Allgrove Syndrome in Iranian Patients and Report on a Novel Mutation in AAAS Gene

Author(s):
Mahin HashemipourMahin Hashemipour1, Mehdi KhorramiMehdi Khorrami2, Manijeh MahdaviManijeh Mahdavi2, Maryam Hosseindokht KhujinMaryam Hosseindokht Khujin2, Majid KheirollahiMajid KheirollahiMajid Kheirollahi ORCID2,*
1Endocrine and Metabolism Research Center, Isfahan University of Medical Sciences, Isfahan, IR Iran
2Pediatric Inherited Diseases Research Center, Research Institute for Primordial Prevention of Non-communicable Disease AND Genetics and Molecular Biology Department, School of Medicine, Isfahan University of Medical Sciences, Isfahan, IR Iran

Innovative Journal of Pediatrics:Vol. 28, issue 1; e6921
Published online:Feb 18, 2018
Article type:Research Article
Received:May 08, 2016
Accepted:Jan 18, 2018
How to Cite:Hashemipour M, Khorrami M, Mahdavi M, Hosseindokht Khujin M, Kheirollahi M. Allgrove Syndrome in Iranian Patients and Report on a Novel Mutation in AAAS Gene. Inn J Pediatr. 2018;28(1):e6921. doi: https://doi.org/10.5812/ijp.6921

Abstract

1. Introduction

Allgrove or Achalasia-addisonianism-alacrimia syndrome (MIM: 231550) is caused by homozygous or compound heterozygous mutation in the gene encoding aladin (AAAS; 605378) on chromosome 12q13. Allgrove et al. (1978) described 2 pairs of siblings (aged 4 - 6 years) with the combination of the symptoms of achalasia, ACTH-resistant adrenal insufficiency and alacrima. This triad of symptoms is known as Allgrove syndrome (1, 2). Patients with Allgrove syndrome usually present dysphagia or severe hypoglycemic or hypotensive attacks, related to adrenal insufficiency in the first decade of life (3).
The onset of adrenal insufficiency is usually before puberty but it may become manifested in the third decade of life (4). In addition, progressive neurological abnormalities related to peripheral, central, or autonomic nervous system may be present (2) that is often associated with mental retardation (5). The phenotype of patients with Allgrove syndrome is highly variable (6).
This syndrome is caused by mutations of the AAAS gene, encoding a 546 amino acid protein ALADIN (alacrima- achalasia-adrenal insufficiency neurologic disorder). In Allgrove syndrome, the association of adrenal and neurologic disease is similar to X-linked adrenoleukodystrophy (7, 8).
In this report, we describe six Iranian patients with Allgrove syndrome, and discuss clinical and genetic features.

2. Methods

2.1. Patients and Samples

In this study we present 6 new patients of Allgrove syndrome. Patient 1 is a 12-year-old Iranian boy. He was a product of non-consanguineous marriage and born by natural delivery. He was confirmed to have alacrima at the age of 1 year. He developed adrenal insufficiency at the age of 11 years. Patient 2 is a 7-year-old Iranian girl, born to non-consanguineous parents. Alacrima was diagnosed at the age of 2 months. She was confirmed to have adrenal insufficiency at the age of 1 year and 6 months. Patient 3 is a 6-year-old Iranian boy, born to consanguineous parents. He was identified to have alacrima at the age of 1 year. He was confirmed to have adrenal insufficiency at the age of 2 years and 6 months. Patient 4 is a 6-year-old Iranian girl, born to non-consanguineous parents. Alacrima was diagnosed at the age of 6 months. She was confirmed to have adrenal insufficiency at the age of 4 years. Patient 5 is a 9-year-old Iranian girl. She was born to consanguineous parents. At the age of 1 year and 6 months she developed alacrima. Adrenal insufficiency was definitively confirmed at the age of 3 years. Patient 6 is an 8-year-old Iranian girl. She was born to non-consanguineous parents. She was diagnosed to have alacrima at the age of 8 months. She was confirmed to have adrenal insufficiency at the age of 5 years.
This study was approved by the ethics committee of the Medical University of Isfahan according to the national health and medical research council guidelines.

2.2. Molecular Analysis

DNA was extracted from whole-blood samples by genomic DNA isolation kit (Genet Bio, Korea). The exons 1 to 16 and some introns of the AAAS gene were amplified by the PCR. Primers used for PCR are listed in Table 1. PCR reactions were carried out in a total volume of 25 µL which contained 10 ng of DNA, 12.5 µL Taq DNA Polymerase (Master Mix(Ampliqon, Denmark) and 1 µL of each primer (10 pmol). After a brief centrifugation, the PCR plate was subjected to 35 cycles of the following conditions: (I) PCR activation at 94°C for 3 minutes, (II) denaturation at 94°C for 30 seconds, (III) annealing at 60°C for 30 seconds, (IV) extension at 72°C for 45 seconds, and (V) final extension at 72°C for 10 minutes. Presence of PCR products was evaluated on a 1.5% agarose gel, and then verified by complete nucleotide sequence analysis (Pishgam Biotech Co, Iran). After sequencing, alignment and analysis were carried out.
Table 1.List of the Primers Used in This Study
Primer NameSequence
PF1CGCAGGAAGAAGCTTTGGAGG
PR1GTCTTAGCTCCCGTATCTGTGCAAC
PF2TTTGTGCTATAGTGGATCAATCTTCCTG
PR2CACATCATCTGAGGTCGGAAGTTC
PF3GGGATCAGAGTAAGCTGACCCAC
PR3GGAATGAGAATATGGTGAGCAATCAG
PF4AGGTGCAGGAACTCTTCATGTTAACC
PR4CGTAACCCACAGACACATTGTCC
PF5TGGGCCATCAGGATAGGAGG
PR5AGCAAATTACAGCTCAGGACCTCTAAG
PF6TTAGAGGTCCTGAGCTGTAATTTGCT
PR6GGGCACGGCCTCATTAGATTAAC
PF7CTTCCCAGTTAATCTAATGAGGC
PR7AAAGACAGACTGGTAACTGAGTGG

2.3. Bioinformatics Analysis

To in silico evaluate the possible effects of the identified variant on gene splicing, Human Splicing Finder (http://www.umd.be/HSF/, Marseille, France) and NetGene2 (http: //www.cbs.dtu.dk/services/NetGene2/, Lyngby, Denmark) softwares were used. Splice site scores were calculated using the ‘Berkeley Drosophila Genome Project (BDGP)’ software (www.fruitfly.org/seq_tools/splice.html).

3. Results

The sequencing results of all patients were analyzed and following mutations were found. We sequenced all 16 exons and some introns of the AAAS gene for the patient 1. The analysis of the AAAS gene of patient 1 demonstrated a G to A transition at the splice donor of exon 14 (IVS14 + 1G to A) (Figure 1A). The analysis of the AAAS gene for patient 2 revealed a novel mutation, including a T deletion in intron 5 (c.446 + 87del T) (Figure 1B). We analyzed sequence of all 16 exons and some introns of the AAAS gene for the patients 3 to 6, but no mutation was found. The results are summarized in Table 2.
A, DNA sequencing electropherogram depicting the IVS14 + 1 mutation. The arrow indicates site of mutation in the Patient 1, which is a G to A change. In the control, the arrow indicates the normal nucleotide. The parents are heterozygote, one allele is wild type and one allele is new mutation; B, DNA sequencing electropherogram depicting the c.446 + 87delT novel mutation. The underline indicates the site of mutation in Patient 2, which is a T nucleotide deletion. In the control, the underline indicates the normal nucleotide and the parents are normal.
Figure 1.

A, DNA sequencing electropherogram depicting the IVS14 + 1 mutation. The arrow indicates site of mutation in the Patient 1, which is a G to A change. In the control, the arrow indicates the normal nucleotide. The parents are heterozygote, one allele is wild type and one allele is new mutation; B, DNA sequencing electropherogram depicting the c.446 + 87delT novel mutation. The underline indicates the site of mutation in Patient 2, which is a T nucleotide deletion. In the control, the underline indicates the normal nucleotide and the parents are normal.

Table 2.Summary of Patients Information
Patient No./SexAgeManifestationsAAAS Gene
1/M12Alacrima, Adrenal insufficiencyIVS14 + 1 G > A
2/F7Alacrima, Adrenal insufficiencyc.446 + 87del T
3/M6Alacrima, Adrenal insufficiencyNormal
4/F6Alacrima, Adrenal insufficiencyNormal
5/F9Alacrima, Adrenal insufficiencyNormal
6/F8Alacrima, Adrenal insufficiencyNormal

Abbreviatuions: F, female; M, male.

To determine whether the AAAS c.446 + 87delT variant is pathogenic, we performed bioinformatics predictions using specific tools. This in silico analysis proposed alteration of splicing reactions that probably makes the retention of AAAS intron 5 (Table 3). Especially, the Human Splicing Finder results show breakage of the wild type (wt) donor site. The variant seems to generate different potential Exonic Splicing Enhancers (ESEs) from position +82 to +94, and also the potential alteration of one of these at the position. All these molecular events probably create an alternative splicing process (Figure 2).
Table 3.Splice Site Analysis of the Intron Variant Mutation c.446 + 87del T in AAAS Gene
Splice-Site Analysis ToolsAAAS, c.446 + 87del T
Human Splicing Finder software√ WT branch point broken: Alteration of WT Branch Point
Potential alteration of splicing
√ ESS Site broken: Alteration of an intronic ESS site.
Probably no impact on splicing.
√ New ESE Site: Creation of an intronic ESE site.
Probably no impact on splicing.
Berkely Drosophila Genome Project (BDGP)Breakage of the wild type (wt) donor site (score 0.4)
NetGene 2 (NG2)
Bioinformatics Prediction of the Intron Variant Mutation c.446 + 87delT in <i>AAAS</i> Gene Using Human Splicing Finder Tool
Figure 2.

Bioinformatics Prediction of the Intron Variant Mutation c.446 + 87delT in AAAS Gene Using Human Splicing Finder Tool

4. Discussion

Since first described by Allgrove et al. in 1978 (1), many patients with Allgrove syndrome have been reported worldwide. Studies have identified mutations in the AAAS gene that are responsible for this disease; therefore, nowadays molecular analysis is usually accomplished to confirm the clinical diagnosis. Mutations in the AAAS gene have been described in several individuals (Table 4). The AAAS gene consists of 16 exons and is translated to a 546 amino acid protein called ALADIN (alacrima-achalasia-adrenal insufficiency neurologic disorder). ALADIN does not show major homology to any known protein but has four WD-repeats (tryptophan-aspartate repeat). WD proteins are involved in a variety of cellular processes such as cell cycle progression, cell fate determination, signal transduction, gene regulation, intracellular trafficking, transcription and apoptosis (9, 10). The function of ALADIN protein is still unknown, but proteomic analysis has shown that ALADIN is a part of nuclear pore complex (NPC) (11).
Table 4.List of Reported Mutations in Patients with Allgrove Syndrome
LocationcDNA MutationPredicted EffectReferences
Ex 1c.43C > Ap.Q15K(6, 7, 12, 13)
Ex 2c.210delCp.170fsX92(13)
Ex 2c.211delCp.H71fsX92(14)
Ex 2c.251G > Ap.W84X(7)
Ex 3c.352delTp.F90fs(15)
Ex 4c.355C > Tp.R119X(14)
IVS 4IVS4-2A > G(8)
Ex 5c.433C > Tp.Q145X(14)
In5c.446 + 87del TThis report
IVS 5IVS5 + 3insT(14)
Ex 6c.518A > Tp. D173V(15)
Ex 6c.479A > Gp.H160R(7)
Ex 6c.470-471delTTp.F157fsX171(7)
Ex 7c.580C > Tp.R194X(16, 17)
Ex 7c.678C > Tp.R230X(13, 14)
Ex 8c.787T > Cp.S263P(6, 7, 13)
IVS8IVS8 + 1G > A(18)
Ex 9c.856C > Tp.R286X(7, 19)
Ex 9c.928-931delGTCTp.V310FfsX42(15)
Ex 9c.934C > Tp.R312X(8)
Ex 9c.991T > Cp.C331R(15)
Ex 10c.981-982insTp.S328fsX363(8)
Ex 10c.1238T > Cp.V313A(13)
Ex 11c.1024C > Tp.R342X(7)
Ex 11c.1066-1067delCTp.L356fsX362(13)
IVS 11IVS11 + 1G > A(12)
Ex 12c.1104-1105insCp.D368fsX382(13)
Ex 12c.1144-1147delTCTGp.S382fsX413(13)
Ex 12c.1159C > Tp.Q387X(6)
Ex 13c.1191insAp.397fxs27(13)
Ex 14c.1374-1176delTTCinsAp.F431X(15)
IVS14IVS14 + 1G > A(8, 12, 14, 20)
Ex 15c.1366C > Tp.Q456X(14)
Ex 15c.1368-1372delGCTCAp.X492(19)
Ex 15c.1389delCp.S463fsX549(7)
Ex 16c.1421G > Ap.W474X(13)
Ex 16c.1422G > Cp.W474C(15)
Ex 16c.1432C > Tp.R487X(8, 20, 21)
Tullio-Pelet et al (2000) found 5 homozygous truncating mutations in the AAAS gene in unrelated patients with triple-A syndrome. They described the founder effect to a single splice donor mutation that happened more than 2,400 years ago in North African families (8). Sandrini et al (2001) investigated 6 families with Allgrove syndrome and 4 with isolated ACTH resistance. Four triple-A syndrome families were from Puerto Rico and most of the remaining 6 families were Caucasian families from North America. All of the triple-A syndrome families, showed mutations in AAAS gene, but no kindred with ACTH resistance. Apparently due to a founder effect, the IVS14 + 1G-A donor splice mutation was found in all Puerto Rican families. In addition, a North American kindred was heterozygous for this mutation. One Puerto Rican family had a new splice donor site mutation in exon 11 of the AAAS gene, IVS11 + 1G-A; the proband was a compound heterozygote. In a Canadian triple-A syndrome kindred, a gln15-to-lys point mutation in homozygote state was determined with a milder phenotype. The patients with the same AAAS defect showed significant clinical variability (12). Handschug et al identified 8 different homozygous and compound heterozygous mutations in the AAAS gene in 9 patients with Allgrove syndrome. Most of these mutations cause truncation of protein (7, 22).
In one patient, we identified a IVS14 + 1 G > A mutation, which has been previously reported in Algerian and Hispanic patients and, hence, is highly expected to be pathogenic (8, 12). This splice site mutation produces abnormal transcripts which cause premature termination of the predicted protein (8). In 4 patients, we couldn’t detect any mutation. We determined a new mutation (c.446 + 87del T) in the AAAS gene in a patient. We speculate that this deletion causes splicing defect in intron 5 which results in a premature termination and non-functional ALADIN protein. However, to define whether it affects AAAS gene expression or function, more detailed studies will be required. In conclusion, the most frequent mutations were not detected in our patients and perhaps further investigation in AAA gene is required to find all mutations in Iran. Since the molecular genetic testing results may influence the therapy and prognosis of Allgrove patients, this paper contributes to understanding the molecular basis of Allgrove in Iranian patients.

Acknowledgments

References

  • 1.
    Allgrove J, Clayden GS, Grant DB, Macaulay JC. Familial glucocorticoid deficiency with achalasia of the cardia and deficient tear production. Lancet. 1978;1(8077):1284-6. [PubMed ID: 78049].
  • 2.
    Gazarian M, Cowell CT, Bonney M, Grigor WG. The "4A" syndrome: adrenocortical insufficiency associated with achalasia, alacrima, autonomic and other neurological abnormalities. Eur J Pediatr. 1995;154(1):18-23. [PubMed ID: 7895750].
  • 3.
    Kimber J, McLean BN, Prevett M, Hammans SR. Allgrove or 4 "A" syndrome: an autosomal recessive syndrome causing multisystem neurological disease. J Neurol Neurosurg Psychiatry. 2003;74(5):654-7. [PubMed ID: 12700313].
  • 4.
    Moore PS, Couch RM, Perry YS, Shuckett EP, Winter JS. Allgrove syndrome: an autosomal recessive syndrome of ACTH insensitivity, achalasia and alacrima. Clin Endocrinol (Oxf). 1991;34(2):107-14. [PubMed ID: 1850671].
  • 5.
    Huebner A, Elias LL, Clark AJ. ACTH resistance syndromes. J Pediatr Endocrinol Metab. 1999;12 Suppl 1:277-93. [PubMed ID: 10698592].
  • 6.
    Prpic I, Huebner A, Persic M, Handschug K, Pavletic M. Triple A syndrome: genotype-phenotype assessment. Clin Genet. 2003;63(5):415-7. [PubMed ID: 12752575].
  • 7.
    Handschug K, Sperling S, Yoon SJ, Hennig S, Clark AJ, Huebner A. Triple A syndrome is caused by mutations in AAAS, a new WD-repeat protein gene. Hum Mol Genet. 2001;10(3):283-90. [PubMed ID: 11159947].
  • 8.
    Tullio-Pelet A, Salomon R, Hadj-Rabia S, Mugnier C, de Laet MH, Chaouachi B, et al. Mutant WD-repeat protein in triple-A syndrome. Nat Genet. 2000;26(3):332-5. [PubMed ID: 11062474]. https://doi.org/10.1038/81642.
  • 9.
    Cronshaw JM, Matunis MJ. The nuclear pore complex protein ALADIN is mislocalized in triple A syndrome. Proc Natl Acad Sci U S A. 2003;100(10):5823-7. [PubMed ID: 12730363]. https://doi.org/10.1073/pnas.1031047100.
  • 10.
    Smith TF, Gaitatzes C, Saxena K, Neer EJ. The WD repeat: a common architecture for diverse functions. Trends Biochem Sci. 1999;24(5):181-5. [PubMed ID: 10322433].
  • 11.
    Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT, Matunis MJ. Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol. 2002;158(5):915-27. [PubMed ID: 12196509]. https://doi.org/10.1083/jcb.200206106.
  • 12.
    Sandrini F, Farmakidis C, Kirschner LS, Wu SM, Tullio-Pelet A, Lyonnet S, et al. Spectrum of mutations of the AAAS gene in Allgrove syndrome: lack of mutations in six kindreds with isolated resistance to corticotropin. J Clin Endocrinol Metab. 2001;86(11):5433-7. [PubMed ID: 11701718]. https://doi.org/10.1210/jcem.86.11.8037.
  • 13.
    Houlden H, Smith S, De Carvalho M, Blake J, Mathias C, Wood NW, et al. Clinical and genetic characterization of families with triple A (Allgrove) syndrome. Brain. 2002;125(Pt 12):2681-90. [PubMed ID: 12429595].
  • 14.
    Reshmi-Skarja S, Huebner A, Handschug K, Finegold DN, Clark AJ, Gollin SM. Chromosomal fragility in patients with triple A syndrome. Am J Med Genet A. 2003;117A(1):30-6. [PubMed ID: 12548737]. https://doi.org/10.1002/ajmg.a.10846.
  • 15.
    Vallet AE, Verschueren A, Petiot P, Vandenberghe N, Nicolino M, Roman S, et al. Neurological features in adult Triple-A (Allgrove) syndrome. J Neurol. 2012;259(1):39-46. [PubMed ID: 21656342]. https://doi.org/10.1007/s00415-011-6115-9.
  • 16.
    Dusek T, Korsic M, Koehler K, Perkovic Z, Huebner A, Korsic M. A novel AAAS gene mutation (p.R194X) in a patient with triple A syndrome. Horm Res. 2006;65(4):171-6. [PubMed ID: 16543750]. https://doi.org/10.1159/000092003.
  • 17.
    Kinjo S, Takemoto M, Miyako K, Kohno H, Tanaka T, Katsumata N. Two cases of Allgrove syndrome with mutations in the AAAS gene. Endocr J. 2004;51(5):473-7. [PubMed ID: 15516781].
  • 18.
    Brooks BP, Kleta R, Stuart C, Tuchman M, Jeong A, Stergiopoulos SG, et al. Genotypic heterogeneity and clinical phenotype in triple A syndrome: a review of the NIH experience 2000-2005. Clin Genet. 2005;68(3):215-21. [PubMed ID: 16098009]. https://doi.org/10.1111/j.1399-0004.2005.00482.x.
  • 19.
    Brooks BP, Kleta R, Caruso RC, Stuart C, Ludlow J, Stratakis CA. Triple-A syndrome with prominent ophthalmic features and a novel mutation in the AAAS gene: a case report. BMC Ophthalmol. 2004;4:7. [PubMed ID: 15217518]. https://doi.org/10.1186/1471-2415-4-7.
  • 20.
    Roubergue A, Apartis E, Vidailhet M, Mignot C, Tullio-Pelet A, Lyonnet S, et al. Myoclonus and generalized digestive dysmotility in triple A syndrome with AAAS gene mutation. Mov Disord. 2004;19(3):344-6. [PubMed ID: 15022193]. https://doi.org/10.1002/mds.10660.
  • 21.
    Goizet C, Catargi B, Tison F, Tullio-Pelet A, Hadj-Rabia S, Pujol F, et al. Progressive bulbospinal amyotrophy in triple A syndrome with AAAS gene mutation. Neurology. 2002;58(6):962-5. [PubMed ID: 11914417].
  • 22.
    Neer EJ, Schmidt CJ, Nambudripad R, Smith TF. The ancient regulatory-protein family of WD-repeat proteins. Nature. 1994;371(6495):297-300. [PubMed ID: 8090199]. https://doi.org/10.1038/371297a0.

Similar Articles

31
Oct
2007

Allgrove Syndrome: A Case Report

A Soltani,
M Arab Ameri,
SH Hasani Ranjbar

Soltani A, Arab Ameri M, Hasani Ranjbar S. Allgrove Syndrome: A Case Report. Int J Endocrinol Metab. 2007;5(4):. doi:

30
Apr
2005

A Novel Mutation of SLC26A4 Gene In an Iranian Family with Pendred Syndrome

K Kahrizi,
C Nishimura,
A Naghavi,
Y Riazalhosseini,
RJH Smith,
H Najmabadi

Kahrizi K, Nishimura C, Naghavi A, Riazalhosseini Y, Smith R, et al. A Novel Mutation of SLC26A4 Gene In an Iranian Family with Pendred Syndrome. Int J Endocrinol Metab. 2005;3(2):. doi:

5
Mar
2016

Novel Mutation in the ATP-Binding Cassette Transporter A3 (ABCA3) Encoding Gene Causes Respiratory Distress Syndrome in A Term Newborn in Southwest Iran

Farideh Rezaei,
Mohammad Shafiei,
Gholamreza Shariati,
Ali Dehdashtian,
Maryam Mohebbi,
Hamid Galehdari

Rezaei F, Shafiei M, Shariati G, Dehdashtian A, Mohebbi M, et al. Novel Mutation in the ATP-Binding Cassette Transporter A3 (ABCA3) Encoding Gene Causes Respiratory Distress Syndrome in A Term Newborn in Southwest Iran. Inn J Pediatr. 2016;26(2):e2493. doi: https://doi.org/10.5812/ijp.2493

12
Sep
2020
Jentashapir Journal of Cellular and Molecular Biology

The Association of Apolipoprotein A1 Gene Polymorphisms with Acute Lymphocytic Leukemia in Tehran Province

Mostafa Bahrebar,
Tahmineh Chalak

Bahrebar M, Chalak T. The Association of Apolipoprotein A1 Gene Polymorphisms with Acute Lymphocytic Leukemia in Tehran Province. Jentashapir J Cell Mol Biol. 2020;11(2):e106563. doi: https://doi.org/10.5812/jjcmb.106563

28
Sep
2016

Novel Homozygous Mutation in the MYO15A Gene in Autosomal Recessive Hearing Loss

Farah Talebi,
Farideh Ghanbari Mardasi,
Javad Mohammadi Asl

Talebi F, Ghanbari Mardasi F, Mohammadi Asl J. Novel Homozygous Mutation in the MYO15A Gene in Autosomal Recessive Hearing Loss. Zahedan J Res Med Sci. 2016;18(10):e4256. doi: https://doi.org/10.17795/zjrms-4256


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles