Prevalence of Hepatitis G Virus and Co-Infection with Hepatitis B Virus and Hepatitis C Virus Among Hemodialysis Patients in Ahvaz, Iran

Author(s):
Alireza SanchooliAlireza Sanchooli1, 2, 3,*, Manoochehr MakvandiManoochehr MakvandiManoochehr Makvandi ORCID1, 2, Niloofar NisiNiloofar Nisi1, 2, Rahil Nahid SamieiRahil Nahid Samiei1, 2
1Infectious and Tropical Disease Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran
2Virology Department, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran
3Department of Genomics and Genetic Engineering, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, IR Iran

Jundishapur Journal of Chronic Disease Care:Vol. 7, issue 2; e66417
Published online:Apr 30, 2018
Article type:Research Article
Received:Jan 17, 2018
Accepted:Apr 24, 2018
How to Cite:Sanchooli A, Makvandi M, Nisi N, Samiei RN. Prevalence of Hepatitis G Virus and Co-Infection with Hepatitis B Virus and Hepatitis C Virus Among Hemodialysis Patients in Ahvaz, Iran. Jundishapur J Chronic Dis Care. 2018;7(2):e66417. doi: https://doi.org/10.5812/jjcdc.66417

Abstract

Background:

Patients on hemodialysis are at a high-risk for acquiring blood-borne infections, such as hepatitis G, hepatitis C, and hepatitis B viruses. The aim of this investigation was to determine the prevalence of HGV infection among patients on hemodialysis and its co-infection with hepatitis C and B viruses in Ahvaz.

Methods:

Blood samples were collected from patients on hemodialysis during January to July, 2016. RNAs were extracted from sera and cDNA was prepared using the kit. The nested-polymerase chain reaction (PCR) and sequencing of positive samples were carried out to determine hepatitis G virus genotypes. In addition, to evaluate the co-infection of HGV with hepatitis C and hepatitis B virus infections, the sera of all the individuals were tested for hepatitis C virus antibody and HBs-Ag by enzyme linked immunosorbent assay (ELISA) assay.

Results:

The HGV RNA was found in 10% of the patients with dominant genotype 2a. About 2% of the patients on hemodialysis were co-infected with hepatitis C virus while 1% of them was co-infected with hepatitis B virus. The statistical analysis revealed that there was a significant correlation (P < 0.01) between duration of the hemodialysis process and hepatitis G virus infectivity.

Conclusions:

The present study showed that patients, who used the hemodialysis devices in this city, were infected with Hepatitis G, hepatitis B, and hepatitis C viruses. The data indicates that duration of dialysis is significantly related to infection of Hepatitis G virus. Therefore, it is critical to control the sterility of these equipment for intercepting cross-infectivity.

1. Background

Hepatitis G virus was firstly reported by Abbott laboratory researchers in West Africa. This agent was isolated from non-A-E hepatitis patients. They showed that genome sequence of this virus was similar to GBV-A and GBV-B isolated from primates. Hence, they called it GBV-C (1). This virus was also found by Genelabs technologies group when analyzing the samples from hepatitis patients, and was named hepatitis G virus (1). Recently, it was found that this virus was a new genus called Pegivirus from the Flaviviridae family. Therefore, it was named human Pegivirus (HPgV) (1).
This virus is an enveloped RNA virus with a single chain RNA structure of positive polarity with a size of 9.4 kb, belonging to the Flaviviridae family (1, 2). The viral genome comprised of a single open reading frame (ORF), encoding ~3000 amino acids, which included some structural (E1 - E2) and non-structural (NS2 - NS5B) proteins (3, 4). By comparing the HGV and HCV genomes (both are in the same family), it seems that HGV is a hazardous agent and can cause hepatic diseases (5, 6). Surprisingly, some researches asserted that HGV was isolated from persistent and fulminant hepatitis samples, while the other hepatitis agents were not detected (7).
It was illustrated that HGV is transmitted via person-to-person, mainly by the parenteral routes, especially individuals with multi-blood transfusion. Among these patients, those on hemodialysis (HDs) are at high risk of infection with HGV (8, 9). In addition, another high-risk population acquiring HGV infection is individuals infected with hepatitis B virus (HBV) (10, 11) or hepatitis C virus (HCV) (12). Some studies showed that co-infection of HBV and HCV with HGV causes acceleration of chronic illness and an increase in the severity of the disease (7).
Several studies have displayed that HGV is an infectious agent. It has been estimated that roughly 1% of healthy blood donors are infected with HGV (6, 10, 13). Low (3.1%) and high (57.5%) prevalence of HGV outbreaks have been reported in patients with HD in Japan and France, respectively (14, 15). Generally, the prevalence of HGV varies from 11% to 24%, among HCV-infected individuals (16-18). The prevalence of HGV infection varies in different regions of Iran and ranges from 3.14% to 10.73% (19, 20).
Due to sharing of dialysis machines among patients with HD, the transmission risk of hepatitis viruses to these people is at a high level. Hence, for more cautious use of these devices, detecting HD patients infected with hepatic diseases seems to be necessary to determine the risk of transmission of these viruses to the uninfected patients. In this regard, evaluating the prevalence of the hepatitis viruses in patients with HD is also essential. Furthermore, testing the sterility of HD devices after use for these patients should be carried out under strict laws.
With this purpose in mind, an epidemiological study was conducted to determine the prevalence of HGV and its co-infection with HCV and HBV infections in HD patients at dialysis units of Ahvaz hospitals, affiliated to the Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. Ahvaz is the capital city of Khuzestan Province with roughly two million individuals and a tropical climate. It merits attention that Ahvaz is a touristic city located in the south-west region of Iran.

2. Objectives

The aim of this study was to determine the prevalence of HGV among hemodialysis patients in Ahvaz and its co-infection with HCV and HBV patients.

3. Methods

This epidemiological study project was approved by the ethics committee of Ahvaz Jundishapur University of Medical Sciences (Ethic code: IRAJUMS.REC.1394.569). The ethic consent was obtained from each HD patient.

3.1. Detection of Hepatitis G Virus Genome Using the Molecular Method

The RNA was extracted from all plasma samples by high pure viral RNA Kit (Roche, Germany), according to the manufacturer’s protocol. Finally, 50 µL of RNA samples were employed for synthesizing cDNAs. The cDNAs were prepared using the Thermo Fisher Scientific kit, according to the manufacturer’s protocol and maintained at -20°C until use.

3.2. Nested Polymerase Chain Reaction

The nested PCR was carried out using 4 primers conserved in the 5’ un-translated region of genomic HGV (21). The reaction mixture contained 2.5 µL of PCR buffer (Roche), 0.3 mmol of dNTP, 0.125 µL of enzyme (taq DNA polymerase 5 unit, Roche), 1.5 mmol of MgCl2, and 1.5 pmol/µL of primers (nucleotides 102 to 121 as Fhg1 contained GCCAAAAGGTGGTGGATGGG as the forward primer, and nucleotides 457 to 477 as Rhg1 contained CGGAGCTGGGTGGCCCCATGC as the reverse primer) and water up to 25 µL. For the second round, 1 µL of PCR products of the first step of PCR, was utilized for the second step of PCR as the template. For the second round, the reaction mixture and PCR thermal condition were carried out the same as the first round PCR and the following primers were used: Forward primer: Fhg2 TGGTAGGTCGTAAATCCCGG, and reverse primer: Rhg2 TGGTCCTTGTCAACTCGCCG. Polymerase chain reaction reactions were performed using a thermocycler (Bio-Rad, Hercules, CA, USA). Durations and temperatures used in both steps of PCR are shown in Table 1.
Table 1.Durations and Temperatures Used in Both Polymerase Chain Reaction Steps
StepTemperature, °CDuration, MinRepeat
1First denaturation9551
2Denaturation94136
Annealing451
Extension721
3Final extension72101
The PCR products from the second step of PCR were run on 2% agarose gel, using 1X TAE buffer, stained with safe stain, and observed under UV trans illuminator (Bio-Rad, Hercules, CA, USA). The final PCR product of 261 bp was indicated as a positive sample. The PCR products were purified using Nucleo Spin Gel and PCR Clean-up Kit (Duren, Germany), according to the manufacturer’s protocol. The purified PCR products were sequenced (ABI Company, USA) to determine HGV genotypes.
This project, registration number 94111, was approved by the ethics committee of the Ahvaz Jundishapur University of Medical Sciences. Ethical consent was obtained from each HD patient.

3.3. Serological Test

The sera samples were collected via the venoject method from 100 randomly selected HD patients, who were registered for dialysis at Golestan and Razi hospitals of Ahvaz city, Iran, during February to December 2016. Sampling was carried out before dialysis. The sera of all the patients were tested for HBsAg and anti-HCV antibody, using enzyme linked immunosorbent assay (ELISA) kits (Dia. Pro Kit, Italy), based on the manufacturer’s manual.

3.4. Statistical Analysis

Number of samples (100) was estimated, according to Morgan’s table. The effects of three factors, including gender, age, and duration of hemodialysis (DHD) on HGV were analyzed using the GLM procedure of the SAS software (version 9.1).
Analysis was followed as:
Hijk = Si + Aj + Dk + eijk
Hijk: the phenotype of the HD patients for HGV disease (infected/non-infected)
Si: Gender (male/female)
Aj: Age as a covariate factor
Dk: Duration of Hemodialysis (DHD) as a covariate factor

4. Results

As illustrated in Figure 1, the outbreak of the HGV infection was 10% in the patients on HD, which was determined by the nested PCR. All the detected HGVs were dominant with genotype 2a. In addition, as showed in Table 2, 2% of the HD patients were co-infected with HCV and HGV, while 1% of the HD patients were co-infected with HBV.
The Figure shows the polymerase chain reaction analysis of patients on hemodialysis in Ahvaz. 1, Marker; 2, Negative control; 3, Positive control; 4, 5, and 7, Negative samples; 6, positive sample.
Figure 1.

The Figure shows the polymerase chain reaction analysis of patients on hemodialysis in Ahvaz. 1, Marker; 2, Negative control; 3, Positive control; 4, 5, and 7, Negative samples; 6, positive sample.

Table 2.The Characteristics of Hemodialysis Patients Infected with GBV-Ca
PatientsGenderAgeDuration of HD, MoHBVHCV
1M5530--
2M5617-+
3M3320--
4M5018--
5M5424+-
6M5824--
7M5348-+
8F5021--
9M6224--
10F6124--

Abbreviations: F, Female; M, Male.

a-, Negative; +, Positive.

Based on the statistical analysis, the average age of the total patients was 47 ± 14.5 (mean ± SD) years, 70% of whom were male and 30% were female. The average age of the positive patients for HGV RNA was 47 ± 14.5 (mean ± SD) years. The average HD period in HGV RNA positive cases was 25 ± 8.5 months, which was longer than that of the HGV RNA negative cases.
The relationship between HGV and three factors of gender, age, and duration of HD was investigated in the HD patients. The results demonstrated that there was a significant correlation between HGV and duration of HD (P < 0.01). However, gender and age had no significant effects on HGV in the HD patients (Table 3).
Table 3.Demographic Characteristics of the Patients on Hemodialysis
VariablesHGV ExposedHGV Non ExposedP Value
Number of patients1090-
Age47 ± 14.547 ± 14.5NS
Gender (F: M)2:826:64NS
Duration of dialysis, mo25 ± 8.516.26 ± 4.8P < 0.01
Due to the sharing of dialysis machines among patients on HD, the transmission risk of the hepatitis viruses to these people is at a high level. Hence, for more cautious use of these devices, detecting patients on HD infected with hepatic diseases seems necessary to determine the risk of transmission of these viruses to uninfected HD patients. In this regard, evaluating the prevalence of hepatitis viruses in HD patients is essential. Furthermore, testing the sterility of HD devices after use for these patients should be carried out under strict laws.
With this purpose in mind, an epidemiological study was conducted to determine the prevalence of HGV and its co-infection with HCV and HBV infections in patients on HD at dialysis units of Ahvaz hospitals, affiliated to the Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. Ahvaz is the capital city of Khuzestan province with an approximate population of two million and a tropical climate. It merits attention that Ahvaz is a touristic city, located in the south west region of Iran.
The diagram illustrates the prevalence of hepatitis G virus, hepatitis C virus and hepatitis B virus infection among hemodialysis patients of hospitals in the Center of Ahvaz.
Figure 2.

The diagram illustrates the prevalence of hepatitis G virus, hepatitis C virus and hepatitis B virus infection among hemodialysis patients of hospitals in the Center of Ahvaz.

5. Discussion

Transmission of hepatitis viruses to HD patients is a worrying problem. In this regard, identifying patients on HD infected with hepatic diseases is an essential measure. The present study was carried out to determine the prevalence of hepatitis (G, C, B) infections among patients on HD in Ahvaz city of Iran. The results showed that a number of patients on HD were infected with HGV in the statistical population analyzed in this research. As a matter of fact, when comparing HGV prevalence between Ahvaz city and other cities of Iran and different regions around the world, it was observed that HGV outbreak was moderate. For instance, the prevalence of HGV in patients undergoing kidney transplantation was 24% in Italy (22). The frequency of HGV in patients undergoing HD was 50% in Germany (23), 12.8% in Brazil (24), and 4.5% in Japan (25). The prevalence of HGV among HD patients varied from 3.15% to 57% in different regions of the world, 3.1% to 15% in Japan, 11.5% to 20% in USA, and 6% to 57.5% in Europe, and 55% in Indonesia (11). The results were in agreement with findings reported by Watanabe MA in Brazil (24).
The co-infection of HGV was observed in HCV and HBV carriers (26). In the present study, two cases on HD with HGV infection were found to be co-infected with HCV. The prevalence of HGV among the HD patients has been reported in different regions of Iran. Hossini-Moghaddam et al. (2008) (southern Khorasan, Iran) described the prevalence of HGV RNA as 13.6% while the co-infection of HGV and HCV was 2% in patients on HD. In addition, Hossini-Moghaddam et al. reported that the HGV genotypes 1a, 1b, 3a, and 3b were observed in patients on HD (27). However, in the current study, HGV genotype 2a was prominent in the patients on HD. Ziaii et al. (2007) reported the outbreak of HGV infection as 5% among patients on HD in Birjand, Iran. The HGV dominant genotypes were reported as 1a, 2a, and 3a in Birjand city, Iran. All the detected HGV cases were shown to be co-infected with HCV infection (28). Khafi-Abad et al. (2009) in Tehran described the prevalence of HGV as 32.6% in patients on HD, which was higher than that obtained in the current study (29). Dadmanesh et al. (2015) found that 4.3% of patients on HD were infected with HGV RNA in Tehran, which was lower than that obtained by the current study (30). Samarbaf-zadeh et al. (2015) described that 3.14% of HD and kidney transplant patients had positive results for HGV RNA, which was lower than that obtained in the current study (19). Kargar Khaierabad et al. (2016) conducted a research on HGV and HCV in patients on HD in Hormozgan Province and found no co-infection of HGV and HCV among the patients (31). Samadi et al. (2008) reported the prevalence of HGV infection as 12.6% in patients on HD of Tehran, which is in agreement with the current results (32). Mohsenzadeh et al. (2012) outlined the prevalence of HGV as 11% among chronic renal failure individuals in Shiraz, which is in accordance with the current findings (33). Monica V Alvarado-Mora et al. (2011) conducted a research on detection of HGV- in HCV- and HBV-infected population. The results revealed the prevalence of HGV among the population groups as 3.2% and 5.06%, respectively. The co-infection of HGV with HBV or HCV infection was 7.7% among patients on HD. Moreover, the HGV dominant genotypes were found to be 1, 2a, and 2b (5). Hanggoro Tri Rinonce et al. (2017) observed the diversity distribution of HGV genotype among individuals on HD in Indonesia. The HGV dominant genotypes were 6 (85%), 4 (6%), and 3 (1%), respectively (34). Imen Ben Dhifallah et al. (2016) described the prevalence of HGV among multi-transfused individuals and the HCV-positive population. It was found that the HGV positive prevalence was 14.9% and 7.2%, respectively, in Tunisian patients. The dominant genotype of HGV was 2a, as in the current investigation (35).

5.1. Conclusion

The present study revealed that the prevalence of HGV infection was moderate among the HD patients of Ahvaz city in comparison with other regions of Iran. In addition, some HGV-positive patients were co-infected with HBV and HCV in this region. Meanwhile, the duration of the HD period had a significant correlation with infectivity. Hence, managing the decontamination of the HD devices after use for these positive hepatitis patients should be carried out under strict laws to prevent cross-contamination among HD patients in this city.

Acknowledgments

Footnotes

References

  • 1.
    Ramos Filho R, Carneiro MA, Teles SA, Dias MA, Cardoso DD, Lampe E, et al. GB virus C/hepatitis G virus infection in dialysis patients and kidney transplant recipients in Central Brazil. Mem Inst Oswaldo Cruz. 2004;99(6):639-43. [PubMed ID: 15558178].
  • 2.
    Soleiman-Meigooni S, Asgari A, Hoseini-Shokouh SJ, Rajabi J, Kazemi-Galougahi MH, Moshtaghi M. Association between Hepatitis G and Unknown Chronic Hepatitis. Electron Physician. 2015;7(1):985-9. [PubMed ID: 26052409]. https://doi.org/10.14661/2015.985-989.
  • 3.
    Simons JN, Leary TP, Dawson GJ, Pilot-Matias TJ, Muerhoff AS, Schlauder GG, et al. Isolation of novel virus-like sequences associated with human hepatitis. Nat Med. 1995;1(6):564-9. [PubMed ID: 7585124]. https://doi.org/10.1038/nm0695-564.
  • 4.
    Linnen J, Wages JJ, Zhang-Keck ZY, Fry KE, Krawczynski KZ, Alter H, et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science. 1996;271(5248):505-8. [PubMed ID: 8560265]. https://doi.org/10.1126/science.271.5248.505.
  • 5.
    Alvarado-Mora MV, Botelho L, Nishiya A, Neto RA, Gomes-Gouvea MS, Gutierrez MF, et al. Frequency and genotypic distribution of GB virus C (GBV-C) among Colombian population with Hepatitis B (HBV) or Hepatitis C (HCV) infection. Virol J. 2011;8:345. [PubMed ID: 21745373]. https://doi.org/10.1186/1743-422X-8-345.
  • 6.
    Bhattarai N, Stapleton JT. GB virus C: the good boy virus? Trends Microbiol. 2012;20(3):124-30. [PubMed ID: 22325031]. https://doi.org/10.1016/j.tim.2012.01.004.
  • 7.
    Yang JF, Dai CY, Chuang WL, Lin WY, Lin ZY, Chen SC, et al. Prevalence and clinical significance of HGV/GBV-C infection in patients with chronic hepatitis B or C. Jpn J Infect Dis. 2006;59(1):25-30. [PubMed ID: 16495630].
  • 8.
    Ozdarendeli A, Toroman ZA, Kalkan A, Kilic SS, Ozden M, Doymaz MZ. Prevalence and genotypes of hepatitis G virus among hemodialysis patients in Eastern Anatolia, Turkey. Med Princ Pract. 2005;14(2):102-6. [PubMed ID: 15785102]. https://doi.org/10.1159/000083920.
  • 9.
    Laskus T, Radkowski M, Wang LF, Vargas H, Rakela J. Lack of evidence for hepatitis G virus replication in the livers of patients coinfected with hepatitis C and G viruses. J Virol. 1997;71(10):7804-6. [PubMed ID: 9311866].
  • 10.
    Chang CM, Stapleton JT, Klinzman D, McLinden JH, Purdue MP, Katki HA, et al. GBV-C infection and risk of NHL among U.S. adults. Cancer Res. 2014;74(19):5553-60. [PubMed ID: 25115299]. https://doi.org/10.1158/0008-5472.CAN-14-0209.
  • 11.
    Handajani R, Lusida MI, Suryohudoyo P, Adi P, Setiawan PB; Soetjipto, et al. Prevalence of GB virus C/Hepatitis G virus infection among various populations in Surabaya, Indonesia, and identification of novel groups of sequence variants. J Clin Microbiol. 2000;38(2):662-8. [PubMed ID: 10655364].
  • 12.
    Hassan H, Bastani B. Hepatitis G virus infection among hemodialysis patients: true infection or innocent bystander? Semin Dial. 2000;13(2):108-11. [PubMed ID: 10795114]. https://doi.org/10.1046/j.1525-139x.2000.00035.x.
  • 13.
    Stapleton JT, Foung S, Muerhoff AS, Bukh J, Simmonds P. The GB viruses: a review and proposed classification of GBV-A, GBV-C (HGV), and GBV-D in genus Pegivirus within the family Flaviviridae. J Gen Virol. 2011;92(Pt 2):233-46. [PubMed ID: 21084497]. https://doi.org/10.1099/vir.0.027490-0.
  • 14.
    Masuko K, Mitsui T, Iwano K, Yamazaki C, Okuda K, Meguro T, et al. Infection with hepatitis GB virus C in patients on maintenance hemodialysis. N Engl J Med. 1996;334(23):1485-90. [PubMed ID: 8618602]. https://doi.org/10.1056/NEJM199606063342301.
  • 15.
    de Lamballerie X, Charrel RN, Dussol B. Hepatitis GB virus C in patients on hemodialysis. N Engl J Med. 1996;334(23):1549. [PubMed ID: 8618624]. https://doi.org/10.1056/NEJM199606063342319.
  • 16.
    Feucht HH, Zollner B, Polywka S, Knodler B, Schroter M, Nolte H, et al. Prevalence of hepatitis G viremia among healthy subjects, individuals with liver disease, and persons at risk for parenteral transmission. J Clin Microbiol. 1997;35(3):767-8. [PubMed ID: 9041431].
  • 17.
    Di Bisceglie AM. Hepatitis G virus infection: a work in progress. Ann Intern Med. 1996;125(9):772-3. [PubMed ID: 8929013].
  • 18.
    Berzsenyi MD, Bowden DS, Roberts SK. GB virus C: insights into co-infection. J Clin Virol. 2005;33(4):257-66. [PubMed ID: 15922655]. https://doi.org/10.1016/j.jcv.2005.04.002.
  • 19.
    Samarbaf-Zadeh AR, Makvandi M, Hamadi A, Kaydani GA, Absalan A, Afrough P, et al. Prevalence of Hepatitis G Virus Among Hemodialysis and Kidney Transplant Patients in Khuzestan Province, Iran. Jundishapur J Microbiol. 2015;8(5). e20834. [PubMed ID: 26060569]. https://doi.org/10.5812/jjm.20834.
  • 20.
    Kelishadi M, Mojerloo M, Moradi A, Bazouri M, Hashemi P, Samadi S, et al. GB virus C Viremia and Anti-E2 Antibody Response Among Hemodialysis Patients in Gorgan, Iran. Jundishapur J Microbiol. 2014;7(11). e13122. [PubMed ID: 25774276]. https://doi.org/10.5812/jjm.13122.
  • 21.
    Davod J, Javanmard D, Makvandi M, Hajiani E, Khalafkhany D, Samarbaf Zadeh AR. Hepatitis G virus (HGV), its prevalence and genotypes in patients with hepatitis B & C in Ahvaz, Southwest Iran. Turk J Med Sci. 2013;43:474-8. https://doi.org/10.3906/sag-1203-55.
  • 22.
    De Filippi F, Lampertico P, Soffredini R, Rumi MG, Lunghi G, Aroldi A, et al. High prevalence, low pathogenicity of hepatitis G virus in kidney transplant recipients. Dig Liver Dis. 2001;33(6):477-9. [PubMed ID: 11572574]. https://doi.org/10.1016/S1590-8658(01)80025-6.
  • 23.
    Heringlake S, Osterkamp S, Trautwein C, Tillmann HL, Boker K, Muerhoff S, et al. Association between fulminant hepatic failure and a strain of GBV virus C. Lancet. 1996;348(9042):1626-9. [PubMed ID: 8961994]. https://doi.org/10.1016/S0140-6736(96)04413-3.
  • 24.
    Watanabe MA, Milanezi CM, Silva WJ, de Lucena Angulo I, Santis G, Kashima S, et al. Molecular investigation of GB virus C RNA in hemodialysis and thalassemics patients from Brazil. Ren Fail. 2003;25(1):67-75. [PubMed ID: 12617334]. https://doi.org/10.1081/JDI-120017469.
  • 25.
    Okuda M, Hino K, Korenaga M, Yamaguchi Y, Kao Y, Mukaide M. GB virus C/hepatic G viremia and antibody response to the E2 protein of hepatitis G virus in hemodialysis patients. J Clin Gastroenterol. 2000;30:425-8.
  • 26.
    Kao JH, Huang CH, Chen W, Tsai TJ, Lee SH, Hung KY, et al. GB virus C infection in hemodialysis patients: molecular evidence for nosocomial transmission. J Infect Dis. 1999;180(1):191-4. [PubMed ID: 10353878]. https://doi.org/10.1086/314850.
  • 27.
    Hosseini-Moghaddam SM, Keyvani H, Samadi M, Alavian SM, Mahdavimazdeh M, Daneshvar S, et al. GB virus type C infection in hemodialysis patients considering co-infection with hepatitis C virus. J Med Virol. 2008;80(7):1260-3. [PubMed ID: 18461616]. https://doi.org/10.1002/jmv.21161.
  • 28.
    Ziaee M, Zarban A, Malekinejad P, Akhbary H. Evaluation of HGV viremia prevalence and its co-infection with HBV, HCV, HIV and HTLV-1 in hemophilic patients of Southern Khorassan, Iran. Hepat Mon. 2007;7(1):11-4.
  • 29.
    Kafi-Abad SA, Samiei S, Talebian A, Maghsudloo M, Gharehbaghian A. Hepatitis G virus infection in Iranian blood donors and high-risk groups. Hepat Mon. 2009;9:282-6.
  • 30.
    Dadmanesh M, Hosseinzadeh M, Keyvani H, Ghorban K, Rahimi M, Hosseinzadeh M, et al. Evaluation of prevalence and risk factors of hepatitis g virus infection among hemodialysis patients referred to Iranian army hospitals in tehran during 2012-2013. Hepat Mon. 2015;15(1). e18322. [PubMed ID: 25741370]. https://doi.org/10.5812/hepatmon.18322.
  • 31.
    Kargar Kheirabad A, Bahri F, Kargar M, Ghasemzadeh I. Hepatitis C and G Virus Infection Prevalence Among Hemodialysis Patients and Associated Risk Factors in the Hormozgan Province of Southern Iran. Hepat Mon. 2016;16(10). e40375. [PubMed ID: 27882069]. https://doi.org/10.5812/hepatmon.40375.
  • 32.
    Samadi M, Keyvani H, Moghaddam SMH. Prevalence and risk factors of the hepatitis G (HGV) infection in hemodialysis patients. Iran J Clin Infect Dis. 2008;3(1):7-11.
  • 33.
    Mohsenzadeh M. Molecular evaluation of hepatitis G virus and hepatitis C virus in patients with chronic renal failure in Iran. Afr J Microbiol Res. 2012;6(33):6257-61. https://doi.org/10.5897/ajmr12.575.
  • 34.
    Rinonce HT, Yano Y, Utsumi T, Heriyanto DS, Anggorowati N, Widasari DI, et al. Prevalence and genotypic distribution of GB virus C and torque teno virus among patients undergoing hemodialysis. Mol Med Rep. 2017;15(5):2843-52. https://doi.org/10.3892/mmr.2017.6281.
  • 35.
    Ben Dhifallah I, Ayouni K, Chouiha A, Sadraoui A, Hogga N, Hammami W, et al. Genotype Distribution and Prevalence of Human Pegivirus among High-Risk Populations in Tunisia. Intervirology. 2016;59(3):170-8. [PubMed ID: 28132064]. https://doi.org/10.1159/000454810.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles