J Clin Res Paramed Sci

Image Credit:J Clin Res Paramed Sci

Study of the Effect of Bacteriocin-producing Bacillus subtilis Strains on Beta-lactamase-producing Pathogenic Bacteria

Author(s):
Ciamak GhazaeiCiamak GhazaeiCiamak Ghazaei ORCID1,*
1Department of Microbiology, University of Mohaghegh Ardabili, Ardabil, Iran

Journal of Clinical Research in Paramedical Sciences:Vol. 11, issue 2; e130208
Published online:Dec 16, 2022
Article type:Research Article
Received:Jul 25, 2022
Accepted:Dec 04, 2022
How to Cite:Ghazaei C. Study of the Effect of Bacteriocin-producing Bacillus subtilis Strains on Beta-lactamase-producing Pathogenic Bacteria. J Clin Res Paramed Sci. 2022;11(2):e130208. doi: https://doi.org/10.5812/jcrps-130208

Abstract

Background:

The emergence of antimicrobial resistance results in morbidities and mortalities associated with many bacterial infections and is a major concerning issue in front of the healthcare system. As a part of a competitive adaptive strategy for its growth, gram-positive bacteria like Bacillus subtilis produce antimicrobial peptides; bacteriocins. These peptides protect other bacterial species.

Objectives:

To counter antimicrobial resistance, bacteriocins can be considered a potential drug option against drug-resistant microorganisms.

Methods:

After isolation and characterisation of B. subtilis from the 5 collected soil samples, the bacteriocin was extracted from these bacteria by using the ‘solvent extraction method’, characterised, and then purified to evaluate its antimicrobial activity against pathogenic bacteria like; Streptococcus pyogenes, Salmonella typhi, Pseudomonas aeruginosa, Klebsiella pneumoniae and Acinetobacter baumannii by using ‘Kirby-Bauer disc diffusion’, method. The bacteriocin stability was also investigated, at different temperatures, pH and incubation times.

Results:

The bacteriocin of B. subtilis showed great antimicrobial activity against S. pyogenes, followed by S. typhi and P. aeruginosa. However, the lowest antimicrobial activity was against A. baumannii. With the increase in the incubation time and temperature, the antimicrobial activity of bacteriocin was decreased, indicating the protein nature of bacteriocin. Compared to the standard antibiotics, the bacteriocin isolated from B. subtilis demonstrated a significant inhibitory effect against the tested pathogens.

Conclusions:

From this study, it can be concluded that bacteriocin can become a potential alternative to standard available medicines. They can be used against antimicrobial-resistant pathogenic bacteria because of their significant inhibitory activity against the tested pathogens compared to the standard antibiotics.

1. Background

Misuse and overuse of antibiotics or antimicrobial drugs result in the progression of antimicrobial resistance in the human population and have become one of the top 10 healthcare-related threats to the public across the world (1). Beta-lactamase-producing microorganisms are causative agents of nosocomial infections and also contribute to increased healthcare and economic burden due to prolonged hospital stays, increased mortalities, and hence increasing healthcare costs (2). World Health Organisation (WHO) has also listed antibiotic-resistant bacteria from 12 families as a high risk to public health (3). Bacillus is a globally distributed gram-positive, aerobic bacterium which forms spores and has a rod-shaped appearance (4). Due to endospore formation under unfavourable circumstances, Bacillus bacteria are found in clays, food, stones, sand, aquatic environments, soil, plants, and the gastrointestinal systems of countless animals and insects (5). Some of the most prevalent Bacillus species, including Bacillus subtilis and Bacillus licheniformis, are classified by US FDA and are commonly considered as safe (6).
Bacillus subtilis strains, model species for gram-positive organisms, can synthesize 2 dozen antibiotics with various structures and activities, based on the ecological niche and acquired systematic resistance (7). It has been discovered that several bacteriocins, lipopeptides, and other inhibitory substances having bacteriocin properties can be identified in Bacillus spp. (8). To protect themselves and the development of the same bacterial species, bacteria produce and release small antimicrobial peptides called bacteriocins. Bacteriocins mainly prevent bacterial development by creating pores on the surface of the cells or obstructing the production of cell walls (8, 9).
Bacteriocins of both class I and class II are produced by B. subtilis (10). Antibiotics in class I can undergo numerous posttranslational modifications, while ribosomally produced peptides in class II are smaller, pH- and heat-stable. Bacteriocins generated by Bacillus subgroups, including as ericin S, ericin A, and subtilin, have been demonstrated to only hinder the growth of gram-positive bacteria (11). It is thought that 99 % of bacteria and archaea can make at least 1 bacteriocin. Lactic acid bacteria (LAB) have long been explored as important bacteriocin makers, owing to their long history of safe use in food fermentation (4). Bacteriocins made from bacteria are utilized in the food industry, but researchers are looking into their potential as an infection-fighting antibacterial agent (12, 13). Bacteriocins have been researched because of their potential activities against multi-drug resistant bacteria, viruses, as well as some fungi too (14-16).
Bacteriocins can be employed as broad-spectrum antibiofilm medications with the potential for healing. They are typically secure and safe. Antimicrobial substances produced by several Bacillus strains have the potential to treat multidrug resistance issues (17-19).

2. Objectives

This study will investigate the inhibitory effect of B. subtilis bacteriocin on pathogenic bacteria.

3. Methods

3.1. Ethical

Ethical approval for this study was taken as IR.UMA.REC.1400.059.

3.2. Bacterial Isolation from Soil

For sampling, 5 soil samples were used and sent to the laboratory in plastic containers. In order to remove spore-free bacteria and germ cells, the collected samples were treated in a hot water bath for 10 minutes. Dilution was performed in different concentrations by using a physiological serum. The most recent agar was inoculated into nutrition culture media at various dilutions, and then the plates were incubated for 24 hours at 37°C. Colonies grown on an agar plate are studied for colony morphology, cell morphology, hot reaction and endospore formation (20).

3.3. Biochemical Test

Biochemical tests including; catalase activity, motility, glucose uptake by butanediol fermentation pathway (MRVP), citrate utilization and starch hydrolysis, Indole and oxidase tests, were performed according to Bergey’s manual of systematic bacteriology (21).

3.4. Molecular Identification

For the molecular identification of Bacillus strains that were biochemically confirmed, the 16s rRNA sequencing method was used where polymerase chain reaction was used to clone the 16s rRNA gene. Specific primer sequences were used. The first step was DNA preparation by manual method. Isolates of the bacteria were labelled. After that colonies were boiled for 15 minutes and centrifuged at high speed for 10 minutes at 4°C. A standard procedure was used to extract total DNA from the pellet. The PCR test was carried out using the prescribed primers following DNA extraction. The final PCR products were sent to the relevant companies for sequencing, and the submitted sequences were reviewed and finalized by comparison with the NCBI Genome Bank (22). The 16s RNA primer sequences used for PCR are:
Forward: 5’–AGAGTTTGATCCTGGCTCAG– 3’
Reverse: 5’– AAGGAGGTGATCCAGCCGCA– 3’

3.5. Preparation of Pathogen Samples

Standard samples of pathogenic bacetria; Streptococcus pyogenes, Salmonella typhi, Acinetobacter baumannii, Klebsiella pneumoniae, and Pseudomonas aeruginosa were obtained from a microbial bank either from available hospitals or samples in a research group.

3.6. Phenotypic Test for Microorganisms That Produce Beta-lactamases

3.6.1. MBL Identification by Phenotypic Confirmatory Testing

An EDTA solution with a concentration of 0.5 M was prepared by adding 46.53 g of disodium EDTA.2H2O into 250 mL of distilled water and adjusting the pH to 8.0 with NaOH (23). Autoclaving was used to disinfect the mixture. Ten grams of imipenem discs were placed on MH agar and one of them acquire 4 μL of an EDTA solution in order to achieve the necessary concentration. The zones of inhibition of the imipenem and imipenem-EDTA discs were evaluated after incubation of 16 to 18 hours at 35°C. The imipenem-EDTA disc in the combination disk test (CDT) had a 7 mm greater inhibitory zone than the imipenem disc alone, confirming the presence of MBL (24).

3.6.2. Assay for Phenotypic Confirmation of Extended-spectrum-lactamase Production

For phenotypic confirmation ceftazidime-clavulanic acid (30/10 mg), ceftazidime (30 mg), cefotaxime-clavulanic acid (30/10 mg) and cefotaxime (30 mg) were used in the CDT. As suggested by CLSI, isolates were tested using Mueller-Hinton agar and antibiotic-specific discs (Padtan Teb Co. Iran) (25). The inhibition zone diameter was confirmed to be phenotypically for extended-spectrum-lactamase (ESBL) production if it was 5 mm greater for clavulanic acid than without (26).

3.6.3. Antimicrobial Metabolite Extraction

The strains were cultured in liquid LB medium and then the Erlenmeyer flakes were placed in a 30°C oven for 24 hours. The whole culture medium was centrifuged at 6000 rpm and the supernatant was filtered through a filter. The final solution was mixed with ethyl acetate. After separating the solvent phase from the aqueous phase, the excess ethyl acetate was evaporated in a bath at 60°C. The extracted crude was stored at 4°C to investigate its antimicrobial activity (27, 28).

3.6.4. Investigation of Antimicrobial Activity of Standard Antibiotics

Antibiotic resistance of pathogenic strains was tested against some standard antibiotics, by using the disc-diffusion technique. Antibiotics used in the study include; ciprofloxacin, clindamycin, cephalexin and amoxicillin/clavulanate.

3.6.5. Investigation of Antimicrobial Activity of Extracted Crude

Disk diffusion was used to examine the crude extract of the strains’ antibacterial activity. First, a dense culture of the studied pathogens was prepared in Müller-Hinton agar medium, and sterile paper disks with a diameter of 6 mm and impregnated with 30 μL of the extracted crude extract were placed separately on the agar surface. As a negative control, a disc was soaked in 30 μL of ethyl acetate. The media were incubated for 24 hours at 37°C, and the diameter of zones of inhibition were evaluated to determine the antibacterial activity of the crude extracts (mm) (29).

3.6.6. Effect of Different Temperatures, pH and Incubation Times on Bacteriocin Activity

The stability and antimicrobial activity of bacteriocin were tested at different temperatures (25°C, 37°C, 45°C, 55°C and 65°C), different pH (2, 4, 7, 11, 14) and with different incubation times (12, 24, 36, 48, 60 and 72 h). The activity of extracted bacteriocin from B. subtilis was tested against each pathogenic bacteria (30).

4. Results

The diagnosis of B. subtilis was made using biochemical characterisation as shown in Table 1 which was further confirmed by 16s rRNA sequencing. The bacteriocin obtained from B. subtilis strains by ethyl acetate extraction method showed significant inhibitory effects on pathogenic bacteria. Bacteriocin activity against pathogens at different incubation times, temperatures, and pH were shown in Tables 2 - 4, respectively. Results for inhibition zones created by standard antibiotics and bacteriocin extracted from B. subtilis are presented in Tables 5 and 6, respectively. Table 6 results showed that Gram-positive bacteria were almost completely inhibited, and S. pyogenes was significantly inhibited by bacteriocin. Gram-negative bacteria were inhibited less than gram-positive bacteria, indicating that A. baumannii and K. pneumoniae were less inhibited against bacteriocin. Comparisons were made between bacteriocin activity and that of the common antibiotics ciprofloxacin, clindamycin, cephalexin, and amoxicillin clavulanate. When compared to the standard antibiotics, the crude extract of bacteriocin from B. subtilis strains significantly inhibited the growth of tested pathogens.
Table 1.Biochemical Characterisation of Bacillus subtilis Strains Isolated from Soil Samples
Biochemical CharacterisationBacillus subtilis
Motility+
Catalase activity+
Glucose uptake by MRVP–/+
Citrate utilization+
Starch hydrolysis+
Indole
Oxidase test
Table 2.Effect of Incubation Time on Antibacterial Activity of Bacteriocin Produced by Bacillus subtilis
Incubation TimeZone of Inhibition
Acinetobacter baumanniiPseudomonas aeruginosaStreptococcus pyogenesSalmonella typhiKlebsiella pneumoniae
127.108.148.208.108.40
2410.8511.9016.9412.5011.45
368.2410.2013.4010.8010.20
487.107.958.408.208.70
60--7.206.957.10
72-----
Table 3.Effect of Differential Temperature on Antibacterial Properties of Bacteriocin Generated by Bacillus subtilis
TemperatureZone of Inhibition in Pathogens
Klebsiella pneumoniaeSalmonella typhiStreptococcus pyogenesPseudomonas aeruginosaAcinetobacter baumannii
2510.2010.6414.2011.9410.40
3713.5214.6717.4513.9811.95
4511.3011.4012.2411.7010.98
558.209.519.208.928.80
65
Table 4.Effect of pH on the Bacteriocin’s Antimicrobial Properties Derived from Bacillus subtilis
pHZone of Inhibition
Acinetobacter baumanniiPseudomonas aeruginosaStreptococcus pyogenesSalmonella typhiKlebsiella pneumoniae
27.167.248.549.348.26
48.219.7110.1210.908.90
711.2014.4117.2514.7413.92
118.558.8413.9410.149.60
147.207.109.207.507.30
Table 5.Inhibition Zone Created by Selective Standard Antibiotics on Pathogenic Bacteria
SpeciesInhibition Zone
Amoxicillin/ ClavulanateClindamycinCephalexinCiprofloxacin
Acinetobacter baumannii13.5714.6413.1014.80
Pseudomonas aeruginosa14.9615.4514.7214.67
Streptococcus pyogenes16.8216.4615.6015.92
Salmonella typhi15.2014.9014.7014.20
Klebsiella pneumoniae15.9115.8616.5414.60
Table 6.Inhibition Zone Created by Bacteriocin Produced by Bacillus subtilis on Bacterial Pathogens
Bacterial StrainInhibition Zone
Klebsiella pneumoniae11.45
Salmonella typhi12.50
Streptococcus pyogenes16.94
Pseudomonas aeruginosa11.90
Acinetobacter baumannii10.85

4.1. The Effect of Incubation Time on Bacillus subtilis Bacteriocin Antimicrobial Activity

Different time intervals (12, 24, 36, 48, 60 and 72) were given for the incubation of samples. The maximum activity was obtained in 24 hours from 12 to 72 hours. In 24 hours, the largest area of inhibition of B. subtilis bacteriocin against S. pyogenes (16.94 mm) was greatest followed by S. typhi and P. aeruginosa (12.50 and 11.90 mm, respectively) was observed. The lowest inhibition zone was detected against A. baumannii (10.85 mm) in 24 hours. With increasing time, the activity of bacteriocin of B. subtilis was decreased as shown in Table 2. No antibacterial activity was observed after 72 hours of incubation. Such activity data might be observed due to the protein nature of bacteriocin.

4.2. The Effect of Temperature on Bacillus subtilis Bacteriocin Antimicrobial Activity

Samples were treated with different temperatures (25, 37, 45, 55 and 65). Treating bacteriocin at different temperatures caused the increase in the activity at 25 to 37°C by treating for 30 min. Bacteriocin activity decreased after heat treatment at 45°C and was lost at 65°C. Maximum antimicrobial activity was observed from a temperature range of, 25 to 65°C. At 37°C, the largest area of inhibition of B. subtilis bacteriocin against S. pyogenes (17.45) is observed followed by S. typhi and K. pneumoniae (14.67 and 13.52), respectively. The lowest inhibition zone, was detected against A. baumannii (11.95). The data showed that as the temperature was increased, and bacteriocin activity decreased since no antimicrobial activity was observed after 65°C.

4.3. Effect of pH on the Antibacterial Activity of Bacillus subtilis’s Bacteriocin

Samples were treated with different pH (2, 4, 7, 11 and 14). At pH 7, the largest area of inhibition of B. subtilis bacteriocin against S. pyogenes (17.25), followed by S. typhi and P. aeruginosa (14.74 and 14.41). The lowest inhibition zone, was detected against A. baumannii (11.20). Bacteriocin B. subtilis had the highest activity at neutral pH which is 7 and significantly reduced activity was observed at acidic and basic pH which is 2, 4, 11 and 14.
Inhibitory activity against standard antibiotics such as; ciprofloxacin, clindamycin, cephalexin and amoxicillin/clavulanate were shown in Table 5 to compare them with bacteriocin activity. The bacteriocin B. subtilis showed significant inhibitory activity against the tested pathogens compared to standard antibiotics, as shown in Table 6.
The largest area of inhibition of B. subtilis bacteriocin, was observed against S. pyogenes (16.94 mm), followed by S. typhi and P. aeruginosa (12.50 and 11.90 mm, respectively). The lowest inhibition zone was detected against A. baumannii (10.85 mm), as shown in Table 6.
Standard antibiotics such as ciprofloxacin, clindamycin, cephalexin and amoxicillin/ clavulanate were compared with bacteriocin activity. The bacteriocin B. subtilis showed significant inhibitory activity against the tested pathogens compared to standard antibiotics as shown in Table 6. The largest area of inhibition of amoxicillin/clavulanate (16.82) showed great antimicrobial activity for S. pyogenes followed by clindamycin and ciprofloxacin (16.46 and 15.92) respectively.
By plotting the bacterial growth curve, the effect of bacteriocin on S. pyogenes was investigated. To obtain growth curves for the bacteria, absorbance was measured at various intervals of time (0, 2, 4, 6, 8, 10, 12, 14, and 18 hours (Figure 1). Figure 2 shows comparing inhibition zones of S. typhi under the action of antimicrobial disk and bacteriocin.
Evaluation of bacteriocin produced by <i>Bacillus subtilis</i> on the growth curve of <i>Streptococcus pyogenes</i>
Figure 1.

Evaluation of bacteriocin produced by Bacillus subtilis on the growth curve of Streptococcus pyogenes

Inhibition zones for <i>Salmonella typhi</i> under the action of antimicrobial disk and bacteriocin produced by <i>Bacillus subtilis</i>
Figure 2.

Inhibition zones for Salmonella typhi under the action of antimicrobial disk and bacteriocin produced by Bacillus subtilis

5. Discussion

The bacteriocin from B. subtilis showed inhibitory effects on antimicrobial-resistant pathogenic microbes like; S. pyogenes, S. typhi, P. aeruginosa, K. pneumonia, and A. baumannii. Of which, bacteriocin showed the highest antibacterial activity against gram-positive pathogenic bacteria, S. pyogenes. Among gram-negative pathogens used in this study, bacteriocin showed high antibacterial activity against S. typhi, followed by a similar kind of inhibitory effect against P. aeruginosa and K. pneumonia. While the lowest antibacterial activity was observed against gram-negative bacteria A. baumannii. Numerous studies have identified bacteriocins from different microbial sources and studied their antibacterial activity against distinct bacterial species (31). Colicin was the first bacteriocin discovered, in 1925. Later researchers discovered that many gram-positive, as well as gram-negative bacteria have a widespread ability to create these antimicrobial peptides. These compounds are meant to provide a competitive advantage to their producers over other microbes (14, 32). Bacteriocins are a heterologous group of proteinaceous antibacterial compounds produced by bacteria of all main lineages and are synthesized by ribosome synthesis. They show differential antimicrobial potency, sizes, structures, immunity mechanisms, and modes of action (33, 34). They have a high level of target specificity towards closely related bacteria, even though many of them have a broader range of activity (35).
Bacillus subgroups have been found to produce a wide range of bacteriocins with different molecular weights as a result. Bacillus, soil-dwelling bacteria, was discovered to be capable of producing many antimicrobial chemicals that were also determined to be safe to use (36). The following points set bacteriocins apart from antimicrobial drugs: (1) bacteriocins are produced on the ribosomal surface of bacterial cells, whereas antibiotics are secondary metabolites of bacteria (37); (2) antibiotic producers are susceptible to antimicrobial agents, while bacteriocin producers are resistant to antimicrobial agents (38); (3) since the target bacterial cell surface lacks any specialized receptors, bacteriocins can attach to the bacterial cell surface everywhere (17).
There is a wide range of bacteriocins found in B. subtilis which are referred to as class I and II. Class I can undergo post-translational modifications and class II ones are small, ribosomally synthesised peptides, which show pH- and heat-stability (7). It’s vital to identify real bacteriocin ribosomal production in the instance of Bacillus, because this bacterium is notorious for producing antimicrobial peptides via non-ribosomal synthesis too. It is presently predicted that at least 4 - 5% of the genome of any B. subtilis strain is dedicated to the production of antimicrobial compounds (AMCs) (39).
The Bacillus genus sensu lato produced bacteriocins and BLIS, are most likely second in importance only to LAB-produced bacteriocins. Strains of the Bacillus genus produce a variety of antimicrobial peptides with various fundamental chemical structures (8, 40). As bacterial resistance to conventional antibiotics in clinical use increases, bacteriocins are being evaluated as a substitute for antibiotics used to treat human diseases (41). Cross-resistance between frequently used antibiotics and bacteriocins have been uncommon since these 2 forms of antibiotics focus on different biological targets. Bacteriocins, also known as BLIS, are produced by Bacillus species and exhibit antibacterial efficacy against harmful bacteria including VRE and MRSA. Examples include the lantibiotics, haloduracin, or the BLIS produced by Bacillus sphaericus (42).
In both human and veterinary medicine, the ESBL-producing Enterobacteriaceae has become an issue. A resistance mechanism in Enterobacteriaceae that lowers the effectiveness of expanded spectrum cephalosporins and monobactams is currently of attention (43, 44). Bacteriocins produced by lactic acid bacteria have come to light as potential substitutes for food preservatives as a result of this circumstance because they exhibit inhibitory activity against MDR pathogens (44). Although bacteriocins are typically quite strong, they only work against organisms that are phylogenetically related to the bacteria that produce them (45). When a strain that does not produce bacteriocin, contains a gene similar to the self-defence gene of bacteriocin-producing bacterium, mimicking natural defence immunity takes place. When bacteria are attacked, they release enzymes that break down bacteriocin peptides; a defensive molecule called nisinase, is produced by Bacillus cereus and Paenibacillus polymyxa, responsible for the breakdown of nisin (46).
More studies showed bacteriocins are produced by B. subtilis and have antibacterial effects against some human and animal pathogens, including multidrug-resistant ones too. A bacteriocin named Bacillion22, was isolated and purified from B. subtilis which showed antimicrobial activity against some food-borne pathogens (47). A recent study showed that marine B. subtilis (BacSM01) can significantly suppress the growth of methicillin-resistant Staphylococcus aureus as well as ESBL-producing gram-negative pathogens like; A. baumannii, P. aeruginosa, and Escherichia coli (30). In another study, B. subtilis isolated from soil samples showed antibacterial activity against 4 types of diabetic foot ulcer-causing pathogens; Pseudomonas spp., Staphylococcus spp., Klebsiella spp. and Proteus spp. The partially purified bacteriocin from B. subtilis showed high antibacterial activity against Klebsiella spp. (9). Plant-derived B. subtilis MK733983 strain showed antibacterial activity against a broad-range of bacteria; S. aureus, P. aeruginosa, K. pneumoniae, E. coli and Chromobacterium violaceum and highest antimicrobial activity was observed against Mycobacterium smegmatis (48). Bacteriocin isolated from soil; isolate B. subtilis GAS101, showed good inhibitory activity against both gram-positive and gram-negative indicator bacteria Staphylococcus epidermidis and E. coli. Bacteriocin showed a good broad-range of antimicrobial activity along with anti-biofilm activity (19). In one research it was revealed that B. subtilis KKU213 strain produce Subtilosin A; which is a mixture of extracellular antibacterial peptides, exhibited inhibitory activity against B. cereus, Listeria monocytogenes, Micrococcus luteus, and S. aureus (49).
Some studies have evaluated the effects of different incubation times, pH and temperatures and also the action of some chemical compounds (proteolytic and non-proteolytic) on bacteriocin activity against pathogens. Additionally, the duration of incubation is crucial for bacteriocin activity. Bac-maximal SM01’s antibacterial activity was reached in the BHIB medium after 24 hours. Bac-SM01 generated either lost its activity during incubation or became unstable at 72 hours as evidenced by the inability to detect the antibacterial activity of the bacteriocin at that time (30). Bacteriocin from soil isolate B. subtilis GAS101 showed pH and temperature stability in its activity at temperature ranges of 30 - 121°C and pH ranges of 2 - 12 (19). Similarly, bacteriocin isolated from B. subtilis soil isolate which showed phylogenetic similarity with B. subtilis BSF01 showed stability in its activity at a temperature range of 40 - 100 °C and even at both acidic and basic pH with a high level of activity at acidic pH (9). While in another study, bacteriocin isolated from B. subtilis strain RLID 12.1, maximum activity was observed at pH range 6.0 - 8.0, while the stable and maximum activity was noted at 37°C and 80 - 90% of activity at temperature range 50 - 100 °C (50). Another research too showed differential activity of bacteriocin isolated from B. subtilis at incubation time, pH and temperature of, 24 h, 7, and 37°C, respectively (30). This differential stability of bacteriocin activity showed a similar type of variability in the results obtained in this study.
In this study, bacteriocin showed a wide variety of activity when exposed to different temperatures, pH levels, incubation times, and antibiotics. For differential parameters of incubation time, pH and temperature, maximum bacteriocin inhibitory activity was observed at an incubation time of; 24 h, pH 7.0, and a temperature of 37°C. While considerably good bacteriocin activity was observed, between 24 - 37 hours of incubation time, 4 - 11 pH ranges, and 25 - 45 temperature ranges. Standard antibiotics ciprofloxacin, clindamycin, cephalexin, and amoxicillin-clavulanate were used and compared with an inhibitory effect of bacteriocin against selected pathogenic strains. When compared to standard antibiotics, the bacteriocin B. subtilis demonstrated a significant inhibitory effect against the pathogens studied especially, at 24 hours of incubation time, at neutral pH of 7.0 and 37°C of temperature. The largest area of inhibition of B. subtilis bacteriocin was against S. pyogenes. The lowest inhibition zone, was detected against A. baumannii.
The use of bacteriocins as a medicinal agent against human diseases is still in the research and development stage, but they are already being used commercially for food preservation and as a probiotic. This is causing great enthusiasm in the scientific and medical communities. Bacteriocins can be used in conjunction with antibiotics to lessen undesirable side effects while maintaining antibiotic efficiency. Additionally, this would aid in halting the emergence of bacteria resistant to bacteriocin and antibiotics (51). According to WHO and World Bank reports, antimicrobial resistance poses a serious threat to public health, which might increase further by approximately estimated deaths of 10 million people, by 2050, making it a burden on the healthcare system and economy of the countries (52). Hence, there is a dire need for alternative medicines and bacteriocin produced by B. subtilis can be considered a better alternative to traditional antibiotics to treat antibiotic-resistant pathogen-related infections.

5.1. Conclusions

The current study’s findings lead us to conclude that bacteriocin isolated from B. subtilis obtained from soil samples can be a significant chemical compound for bacterial pathogen control. As an alternative to standard antibiotics, this molecule is very specific. Due to different types of bacteriocins produced by B. subtilis isolated from various sources, the differential activity and stability are observed at varying parameters like; temperature, pH and incubation time. Hence, further investigation is essential to study the chemical nature or class (I or II) of bacteriocin produced by B. subtilis in this study. Considering that, the bacteriocins are produced as a competitive strategy, which acts against closely related bacteria. This might be a reason the good inhibitory activity of bacteriocin was observed against gram-positive bacteria than gram-negative ones. Further analysis of, the chemical nature of extracted bacteriocin can help to shed a more light on it.

Footnotes

References

  • 1.
    World Health Organization. Antimicrobial resistance. Geneva, Switzerland: World Health Organization; 2021. Available from: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance.
  • 2.
    Bush K, Bradford PA. Epidemiology of beta-Lactamase-Producing Pathogens. Clin Microbiol Rev. 2020;33(2). [PubMed ID: 32102899]. [PubMed Central ID: PMC7048014]. https://doi.org/10.1128/CMR.00047-19.
  • 3.
    World Health Organization. WHO publishes list of bacteria for which new antibiotics are urgently needed. Geneva, Switzerland: World Health Organization; 2017. Available from: https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed.
  • 4.
    O'Sullivan L, Ross RP, Hill C. Potential of bacteriocin-producing lactic acid bacteria for improvements in food safety and quality. Biochimie. 2002;84(5-6):593-604. [PubMed ID: 12423803]. https://doi.org/10.1016/s0300-9084(02)01457-8.
  • 5.
    Nicholson WL. Roles of Bacillus endospores in the environment. Cell Mol Life Sci. 2002;59(3):410-6. [PubMed ID: 11964119]. https://doi.org/10.1007/s00018-002-8433-7.
  • 6.
    Chopra L, Singh G, Kumar Jena K, Sahoo DK. Sonorensin: A new bacteriocin with potential of an anti-biofilm agent and a food biopreservative. Sci Rep. 2015;5:13412. [PubMed ID: 26292786]. [PubMed Central ID: PMC4544038]. https://doi.org/10.1038/srep13412.
  • 7.
    Abriouel H, Franz CM, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins. FEMS Microbiol Rev. 2011;35(1):201-32. [PubMed ID: 20695901]. https://doi.org/10.1111/j.1574-6976.2010.00244.x.
  • 8.
    Stein T. Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol. 2005;56(4):845-57. [PubMed ID: 15853875]. https://doi.org/10.1111/j.1365-2958.2005.04587.x.
  • 9.
    Joseph B, Dhas B, Hena V, Raj J. Bacteriocin from Bacillus subtilis as a novel drug against diabetic foot ulcer bacterial pathogens. Asian Pac J Trop Biomed. 2013;3(12):942-6. [PubMed ID: 24093784]. [PubMed Central ID: PMC3805101]. https://doi.org/10.1016/S2221-1691(13)60183-5.
  • 10.
    Bierbaum G, Sahl HG. Lantibiotics: mode of action, biosynthesis and bioengineering. Curr Pharm Biotechnol. 2009;10(1):2-18. [PubMed ID: 19149587]. https://doi.org/10.2174/138920109787048616.
  • 11.
    Teixeira ML, Rosa AD, Brandelli A. Characterization of an antimicrobial peptide produced by Bacillus subtilis subsp. spizezinii showing inhibitory activity towards Haemophilus parasuis. Microbiology (Reading). 2013;159(Pt 5):980-8. [PubMed ID: 23519163]. https://doi.org/10.1099/mic.0.062828-0.
  • 12.
    Bizani D, Motta AS, Morrissy JA, Terra RM, Souto AA, Brandelli A. Antibacterial activity of cerein 8A, a bacteriocin-like peptide produced by Bacillus cereus. Int Microbiol. 2005;8(2):125-31. [PubMed ID: 16052461].
  • 13.
    Luo XZ, Shi BH, Zheng H, Wei-Bin WU, Shi QQ. Physical and chemical properties and antimicrobial spectrum of subtilin from Bacillus subtilis FB123. J Microbiol. 2008;28:64-7.
  • 14.
    Simons A, Alhanout K, Duval RE. Bacteriocins, Antimicrobial Peptides from Bacterial Origin: Overview of Their Biology and Their Impact against Multidrug-Resistant Bacteria. Microorganisms. 2020;8(5). [PubMed ID: 32349409]. [PubMed Central ID: PMC7285073]. https://doi.org/10.3390/microorganisms8050639.
  • 15.
    Yasir M, Zeshan B, Daud NHA, Shahid I, Khalid H. Characterization of bacteriocin and chitinase producing bacterial isolates with broad-spectrum antimicrobial activities. SN Appl Sci. 2021;3(8). https://doi.org/10.1007/s42452-021-04740-z.
  • 16.
    Adebayo CO, Aderiye BI. Antifungal Activity of Bacteriocins of Lactic Acid Bacteria from Some Nigerian Fermented Foods. Res J Microbiol. 2010;5(11):1070-82. https://doi.org/10.3923/jm.2010.1070.1082.
  • 17.
    Sanders ME. Probiotics: definition, sources, selection, and uses. Clin Infect Dis. 2008;46 Suppl 2:S58-61. discussion S144-51. [PubMed ID: 18181724]. https://doi.org/10.1086/523341.
  • 18.
    Thirabunyanon M, Thongwittaya N. Protection activity of a novel probiotic strain of Bacillus subtilis against Salmonella Enteritidis infection. Res Vet Sci. 2012;93(1):74-81. [PubMed ID: 21907374]. https://doi.org/10.1016/j.rvsc.2011.08.008.
  • 19.
    Sharma G, Dang S, Gupta S, Gabrani R. Antibacterial Activity, Cytotoxicity, and the Mechanism of Action of Bacteriocin from Bacillus subtilis GAS101. Med Princ Pract. 2018;27(2):186-92. [PubMed ID: 29402863]. [PubMed Central ID: PMC5968280]. https://doi.org/10.1159/000487306.
  • 20.
    Madika A, Ameh JB, Machido DA. Isolation and screening of Bacillus subtilis from soil for amylase production. UJMR. 2017;2:82-6.
  • 21.
    Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. Bergey's manual of determinative bacteriology. 9th ed. Philadelphia, USA: Lippincott Williams & Wilkins; 1994.
  • 22.
    Saleh F, Kheirandish F, Azizi H, Azizi M. Molecular Diagnosis and Characterization of Bacillus subtilis Isolated from Burn Wound in Iran. Res Mol Med. 2014;2(2):40-4. https://doi.org/10.18869/acadpub.rmm.2.2.40.
  • 23.
    Minhas N, Sharma P. Phenotypic detection of metallo and AmpC β-lactamases producing strains of P. aeruginosa in the state of Himachal Pradesh (India). Al Ameen J Med Sci. 2015;8(4):259-65.
  • 24.
    Yong D, Lee K, Yum JH, Shin HB, Rossolini GM, Chong Y. Imipenem-EDTA disk method for differentiation of metallo-beta-lactamase-producing clinical isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol. 2002;40(10):3798-801. [PubMed ID: 12354884]. [PubMed Central ID: PMC130862]. https://doi.org/10.1128/JCM.40.10.3798-3801.2002.
  • 25.
    Webb HE, Bugarel M, den Bakker HC, Nightingale KK, Granier SA, Scott HM, et al. Carbapenem-Resistant Bacteria Recovered from Faeces of Dairy Cattle in the High Plains Region of the USA. PLoS One. 2016;11(1). e0147363. [PubMed ID: 26824353]. [PubMed Central ID: PMC4732617]. https://doi.org/10.1371/journal.pone.0147363.
  • 26.
    Lee K, Lim YS, Yong D, Yum JH, Chong Y. Evaluation of the Hodge test and the imipenem-EDTA double-disk synergy test for differentiating metallo-beta-lactamase-producing isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol. 2003;41(10):4623-9. [PubMed ID: 14532193]. [PubMed Central ID: PMC254300]. https://doi.org/10.1128/JCM.41.10.4623-4629.2003.
  • 27.
    Parthasarathi S, Sathya S, Bupesh G, Samy RD, Mohan MR, Kumar GS, et al. Isolation and characterization of antimicrobial compound from marine Streptomyces hygroscopicus BDUS 49. World J Fish Mar Sci. 2012;4(3):268-77.
  • 28.
    Amin M, Rakhisi Z, Zarei Ahmady A. Isolation and Identification of Bacillus Species From Soil and Evaluation of Their Antibacterial Properties. Avicenna J Clin Microb Infec. 2015;2(1):23233. https://doi.org/10.17795/ajcmi-23233.
  • 29.
    Abu-Mejdad NMJA, Aaiz FL, Jassim OT. Antifungal activity of ethyl acetate extract of four species Bacillus isolated from soil. J Am Sci. 2013;9(10).
  • 30.
    Mickymaray S, Alturaiki W, Al-Aboody MS, Mariappan P, Rajenderan V, Alsagaby SA, et al. Anti-bacterial efficacy of bacteriocin produced by marine Bacillus subtilis against clinically important extended spectrum beta-lactamase strains and methicillin-resistant Staphylococcus aureus. Int J Med Res Health Sci. 2018;7(2):75-83.
  • 31.
    Kaskoniene V, Stankevicius M, Bimbiraite-Surviliene K, Naujokaityte G, Serniene L, Mulkyte K, et al. Current state of purification, isolation and analysis of bacteriocins produced by lactic acid bacteria. Appl Microbiol Biotechnol. 2017;101(4):1323-35. [PubMed ID: 28070665]. https://doi.org/10.1007/s00253-017-8088-9.
  • 32.
    Majeed H, Gillor O, Kerr B, Riley MA. Competitive interactions in Escherichia coli populations: the role of bacteriocins. ISME J. 2011;5(1):71-81. [PubMed ID: 20664553]. [PubMed Central ID: PMC3105674]. https://doi.org/10.1038/ismej.2010.90.
  • 33.
    Riley MA, Wertz JE. Bacteriocins: evolution, ecology, and application. Annu Rev Microbiol. 2002;56:117-37. [PubMed ID: 12142491]. https://doi.org/10.1146/annurev.micro.56.012302.161024.
  • 34.
    Gillor O, Etzion A, Riley MA. The dual role of bacteriocins as anti- and probiotics. Appl Microbiol Biotechnol. 2008;81(4):591-606. [PubMed ID: 18853155]. [PubMed Central ID: PMC2670069]. https://doi.org/10.1007/s00253-008-1726-5.
  • 35.
    Jack RW, Tagg JR, Ray B. Bacteriocins of gram-positive bacteria. Microbiol Rev. 1995;59(2):171-200. [PubMed ID: 7603408]. [PubMed Central ID: PMC239359]. https://doi.org/10.1128/mr.59.2.171-200.1995.
  • 36.
    Hammami I, Jaouadi B, Bacha AB, Rebai A, Bejar S, Nesme X, et al. Bacillus subtilis bacteriocin Bac 14B with a broad inhibitory spectrum: Purification, amino acid sequence analysis, and physicochemical characterization. Biotechnol Bioproc E. 2012;17(1):41-9. https://doi.org/10.1007/s12257-010-0401-8.
  • 37.
    Santos VL, Nardi Drummond RM, Dias-Souza MV. Bacteriocins as Antimicrobial and Antibiofilm Agents. In: Thomaz-Soccol V, Pandey A, Resende RR, editors. Current Developments in Biotechnology and Bioengineering. 2017. p. 403-36. https://doi.org/10.1016/b978-0-444-63660-7.00016-4.
  • 38.
    Vijayakumar PP, Muriana PM. Inhibition of Listeria monocytogenes on Ready-to-Eat Meats Using Bacteriocin Mixtures Based on Mode-of-Action. Foods. 2017;6(3). [PubMed ID: 28335414]. [PubMed Central ID: PMC5368541]. https://doi.org/10.3390/foods6030022.
  • 39.
    Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, et al. Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol. 2007;25(9):1007-14. [PubMed ID: 17704766]. https://doi.org/10.1038/nbt1325.
  • 40.
    Gebhardt K, Schimana J, Muller J, Fiedler HP, Kallenborn HG, Holzenkampfer M, et al. Screening for biologically active metabolites with endosymbiotic bacilli isolated from arthropods. FEMS Microbiol Lett. 2002;217(2):199-205. [PubMed ID: 12480104]. https://doi.org/10.1111/j.1574-6968.2002.tb11475.x.
  • 41.
    Lawton EM, Ross RP, Hill C, Cotter PD. Two-peptide lantibiotics: a medical perspective. Mini Rev Med Chem. 2007;7(12):1236-47. [PubMed ID: 18220976]. https://doi.org/10.2174/138955707782795638.
  • 42.
    Smitha S, Sarita G B. Characterization of Bacteriocins from Bacillus licheniformis strain BTHT8 and Bacillus subtilis strain BTFK101 isolated from marine sediment [dissertation]. Kochi, India: Cochin University of Science and Technology; 2014.
  • 43.
    Jena PK, Trivedi D, Chaudhary H, Sahoo TK, Seshadri S. Bacteriocin PJ4 active against enteric pathogen produced by Lactobacillus helveticus PJ4 isolated from gut microflora of wistar rat (Rattus norvegicus): partial purification and characterization of bacteriocin. Appl Biochem Biotechnol. 2013;169(7):2088-100. [PubMed ID: 23371780]. https://doi.org/10.1007/s12010-012-0044-7.
  • 44.
    Biswas K, Upadhayay S, Rapsang GF, Joshi SR. Antibacterial and Synergistic Activity Against β-Lactamase-Producing Nosocomial Bacteria by Bacteriocin of LAB Isolated From Lesser Known Traditionally Fermented Products of India. HAYATI J Biosci. 2017;24(2):87-95. https://doi.org/10.1016/j.hjb.2017.08.008.
  • 45.
    Dicks LMT, Dreyer L, Smith C, van Staden AD. Corrigendum: A Review: The Fate of Bacteriocins in the Human Gastro-Intestinal Tract: Do They Cross the Gut-Blood Barrier? Front Microbiol. 2018;9:2938. [PubMed ID: 30546355]. [PubMed Central ID: PMC6284148]. https://doi.org/10.3389/fmicb.2018.02938.
  • 46.
    Bastos Mdo C, Coelho ML, Santos OC. Resistance to bacteriocins produced by Gram-positive bacteria. Microbiology (Reading). 2015;161(Pt 4):683-700. [PubMed ID: 25406453]. https://doi.org/10.1099/mic.0.082289-0.
  • 47.
    Zheng G, Slavik MF. Isolation, partial purification and characterization of a bacteriocin produced by a newly isolated Bacillus subtilis strain. Lett Appl Microbiol. 1999;28(5):363-7. [PubMed ID: 10347890]. https://doi.org/10.1046/j.1365-2672.1999.00545.x.
  • 48.
    Santhi Sudha S, Aranganathan V. Experimental elucidation of an antimycobacterial bacteriocin produced by ethnomedicinal plant-derived Bacillus subtilis (MK733983). Arch Microbiol. 2021;203(5):1995-2006. [PubMed ID: 33544157]. [PubMed Central ID: PMC7863612]. https://doi.org/10.1007/s00203-020-02173-7.
  • 49.
    Khochamit N, Siripornadulsil S, Sukon P, Siripornadulsil W. Antibacterial activity and genotypic-phenotypic characteristics of bacteriocin-producing Bacillus subtilis KKU213: potential as a probiotic strain. Microbiol Res. 2015;170:36-50. [PubMed ID: 25440998]. https://doi.org/10.1016/j.micres.2014.09.004.
  • 50.
    Ramachandran R, Chalasani AG, Lal R, Roy U. A broad-spectrum antimicrobial activity of Bacillus subtilis RLID 12.1. ScientificWorldJournal. 2014;2014:968487. [PubMed ID: 25180214]. [PubMed Central ID: PMC4144302]. https://doi.org/10.1155/2014/968487.
  • 51.
    Bonhi KLR, Imran S. Role Of Bacteriocin In Tackling The Global Problem Of Multi-Drug Resistance : An Updated Review. Biosci Biotechnol Res Commun. 2019;12(3):601-8. https://doi.org/10.21786/bbrc/12.3/8.
  • 52.
    The World Bank. Antimicrobial Resistance (AMR). Washington, D. C., USA: The World Bank; 2021. Available from: https://www.worldbank.org/en/topic/health/brief/antimicrobial-resistance-amr.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC