1. Background
Helicobacter pylori is an opportunistic pathogen specific to humans. This gram-negative bacterium with microaerophilic metabolism can colonize in the acidic conditions of the stomach and cause various diseases such as gastritis, gastric ulcers, and gastric carcinoma (1, 2). Eighty percent of people infected with H. pylori are asymptomatic (3, 4). However, various diseases can be caused by H. pylori due to specific characteristics of the microorganism, such as virulence genes, antibiotic resistance, and host genetic and environmental factors (5). The virulence genes of this bacterium encode proteins that help the bacteria attach to and damage the gastric epithelium. Outer membrane proteins (OMPs) such as babA, sialic acid-binding factor (sabA), and oipA adhesins are present on the surface of the bacteria to attach to the gastric epithelium and initiate colonization processes (6, 7). Among other pathogenic factors of this microorganism, the cagA and vacA genes are the most important pathogenic factors that play a key role in the pathogenesis of the infection. VacA is a secreted cytotoxin with a molecular weight of 140 kDa that is cleaved at both ends and becomes active inside the host cell, which can cause vacuolation of epithelial cells (8). All strains of H. pylori have the vacA gene, but their level of activity depends on the specific genotype of this gene. The vacA genotype contains a hypervariable signal sequence and an intermediate region allele (9). The binding of this toxin to H. pylori strains carrying the vacA gene depends on changes in these two regions. Several studies have shown that the vacA s1m1 genotype, especially in combination with the cagA gene, is associated with severe gastric disease. This could help to identify high-risk patients and pave the way for targeted treatment and prevention (10, 11). S1m2 can induce cellular vacuoles, and s2m2 strains have no cytotoxic activity, and s2m1 strains are rare (9, 12).
The cagA gene is located at the end of the pathogenicity island (cagA-PAI) and encodes a protein of 125 - 145 kDa (13-15). Glu-Pro-Ile-Tyr-Ala (EPIYA) motifs are located at the C-terminal end of this protein, which is phosphorylated by host cell kinases (16). CagA-PAI is about 40 kb, and there are 31 different genes such as the type 4 secretion system (T4SS) in this region (17). CagA is transported into the host epithelial cell by the T4SS and phosphorylated by two kinases at the EPIYA site. After transport, cagA alters gastric epithelial cell signaling, leading to the production of cytokines that contribute to chronic gastritis and cancer induction (18). This protein, through direct activation of NFkB, causes the release of interleukin (IL-8), which plays an important role in chronic inflammation and cancer induction. CagA-positive strains cause more severe inflammation than cagA-negative strains (19, 20).
One of the known adhesins with the ability to bind to Lewis blood group antigens located in gastric epithelial cells is called babA. The product of the babA2 allele is more important and essential for binding to Lewis blood group antigens than the other known alleles for babA, which include babA1, A2, and B (5). BabA binding facilitates the entry of vacA and cagA into cells (21, 22). Some studies have shown that H. pylori strains that simultaneously express cagA, vacA, and babA increase the risk of intestinal metaplasia (23).
The sabA is a 70-kDa OMP that binds to sialyl-dimeric-LewisX antigens. Studies in rhesus monkeys have shown that during chronic infections, the expression of babA adhesin is reduced, but conversely, the expression of LewisX antigens on inflamed and infected tissue is increased. At this time, H. pylori probably binds to the gastric mucosa with sabA, increasing the risk of diseases such as intestinal metaplasia and gastric atrophy (24, 25). Furthermore, binding of H. pylori to the surface of neutrophils via sabA induces an immune response (22).
Extrinsic inflammatory protein (oipA) is a 35 kDa protein whose receptor is not precisely known, but it induces increased IL-8 release, inflammation, and the apoptosis cascade of host cells through binding to epithelial cells (26).
Given the high prevalence of H. pylori in gastrointestinal diseases and the relationship between the virulence factors of this bacterium and the importance of its virulence genes in causing various diseases, it is of great importance to study the prevalence and determine the frequency of the pathogenic genes of this bacterium in each geographical region of the country.
2. Objectives
Given the few studies conducted on this subject in Qazvin, this study aimed to investigate the prevalence of virulence genes (babA, cagA, oipA, and sabA, especially vacA) in H. pylori strains isolated from patients referred to Qazvin Velayat Hospital with digestive problems using polymerase chain reaction (PCR) analysis.
3. Methods
3.1. Sample Collection
This descriptive cross-sectional study was conducted on patients with upper gastrointestinal discomfort who required diagnostic endoscopy based on the physician's evaluation. The study was carried out from July 2023 to September 2023 in the Endoscopy Department of Velayat Qazvin Hospital. During this period, all consecutive patients who met the inclusion criteria were invited to participate in the study. Exclusion criteria included prior antibiotic use within the last four weeks and refusal to provide written informed consent. The study protocol was approved by the Ethics Committee of Qazvin University of Medical Sciences (IR.QUMS.REC.1401.204), and informed consent was obtained from all participants before sample collection. During endoscopy, gastric biopsy samples were collected under sterile conditions. Each biopsy specimen was immediately placed in Stuart's transport medium and transferred at 4°C to the Qazvin Medical Microbiology Research Center within 2 hours. For optimal bacterial recovery, each sample was homogenized in Brucella broth and cultured on Brucella agar supplemented with 5% sheep blood. The cultures were incubated for 4 - 7 days at 37°C under microaerophilic conditions.
3.2. Confirmation of Culture and Phenotype of Helicobacter pylori
After growth in the culture medium, gram-negative spiral bacilli were stained by the gram method, and positive results of biochemical tests for urease, catalase, and oxidase phenotypically confirmed H. pylori.
3.3. DNA Extraction and Genotypic Confirmation
In this study, ureC (glmM) was used as a conserved gene for genotypic identification and confirmation of H. pylori strains. The product of this gene is a protein that plays a role in cell wall synthesis and is not related to urease activity (27). After confirming the genotype of the strains, virulence genes including vacAs, vacAm, babA, sabA, cagA, and oipA were identified using PCR. The sequences of the primers used in this study are shown in Table 1.
Table 1.The Primers Utilized in the Study
| Primer Names; Nucleotide Sequence (5’->3’) | Annealing Temperature | Band Size (bp) | Ref. |
|---|---|---|---|
| ureC | 55 | 249 | (10) |
| F: AAGCTTTTAGGGGTGTTAGGGGTTT | |||
| R: AAGCTTACTTTCTAACACTAACGC | |||
| sabA | 45 | 326 | This study |
| F: ATACAATCAAGTCAATAC | |||
| R: ATATGTCAGAAGAAGAAT | |||
| babA | 50 | 278 | This study |
| F: GGAATGTCTTAGGCTATG | |||
| R: GCATGTGTAAGTATAGGT | |||
| oipA | 43 | 567 | This study |
| F: TATTCATCATTATTCCAA | |||
| R: AAATTCATTATTCCCTAA | |||
| cagA | 45 | 309 | This study |
| F: AAAGATAACAGATAAAGT | |||
| R: TTGAGTCCATTATTATTG | |||
| vacAm | 55 | mL: 567/m2: 642 | (5) |
| F: CAATCTGTCCAATCAAGCGAG | |||
| R: GCGTCAAAATAATTCCAAGG | |||
| vacAs | 54 | s1: 259/s2: 286 | (5) |
| F: ATGGAAATACAACAAACACAC | |||
| R: CTGCTTGAATGCGCCAAAC |
Abbreviation: SabA, sialic acid-binding factor.
3.4. Polymerase Chain Reaction
To perform PCR, 10 μL of Mastermix (Kiagen Technologies), 0.5 mM of each primer (Sinaclon, IRAN), 10 ng of template DNA, and distilled water were used for a final volume of 20 μL. For each PCR experiment, nuclease-free water was used as a negative control. Thermal cycling conditions set for performing PCR in a thermocycler system (ABI SimpliAmp, Germany) were 95°C for 5 minutes in the pre-denaturation mode, followed by 30 cycles of denaturation at 95°C for 1 minute, annealing at the temperature indicated in Table 1 for 40 seconds, and extension at 72°C for 50 seconds. A final extension was conducted at 72°C for 10 minutes. Amplification was visualized on a 1% (w/v) agarose gel stained with a DNA green indicator.
3.5. Data Analysis
The data obtained from this study were evaluated using SPSS software version 20.0.
4. Results
Of the 79 samples collected, 32 strains of H. pylori were confirmed phenotypically and genotypically. The babA gene was identified in 59.3% (19/32) of cases, the sabA gene in 81.2% (26/32), the cagA gene in 50% (16/32) of cases, and the oipA gene in 71.8% (23/32) of cases (Table 2).
Table 2.Results of vacA Genotype and Virulence Genes in Different Strains of Helicobacter pylori
| Isolates | Virulence Gene | VacA Genotype |
|---|---|---|
| 1 | babA | s1m2 |
| 2 | babA | s1m2 |
| 3 | babA/oipA/cagA | s1m2 |
| 4 | babA/sabA/oipA/cagA | s1m2 |
| 5 | babA/sabA/oipA/cagA | s1m2 |
| 6 | sabA/oipA/cagA | s1m1 |
| 7 | babA/sabA/oipA/cagA | s1m2 |
| 8 | babA/sabA/oipA/cagA | s2m2 |
| 9 | sabA | s2m2 |
| 10 | sabA/oipA | s1m2 |
| 11 | babA/sabA/oipA | s1m2 |
| 12 | babA/cagA | S1m1 |
| 13 | babA/sabA/oipA/cagA | S1m2 |
| 14 | sabA/oipA | S2m2 |
| 15 | sabA/oipA | s2m2 |
| 16 | sabA/oipA | s2m1 |
| 17 | sabA | s2m2 |
| 18 | sabA | s2m2 |
| 19 | sabA/oipA/cagA | s2m2 |
| 20 | SabA/oipA | s1m2 |
| 21 | babA/sabA/oipA | s1m2 |
| 22 | babA/sabA/oipA/cagA | s1m2 |
| 23 | babA/oipA/cagA | s2m2 |
| 24 | babA/sabA/oipA/cagA | s1m1 |
| 25 | babA/sabA/oipA/cagA | s1m1 |
| 26 | sabA/oipA | s2m2 |
| 27 | babA/sabA/oipA/cagA | s1m2 |
| 28 | sabA | s1m2 |
| 29 | sabA/oipA/cagA | s1m2 |
| 30 | babA/sabA/oipA | s1m1 |
| 31 | babA | s1m1 |
| 32 | babA/sabA/oipA/cagA | s1m1 |
The frequency of the identified vacA gene was as follows: vacAs1m1 was found in 21.8% (7/32), vacAs2m2 in 28.1% (9/32), and vacAs1m2 in 46.8% (15/32) of the cases. Only one strain with the s2m1 genotype was identified (Figure 1).
![Polymerase chain reaction (PCR) results of <i>Helicobacter pylori</i> virulence genes [L: 100bp marker, A, <i>vacAm</i> (567/642bp); B, <i>vacAs</i> (259/276bp); C, <i>cagA</i> (309bp); D, <i>sabA</i> (326bp) E, <i>babA</i> (278bp); F, <i>oipA</i> (567bp)].](https://brieflands.com/journals/jid/articles/161491/figures/jid-29-3-161491-g001-preview.webp "Polymerase chain reaction (PCR) results of <i>Helicobacter pylori</i> virulence genes [L: 100bp marker, A, <i>vacAm</i> (567/642bp); B, <i>vacAs</i> (259/276bp); C, <i>cagA</i> (309bp); D, <i>sabA</i> (326bp) E, <i>babA</i> (278bp); F, <i>oipA</i> (567bp)].")
Figure 1.
Polymerase chain reaction (PCR) results of Helicobacter pylori virulence genes [L: 100bp marker, A, vacAm (567/642bp); B, vacAs (259/276bp); C, cagA (309bp); D, sabA (326bp) E, babA (278bp); F, oipA (567bp)].
5. Discussion
Helicobacter pylori is the most pathogenic bacterium in stomach tissue, capable of causing various diseases due to different pathogenic factors. The mortality rate from infection and stomach cancer caused by H. pylori varies geographically. In countries such as Africa and South Asia, the prevalence of stomach cancer is much lower than in East Asian countries. Even in different regions of these countries, the prevalence rate is not the same, because the pathogenicity of this strain varies in different geographical areas (28-31). The prevalence of bacterial infection is higher in developing countries, with more than 80% of the population in developing countries infected with H. pylori (3, 4). According to a study conducted in Iran, it was found that there is a difference in the prevalence of this bacterium in terms of region and age. In the aforementioned study, the prevalence of H. pylori infection in Iran was reported to be 72.2% (32). According to our study, the prevalence of this bacterium was 40.5% in Velayat Hospital of Qazvin province during a three-month period. It is likely that this number will increase with an increasing sample size. The aim of this study was to investigate the pathogenicity factors vacA, cagA and adhesion factors such as babA, sabA, and oipA in strains isolated from patients referred to the Endoscopy Department.
Using PCR for 32 strains of H. pylori, the vacA sequence showed changes in the signal (s) and middle (m) regions. In the study by C. Chomvarin et al., the frequency of genotypes s1m1 and s1m2 was 58% and 42%, respectively (5). In our study, these values were 18.42% and 44.73%, respectively. The frequency of s1m1 differed between the two studies, but the frequency of s1m2 was almost similar. The s1m1 genotype has a strong cytotoxic effect. The different prevalence of this genotype can be attributed to different geographical regions and sampling of patients with more severe disease conditions. For example, in the study by Havaei et al. conducted in Isfahan, most s1m1 samples were isolated from patients with adenocarcinoma (33). However, most studies have stated that, as in our study, the dominant genotype of the strains studied is s1m2 (34, 35). The low prevalence or lack of identification of the s2m1 genotype in various studies indicates the rarity of this genotype among other known genotypes (34, 36). As a meta-analysis study conducted, it was stated that the average frequency of vacA s2m1 was only 1.4% in the Middle East, which makes Iran's contribution very rare (35). Among the 32 strains examined in this study, one strain (3.1%) showed this genotype. However, based on a study that measured the prevalence of H. pylori in food, they concluded that milk, vegetables, and meat are the latent sources of H. pylori. Fifty-five percent of these samples in their study carried the s2m1 genotype (37). Therefore, it can be said that food sources can be very important in increasing the prevalence of this genotype among clinical samples.
In this study, we detected the cagA gene in 50% of the samples, which is consistent with the results of Kishk RM et al., who found that 53% of the samples in their study had this gene (10). However, it should be noted that there is allelic variation in the (A to D)/cagA 3 region, and each allele can influence the virulence of H. pylori. The presence of the cagA gene varies from a minimum of 50% in some regions of the Middle East (38) to a maximum of 99% in many East Asian countries (5, 39). The percentage of cagA-positive H. pylori strains found in our study is lower than data reported from European and North American studies (74% to 88%) (40, 41). Many studies have suggested that cagA is a useful marker for the most virulent strains associated with peptic ulcer disease, atrophic gastritis, and adenocarcinoma (42).
The present study showed the oipA gene in 71.9% of cases, which is consistent with the study by Esteghmati et al. In their study, the oipA gene was detected in approximately 70% of the subjects studied (43). This adhesion gene is involved in mucosal damage by binding to gastric epithelial cells, and some literature reports suggest that oipA-containing strains are associated with a risk of duodenal ulcers. The oip gene also has an “on/off” state, and when OipA is expressed, cagA is usually positive, meaning that the two proteins are closely associated. However, this finding is controversial because the results of different studies suggest that there are different effects of OipA on inflammation (44). Furthermore, the specific means by which OipA may induce inflammation is unclear, as these effects can often be attributed to cag PAI-mediated pathways.
Among the genes of the splicing factors, the babA gene was identified in 59.4% of the samples, which was higher than the frequency reported in Turkey of 19.51% (45). The high frequency of this gene among these strains can increase the risk of peptic ulcers and gastric cancer in patients with infections caused by these microorganisms. Also, the results of various studies show that strains carrying this gene cause gastritis among patients (46, 47). In previous studies, it was stated that the babA2 gene is positive in most Asian strains (48), but in a study conducted in Ecuador in 2023, the prevalence of this gene was reported to be 70.2% (49). The lower frequency of this gene in our study compared to this study may be due to the presence of different alleles of this gene in H. pylori strains.
Another adhesion gene is sabA, which encodes the sabA binding protein. In our study, 70% of the strains carried this gene. The expression of this gene can depend on the conditions of the stomach, such as pH level and different areas. The importance of the presence of this adhesion is to strengthen the connection between H. pylori and gastric epithelial cells (50), so the high frequency of this gene in the strains under our study could possibly indicate the high ability of these strains to colonize and attach to the gastric tissue. However, it should be kept in mind that this gene has two “off” and “on” states, in which in the off state, the sabA gene is not expressed and in the on state, it is expressed. The relationship between these two states is still unclear, and there is a hypothesis that these two states change in the bacteria depending on different conditions of the stomach (51). Therefore, examining the expression of this protein to detect the presence of this virulence factor due to its off and on states may be challenging. It is better to investigate the presence of this gene using molecular methods such as PCR, and in this study, we were able to identify this pathogenic factor in 70% of strains using this method.
This study provided valuable insights into the prevalence of pathogens associated with H. pylori, a pathogenic bacterium that causes various diseases in the stomach. Through the analysis of 32 H. pylori strains, the presence of virulence genes such as vacA, cagA, babA, sabA, and oipA was determined. This gene can result in gastric problems and even gastric cancer. By determining these genes and H. pylori genotype, it can be clear if there is a need for treatment or not. By shedding light on the presence and prevalence of these pathogens, this study contributes to the existing knowledge base on H. pylori and its associated health risks. Further research in this area could lead to targeted interventions and improved medical strategies against H. pylori infection and its associated complications.
