadequately controlled T2DM, reinforcing the link between IR and dyslipidemia (31). Finally, creatinine showed a positive correlation with C-peptide and HDL, indicating potential associations among muscle mass, residual β-cell activity, and lipid metabolism. Urea showed no notable correlations, suggesting stable nitrogen metabolism. The strong association between T2DM and sarcopenia supports the observed creatinine-related associations (32).

5.4. Molecular Findings

Quantitative RT-qPCR analysis revealed upregulated circulating miRNA-126 and miRNA-132 in PD and T2DM relative to HC. MicroRNA-126 peaked in PD compared with HC and T2DM, with no HC-T2DM difference. MicroRNA-132 showed a progressive and significant increase across all groups. Liu et al. reported findings consistent with these results, observing elevated circulating miRNA-126 as a novel biomarker for screening PD and newly diagnosed T2DM (AUC, 0.78) (33). Similarly, results reported by Zeinali et al. partially aligned with our findings regarding miRNA-126 dysregulation in PD; they observed decreased circulating miRNA-126 - 3p levels compared with controls and negative correlations with inflammation in Iranian PD/T2DM cohorts. Although their pattern contrasts with ours, possibly due to cohort BMI 25 - 35 or ethnicity, the association with inflammation supports a role for miRNA-126 in the pathogenesis of early dysglycemia (34).
Zhang et al. observed significantly lower miRNA-126 in susceptible individuals with impaired fasting glucose and newly diagnosed T2DM than in normal individuals (P < 0.010) and reported an inverse association with fasting glucose. However, their signature miRNA panel confirmed the utility of miRNA-126 for early T2DM prediction, supporting miRNA-126 dysregulation during the PD/T2DM transition, as reflected by its peak expression in this study (35). Moreover, Pramanik et al. reported decreased miRNA-126 and miRNA-132 levels in plasma and vitreous humor of T2DM patients with nonproliferative diabetic retinopathy (NPDR) compared with those without diabetic retinopathy, contrasting with our observed upregulation in PD/T2DM without retinopathy (36). In contrast, Shi et al. reported decreased hippocampal miR-132 in T2DM rats via the GSK-3β/Tau pathway in a cognitive impairment model, differing from our observed plasma increase, possibly due to tissue specificity (brain vs blood), species differences (rat vs human), or hyperglycemia stage (37). Nemecz et al. reported significantly upregulated miR-132, along with miR-218 and miR-143, in microvesicles from patients with diabetic nephropathy compared with controls, linking it to vascular complications and confirming elevated circulating miR-132 in advanced T2DM, consistent with its progressive increase and metabolic/vascular role (38).

5.5. Limitations

This study has limitations, including its cross-sectional design, which may limit the ability to establish causal relationships among biochemical indicators, microRNA expression, and disease development across different glycemic states. The limited sample size and single-center design may also constrain the generalizability of the results to diverse populations with varying ethnic, genetic, or lifestyle characteristics. MicroRNA expression was assessed at a single time point, which may not capture longitudinal changes or temporal fluctuations during progression from PD to T2DM.

5.6. Conclusions

The transition from normoglycemia to PD and T2DM might be driven by metabolic and molecular changes rather than sociodemographic factors, which showed minimal discriminative value. Changes in glycemic markers and C-peptide reflect the evolving balance between IR and β-cell function, with PD characterized by compensatory hyperinsulinemia and T2DM by declining insulin secretory capacity. Correlation patterns among glycemic indices, lipid parameters, and renal markers might highlight the complex, interconnected nature of metabolic dysregulation in established DM. Circulating miRNA-126 and miRNA-132 might exhibit unique, stage-specific expression patterns across the glycemic spectrum, indicating roles in glucose metabolism, vascular regulation, and disease progression. Integrating traditional biochemical markers with molecular markers might provide a more comprehensive approach to detecting early metabolic disturbances and elucidating the continuum of DM progression.

5.7. Recommendations

Future research should use longitudinal designs to monitor biochemical and microRNA changes over time, thereby improving understanding of their prognostic significance for DM development. Larger, multicenter studies are recommended to confirm these results and improve their applicability to other populations. Expanding the panel of circulating miRNAs may provide a more comprehensive molecular profile associated with dysglycemia and improve biomarker sensitivity. Further investigation is needed to elucidate the molecular functions of miRNA-126 and miRNA-132 in insulin production, β-cell function, and vascular regulation, which may inform future diagnostic or therapeutic strategies.

Acknowledgments

Footnotes

  • AI Use Disclosure:The authors declare that no generative AI tools were used in the creation of this article.

  • Authors' Contribution:H. G. contributed to supervision, analysis, and editing. P. M. contributed to experiments, writing, and editing. H. C. contributed to experiments and writing. Z. Z. contributed to data collection, writing, and editing. N. D. contributed to experiments, writing, and editing. J. Z. contributed to conception, supervision, writing, and editing.

  • Conflict of Interests Statement:The authors do not declare any conflicts of interests for this study.

  • Data Availability:The generated data of this study are not available publicly due to its restrictive content, but can be provided by the corresponding author upon request.

  • Ethical Approval:The study protocol was reviewed and approved by the Scientific and Ethical Committees of the College of Medicine, Charmo University, Chamchamal, Sulaimaniyah, Iraq (No. 8, on November 03, 2024). All procedures were conducted in accordance with the Declaration of Helsinki, 2008.

  • Informed Consent:All participants willingly gave their written informed consent to participate voluntarily. They were guaranteed that their personal information would be kept confidential and used only for research purposes. Also, participants were apprised that their participation was completely optional, and they had the choice to withdraw from the research at any moment without justification and without repercussions to their medical treatment.

  • Funding/Support:This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

References

  • 1.
    Westman EC. Type 2 Diabetes Mellitus: A Pathophysiologic Perspective. Front Nutr. 2021;8. 707371. [PubMed ID: 34447776]. [PubMed Central ID: PMC8384107]. https://doi.org/10.3389/fnut.2021.707371.
  • 2.
    Forouhi NG, Wareham NJ. Epidemiology of diabetes. Medicine. 2019;47(1):22-27. https://doi.org/10.1016/j.mpmed.2018.10.004.
  • 3.
    Aghababaeian H, Sadeghi Moghaddam A, Kalani L, Nejat AA, Ahmadi-Mazhin S. The Relationship Between Activity of Daily Living and Blood Biochemical Factors in Newly Diagnosed Patients with Type 2 Diabetes Mellitus. Jundishapur Journal of Chronic Disease Care. 2026;15(1). e166855. https://doi.org/10.5812/jjcdc-166855.
  • 4.
    Beulens JWJ, Rutters F, Rydén L, Schnell O, Mellbin L, Hart HE, et al. Risk and management of pre-diabetes. Eur J Prev Cardiol. Dec. 2019;26(2_suppl):47-54. [PubMed ID: 31766914]. https://doi.org/10.1177/2047487319880041.
  • 5.
    Echouffo-Tcheugui JB, Selvin E. Prediabetes and What It Means: The Epidemiological Evidence. Annu Rev Public Health. Apr 1. 2021;42(1):59-77. [PubMed ID: 33355476]. [PubMed Central ID: PMC8026645]. https://doi.org/10.1146/annurev-publhealth-090419-102644.
  • 6.
    Hostalek U. Global epidemiology of prediabetes - present and future perspectives. Clin Diabetes Endocrinol. 2019;5(1). 5. [PubMed ID: 31086677]. [PubMed Central ID: PMC6507173]. https://doi.org/10.1186/s40842-019-0080-0.
  • 7.
    Mohammadpanah Ardakan A, Hemati Farsani Z, Heydari Z, Habibi Ghahfarrokhi S, Raisi Z. Effect of Exercise Timing on Inflammation and Cognition in Aged Women with Type 2 Diabetes Mellitus: A Randomized Controlled Trial. Iran Journal of Psychiatry Behavioral Sciences. 2025;19(2). e158682. https://doi.org/10.5812/ijpbs-158682.
  • 8.
    Ortiz-Martínez M, González-González M, Martagón AJ, Hlavinka V, Willson RC, Rito-Palomares M. Recent Developments in Biomarkers for Diagnosis and Screening of Type 2 Diabetes Mellitus. Curr Diab Rep. Mar. 2022;22(3):95-115. [PubMed ID: 35267140]. [PubMed Central ID: PMC8907395]. https://doi.org/10.1007/s11892-022-01453-4.
  • 9.
    Laakso M. Biomarkers for type 2 diabetes. Mol Metab. Sep. 2019;27S(Suppl):S139-S146. [PubMed ID: 31500825]. [PubMed Central ID: PMC6768493]. https://doi.org/10.1016/j.molmet.2019.06.016.
  • 10.
    Chakraborty T, Gupta S, Saini V, Talukdar A. Biomarkers: An Important Tool for Diagnosing and Treating Diabetes Mellitus. Int J Life Sci Pharma Res. 2021;11(2):P123-P129. https://doi.org/10.22376/ijpbs/lpr.2021.11.2.P123-129.
  • 11.
    Aghaei Zarch SM, Dehghan Tezerjani M, Talebi M, Vahidi Mehrjardi MY. Molecular biomarkers in diabetes mellitus (DM). Med J Islam Repub Iran. 2020;34:28. [PubMed ID: 32617267]. [PubMed Central ID: PMC7320976]. https://doi.org/10.47176/mjiri.34.28.
  • 12.
    Bijkerk R, Esguerra JLS, Ellenbroek JH, Au YW, Hanegraaf MAJ, de Koning EJ, et al. in vivo Silencing of MicroRNA-132 Reduces Blood Glucose and Improves Insulin Secretion. Nucleic Acid Ther. Apr. 2019;29(2):67-72. [PubMed ID: 30672723]. https://doi.org/10.1089/nat.2018.0763.
  • 13.
    Dorcely B, Katz K, Jagannathan R, Chiang SS, Oluwadare B, Goldberg IJ, et al. Novel biomarkers for prediabetes, diabetes, and associated complications. Diabetes Metab Syndr Obes. 2017;10:345-361. [PubMed ID: 28860833]. [PubMed Central ID: PMC5565252]. https://doi.org/10.2147/DMSO.S100074.
  • 14.
    ElSayed NA, Aleppo G, Bannuru RR, Bruemmer D, Collins BS, Ekhlaspour L, et al. 2. Diagnosis and classification of diabetes: Standards of care in diabetes-2024. Diabetes Care. 2024;47(Suppl 1):S20-S42. [PubMed ID: 38078589]. [PubMed Central ID: PMC10725812]. https://doi.org/10.2337/dc24-S002.
  • 15.
    Lopacinska-Jørgensen J, Petersen PHD, Oliveira DVNP, Høgdall CK, Høgdall EV. Strategies for data normalization and missing data imputation and consequences for potential diagnostic microRNA biomarkers in epithelial ovarian cancer. PLoS One. 2023;18(5). e0282576. [PubMed ID: 37141239]. [PubMed Central ID: PMC10159121]. https://doi.org/10.1371/journal.pone.0282576.
  • 16.
    Kalra S, Anjana RM, Verma M, Pradeepa R, Sharma N, Deepa M, et al. Urban-Rural Differences in the Prevalence of Diabetes Among Adults in Haryana, India: The ICMR-INDIAB Study (ICMR-INDIAB-18). Diabetes Ther. Jul. 2024;15(7):1597-1613. [PubMed ID: 38771471]. [PubMed Central ID: PMC11211308]. https://doi.org/10.1007/s13300-024-01602-w.
  • 17.
    Alharithy MK, Alobaylan MM, Alsugair ZO, Alswat KA. Impact of Family History of Diabetes on Diabetes Control and Complications. Endocr Pract. Sep. 2018;24(9):773-779. [PubMed ID: 30308135]. https://doi.org/10.4158/EP-2018-0071.
  • 18.
    Wutthisathapornchai A, Lertwattanarak R. Progression of Prediabetes to Type 2 Diabetes Mellitus in Thai Population. Journal of the Medical Association of Thailand. 2021;104(5):772-780. https://doi.org/10.35755/jmedassocthai.2021.05.12099.
  • 19.
    Pearson-Stuttard J, Holloway S, Polya R, Sloan R, Zhang L, Gregg EW, et al. Variations in comorbidity burden in people with type 2 diabetes over disease duration: A population-based analysis of real world evidence. EClinicalMedicine. Oct. 2022;52. 101584. [PubMed ID: 35942273]. [PubMed Central ID: PMC9356197]. https://doi.org/10.1016/j.eclinm.2022.101584.
  • 20.
    Washirasaksiri C, Borrisut N, Lapinee V, Sitasuwan T, Tinmanee R, Kositamongkol C, et al. Identification of pre-diabetes subphenotypes for type 2 diabetes, related vascular complications and mortality. BMJ Open Diabetes Res Care. Jun 9. 2025;13(3):e004803. [PubMed ID: 40490374]. [PubMed Central ID: PMC12161346]. https://doi.org/10.1136/bmjdrc-2024-004803.
  • 21.
    Mohseni S, Tabatabaei_Malazy O, Bandarian F, Larijani B. Pharmacogenomics of glibenclamide in patients with type 2 diabetes mellitus: A systematic review. Koomesh. 2022;24(2):183-190.
  • 22.
    Echouffo-Tcheugui JB, Perreault L, Ji L, Dagogo-Jack S. Diagnosis and management of prediabetes: a review. JAMA. 2023;329(14):1206-1216. [PubMed ID: 37039787]. https://doi.org/10.1001/jama.2023.4063.
  • 23.
    Al-Keilani MS, Almomani BA, Al-Sawalha NA, Shhabat BA. Self-monitoring of blood glucose among patients with diabetes in Jordan: Perception, adherence, and influential factors. Diabetes Res Clin Pract. 2017;126:79-85. [PubMed ID: 28236721]. https://doi.org/10.1016/j.diabres.2017.01.005.
  • 24.
    Susairaj P, Snehalatha C, Raghavan A, Nanditha A, Vinitha R, Satheesh K, et al. Cut-off Value of Random Blood Glucose among Asian Indians for Preliminary Screening of Persons with Prediabetes and Undetected Type 2 Diabetes Defined by the Glycosylated Haemoglobin Criteria. J Diabetes Clin Res. 2019;1(2):53-58. [PubMed ID: 32133459]. [PubMed Central ID: PMC7056354]. https://doi.org/10.33696/diabetes.1.009.
  • 25.
    Yin P, Shao P, Liu H, Li W, Wang L, Wang J, et al. C-peptide levels and the risk of diabetes and pre-diabetes among Chinese women with gestational diabetes. J Diabetes Complications. Dec. 2017;31(12):1658-1662. [PubMed ID: 28919328]. [PubMed Central ID: PMC5679088]. https://doi.org/10.1016/j.jdiacomp.2017.08.006.
  • 26.
    Arya P, Husain N, Kumar C, Shekhar R, Prakash V, Hameed S, et al. C-peptide Level in Patients With Uncontrolled Type 2 Diabetes Mellitus on Oral Anti-diabetic Drugs. Cureus. Mar. 2024;16(3). e56810. [PubMed ID: 38654804]. [PubMed Central ID: PMC11036452]. https://doi.org/10.7759/cureus.56810.
  • 27.
    Jasim OH, Mahmood MM, Ad'hiah AH. Significance of Lipid Profile Parameters in Predicting Pre-Diabetes. Arch Razi Inst. Feb. 2022;77(1):277-284.
  • 28.
    Chung HS, Hwang SY, Choi JH, Lee HJ, Yoo HJ, Seo JA, et al. Effects of Low Muscle Mass on Albuminuria and Chronic Kidney Disease in Patients With Type 2 Diabetes: The Korean Sarcopenic Obesity Study (KSOS). J Gerontol A Biol Sci Med Sci. Mar 2. 2018;73(3):386-392. [PubMed ID: 28407041]. [PubMed Central ID: PMC5861907]. https://doi.org/10.1093/gerona/glx055.
  • 29.
    Garg P, Pethusamy K, Ranjan R. Correlation between Estimated Average Glucose Levels Calculated from HbA1c Values and Random Blood Glucose Levels in a Cohort of Subjects. J Lab Physicians. Jun. 2023;15(2):217-223. [PubMed ID: 37323598]. [PubMed Central ID: PMC10264116]. https://doi.org/10.1055/s-0042-1757719.
  • 30.
    Kocanoğlu A, Oral A, Vural Keskinler M, Sadeçolak M, Oğuz A. The relationship between postprandial C peptide-glucose ratio, beta-cell function and treatment success in type 2 diabetes mellitus. Demiroglu Science University Florence Nightingale Journal of Medicine. 2021;7(2):133-140. https://doi.org/10.5606/fng.btd.2021.25060.
  • 31.
    Aruna V. Correlation of C-Peptide and HbA1c in Type II Diabetes Mellitus. International Journal of Research and Review. 2021;8(6):297-303. https://doi.org/10.52403/ijrr.20210637.
  • 32.
    Chen H, Huang X, Dong M, Wen S, Zhou L, Yuan X. The Association Between Sarcopenia and Diabetes: From Pathophysiology Mechanism to Therapeutic Strategy. Diabetes Metab Syndr Obes. 2023;16:1541-1554. [PubMed ID: 37275941]. [PubMed Central ID: PMC10239259]. https://doi.org/10.2147/DMSO.S410834.
  • 33.
    Liu Y, Gao G, Yang C, Zhou K, Shen B, Liang H, et al. The role of circulating microRNA-126 (miR-126): a novel biomarker for screening prediabetes and newly diagnosed type 2 diabetes mellitus. Int J Mol Sci. Jun 12. 2014;15(6):10567-10577. [PubMed ID: 24927146]. [PubMed Central ID: PMC4100169]. https://doi.org/10.3390/ijms150610567.
  • 34.
    Zeinali F, Aghaei Zarch SM, Jahan-Mihan A, Kalantar SM, Vahidi Mehrjardi MY, Fallahzadeh H, et al. Circulating microRNA-122, microRNA-126 - 3p and microRNA-146a are associated with inflammation in patients with pre-diabetes and type 2 diabetes mellitus: A case control study. PLoS One. 2021;16(6). e0251697. [PubMed ID: 34077450]. [PubMed Central ID: PMC8171947]. https://doi.org/10.1371/journal.pone.0251697.
  • 35.
    Zhang T, Lv C, Li L, Chen S, Liu S, Wang C, et al. Plasma miR-126 is a potential biomarker for early prediction of type 2 diabetes mellitus in susceptible individuals. Biomed Res Int. 2013;2013:761617-6. [PubMed ID: 24455723]. [PubMed Central ID: PMC3886569]. https://doi.org/10.1155/2013/761617.
  • 36.
    Pramanik S, Saha C, Chowdhury S, Bose C, Bhattacharyya NP, Mondal LK. Decreased Levels of miR-126 and miR-132 in Plasma and Vitreous Humor of Non-Proliferative Diabetic Retinopathy Among Subjects with Type-2 Diabetes Mellitus. Diabetes Metab Syndr Obes. 2022;15:345-358. [PubMed ID: 35153496]. [PubMed Central ID: PMC8823438]. https://doi.org/10.2147/DMSO.S346097.
  • 37.
    Shi L, Zhang R, Li T, Han X, Yuan N, Jiang L, et al. Decreased miR-132 plays a crucial role in diabetic encephalopathy by regulating the GSK-3β/Tau pathway. Aging (Albany NY). Dec 27. 2020;13(3):4590-4604. [PubMed ID: 33406505]. [PubMed Central ID: PMC7906212]. https://doi.org/10.18632/aging.202418.
  • 38.
    Nemecz M, Stefan DS, Comarița IK, Constantin A, Tanko G, Guja C, et al. Microvesicle-associated and circulating microRNAs in diabetic dyslipidemia: miR-218, miR-132, miR-143, and miR-21, miR-122, miR-155 have biomarker potential. Cardiovasc Diabetol. Sep 25. 2023;22(1). 260. [PubMed ID: 37749569]. [PubMed Central ID: PMC10521428]. https://doi.org/10.1186/s12933-023-01988-0.

Copyright

Copyright © 2026, Ghareeb and Rahman. This open-access article is available under the Creative Commons Attribution 4.0 (CC BY 4.0) International License (https://creativecommons.org/licenses/by/4.0/), which allows for unrestricted use, distribution, and reproduction in any medium, provided that the original work is properly cited.

Similar Articles

30
Mar
2013

Correlation Between Prediabetes Conditions and Microalbuminuria

Adele Bahar,
Atieh Makhlough,
Atefe Yousefi,
Zahra Kashi,
Saeid Abediankenari

Bahar A, Makhlough A, Yousefi A, Kashi Z, Abediankenari S. Correlation Between Prediabetes Conditions and Microalbuminuria. Nephro-Urol Mon. 2013;5(2):741-4. doi: https://doi.org/10.5812/numonthly.7646

31
Aug
2024
J Nurs Midwifery Sci

Anthropometric Measures, Cardiometabolic and Hepatic Indices, and Cut-off Points for Predicting Type 2 Diabetes Mellitus in Southwest Iran: A Cross-Sectional Study from the Enrolment Phase of the Hoveyzeh Cohort Study

Batoul Farhadi,
Mehrnoosh Zakerkish,
Meysam Alipour,
Homeira Rashidi

Farhadi B, Zakerkish M, Alipour M, Rashidi H. Anthropometric Measures, Cardiometabolic and Hepatic Indices, and Cut-off Points for Predicting Type 2 Diabetes Mellitus in Southwest Iran: A Cross-Sectional Study from the Enrolment Phase of the Hoveyzeh Cohort Study. J Nurs Midwifery Sci. 2024;11(3):e148315. doi: https://doi.org/10.5812/jnms-148315

11
Apr
2013

Adiponectin is a Good Marker for Metabolic State among Type 1 Diabetes Mellitus Patients

Hamdollah Karamifar,
Narges Habibian,
Gholamhosein Amirhakimi,
Zohre Karamizadeh,
Abbas Alipour

Karamifar H, Habibian N, Amirhakimi G, Karamizadeh Z, Alipour A. Adiponectin is a Good Marker for Metabolic State among Type 1 Diabetes Mellitus Patients. Inn J Pediatr. 2013;23(3):. doi:

30
Sep
2003

Prevalence of diabetes mellitus impaired glucose tolerance of

B Larijani,
M Pajoohi,
A Javadi,
H Maleckzadeh,
T Samavat,
A Hojjatzadeh
,et al.

Larijani B, Pajoohi M, Javadi A, Maleckzadeh H, Samavat T, et al. Prevalence of diabetes mellitus impaired glucose tolerance of. J Inflamm Dis. 2024;7(2):e154936. doi:

31
Jan
2006

Prevalence and Risk Factors of Microalbuminuria in Type 2 Diabetic Patients in a Diabetic Clinic of Ardabil-Iran

M Iranparvar Alamdari,
N Aminisani,
B Bashardoost,
SM Shamshirgaran,
M Khodamoradzadeh,
M Shokrabadi
,et al.

Iranparvar Alamdari M, Aminisani N, Bashardoost B, Shamshirgaran S, Khodamoradzadeh M, et al. Prevalence and Risk Factors of Microalbuminuria in Type 2 Diabetic Patients in a Diabetic Clinic of Ardabil-Iran. Int J Endocrinol Metab. 2006;4(1):. doi:

Download PDF810.89 KB
Indexed in

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles