Jentashapir J Cell Mol Biol

Image Credit:Jentashapir J Cell Mol Biol

Somatic BRAF V600E Mutation in Familial Colorectal Cancer Type X: A New Study in Central Iran

Author(s):
Mehrdad ZeinalianMehrdad ZeinalianMehrdad Zeinalian ORCID1, 2, 3,*, Mohammad Hassan EmamiMohammad Hassan Emami4, Mohammad Reza  PourrezaMohammad Reza Pourreza1, Mohammad Amin TabatabaiefarMohammad Amin Tabatabaiefar1, 2, Morteza  Hashemzadeh-ChaleshtoriMorteza Hashemzadeh-Chaleshtori5
1Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2Pediatric Inherited Disease Research Center, Research Institute for Primordial Prevention of Non-communicable Disease, Isfahan University of Medical Sciences, Isfahan, Iran
3Ala Cancer Prevention and Control Center, Isfahan, Iran
4Gastrointestinal and Hepatobiliary Diseases Research Center, Poursina Hakim Research Institute for Health Care Development, Isfahan, Iran
5Cellular and Molecular Research Center, Shahrekord University of Medical Sciences, Shahrekord, Iran

Jentashapir Journal of Cellular and Molecular Biology:Vol. 12, issue 2; e115099
Published online:Jun 19, 2021
Article type:Research Article
Received:Apr 06, 2021
Accepted:May 05, 2021
How to Cite:Zeinalian M, Emami MH, Pourreza MR, Tabatabaiefar MA, Hashemzadeh-Chaleshtori M. Somatic BRAF V600E Mutation in Familial Colorectal Cancer Type X: A New Study in Central Iran. Jentashapir J Cell Mol Biol. 2021;12(2):e115099. doi: https://doi.org/10.5812/jjcmb.115099

Abstract

Background:

BRAF-V600E is a known prognostic/predictive marker in colorectal cancer (CRC), detected in 4 - 12% of all patients with this cancer. Familial-CRC-type-X (FCCX) is a subtype of mismatch-repair (MMR) proficient CRC with an unknown genetic cause.

Objectives:

Given the lack of enough information on the molecular aspects of FCCX among Iranians, this study was conducted to evaluate the BRAF-V600E hot-spot mutation in tumor DNA in FCCX probands in Central Iran.

Methods:

This was a cross-sectional study in which 48 FCCX probands were recruited according to Amsterdam-II criteria, and MMR proficiency was confirmed by MSI testing and IHC-MMRs. Tumors’ DNA samples were assessed for the BRAF-V600E mutation by Sanger-sequencing.

Results:

None of the 48 assessed FCCX probands presented the BRAF-V600E mutation.

Conclusions:

It can be suggested that FCCX tumors have a good prognosis compared to other CRCs.

1. Background

Cancer is one of the three most important causes of mortality in humans throughout the world, and colorectal cancer (CRC) is estimated to be amongst the first five frequent cancers in both genders (1). The Lynch syndrome (LS) is the most common form of hereditary cancers, in the context of which the incidence of CRC, uterus cancer, and some other extracolonic cancers such as the stomach, hepatobiliary tract, small intestine, urinary tract, brain, breast, and skin is higher than the average risk of the general population (2). The colorectal cancers associated with LS are usually early-onset and include 3 - 5% of all CRCs (3). Clinical criteria such as Amsterdam I/II (ACI/II) and revised Bethesda guidelines are routinely used to screen the CRC associated with LS, entitled as hereditary nonpolyposis colorectal cancer (HNPCC) (4). The HNPCC phenotype has clinically a heterogeneous pattern encompassing LS (4%), Lynch-like syndrome (< 1%), and familial colorectal cancer type X (FCC-X) (2 - 4% ) (10, 11).
The underlying molecular event in LS mainly involves a germline mutation in DNA mismatch repair genes (MMRs), including MLH1, MSH2, MSH6, and PMS2 (5). Mismatch repair deficiency causes the accumulation of mutations in cancer-related genes, accelerating tumorigenesis events, and leads to a unique molecular phenomenon entitled “microsatellite instability (MSI)”, which can be used as a surrogate marker for MMR deficiency for the molecular screening of LS (6).
Besides LS, about 15% of sporadic CRC patients present MSI-H in their tumors, who are usually affected at a higher age than LS patients (7). The molecular defect in MSI-H sporadic CRC also involves the epigenetic silencing of MLH1 due to promoter hypermethylation (8). According to different studies, a significant portion of these tumors has a specific common mutation in BRAF (V600E), which is not generally found in LS-associated tumors. Therefore, this mutation has been suggested as a surrogate marker to distinguish MSI-H sporadic CRC from LS-associated CRC (8-10).
The BRAF gene encodes a cytoplasmic serine-threonine kinase of the Raf family. Gain-of-function mutations in BRAF can lead to the destruction of the kinase domain, which includes a hotspot at the nucleotide position of 1,796, where a T>A substitution leads to an amino acid change from glutamate to valine at the residue 600 (i.e., V600E) (11). This is the most common mutation of BRAF, including up to 90% of all mutations in CRC (12). Oncogenic BRAF mutations have been found in 4 - 12% of all colorectal tumors, regardless of the type or pathologic stage of the tumor (12-14). Several studies have indicated a prognostic value for the BRAF V600E mutation, and mutant CRCs have presented accelerated recurrence and a poor prognosis (15).
Familial-CRC-type-X is characterized by AC positivity and MMR-proficient tumors without mutations in MMR genes (16-18). Meanwhile, some parts of MLH1 defective tumors may present MMR-proficiency in immunohistochemistry (IHC) due to the immunogenicity of the truncated protein (2, 6).
Although FCCX constitutes a major portion of hereditary CRC cases, its molecular features remain poorly defined. More knowledge about the genetics and molecular basis of this subset of hereditary CRC can provide vital hints of disease-predisposing factors and help to develop new efficient early diagnostic and targeted therapeutic strategies (18). Whether or not some FCCX cases harbor sporadic MLH1-defective tumors and MMR-proficiency is uncertain because of the false-negative results of MSI-testing and IHC, and the current study was designed to divulge this issue. Among Iranian FCCX patients with different clinicopathologic features (2, 16), we evaluated the presence of the V600E BRAF mutation as a known predictive and prognostic marker in CRC and a well-defined surrogate for detecting sporadic MLH-defective CRCs.

2. Methods

2.1. Patients and Samples

This was a descriptive study to reveal more clearly a molecular feature of FCCX in central Iran, Isfahan. Among 2,460 CRC patients registered in Poursina Hakim Digestive Diseases Research Center and Iranian Cancer Control Charity Institute, two referral centers for cancer patients in Isfahan, 48 families with FCCX were screened for MMR deficiency using IHC-MMRs staining and MSI testing according to ACII, which included the presence of at least three members with one of LS-associated cancers (colorectal, uterus, gastrointestinal, renal, breast, brain, skin, and pelvic) in at least two successive generations, as well as a first-degree relationship between at least two out of three affected members and at least one being diagnosed before the age of 50 years (19).
An informed consent form was signed by the patient or a family member. Ethical approval was obtained from the Research Ethics Committee of Shahrekord University of Medical Sciences (ethical ID: 93-6-6). The study received grant number of 1686.

2.2. BRAF Mutation Screening

In this study, a primer pair was designed for the exon 15 of the BRAF gene using the Primer-Blast tool of NCBI (forward primer: ATTGCACGACAGACTGCACA and reverse primer: CTGATGGGACCCACTCCATC) to amplify a DNA sequence enclosing the V600E BRAF mutation. DNA extraction was performed on tumor tissue samples from formalin-fixed paraffin-embedded (FFPE) blocks (20). After PCR, according to standard procedures, Sanger sequencing was done by an ABI PRISM 3100 Genetic Analyzer system. Using Chromas 2.6.4 DNA sequence editing software (Technelysium Pty Ltd), the reported electropherograms were analyzed, and the presence of the V600E BRAF mutation was assessed (Figure 1).
An electropherogram related to a patient with wild type BRAF: The Valine codon at the 600 position is intact.
Figure 1.

An electropherogram related to a patient with wild type BRAF: The Valine codon at the 600 position is intact.

3. Results

Overall, 48 cases (1.95%), out of 2,460 patients with CRC, were finally diagnosed as FCCX. None of the MMR-proficient probands in the 48 studied FCCX families presented the V600E BRAF mutation in tumors’ extracted DNA. According to pedigrees, affected members in MMR-proficient CRC families had an average age of 51.7 years at diagnosis. The frequencies of right-sided and left-sided colorectal tumors were 20.8 and 79.2%, respectively. The number of cancer patients in the 48 identified families with FCCX was 286, and CRC, gastric, and lung cancers with 39.9, 10.1, and 8.4%, respectively, were the most frequent cancers (Table 1).
Table 1.Tumor Locations Among Iranian Patients with Familial Colorectal Cancer Type X
Tumor locationNo. (%)
Colorectal114 (39.9)
Stomach29 (10.1)
Lung24 (8.4)
Breast23 (8.0)
Brain18 (6.3)
Hepatobiliary tract14 (4.9)
Intestine12 (4.2)
Prostate8 (2.8)
Uterus8 (2.8)
Skin6 (2.1)
Hematopoietic system6 (2.1)
Bladder6 (2.1)
Thyroid4 (1.4)
Testis4 (1.4)
Bone4 (1.4)
Kidney2 (0.7)
Pancreas2 (0.7)
Nasopharynx2 (0.7)
Total286 (100)
Overall, 16/48 of FCCX probands (33.3%) were pathologically diagnosed at early stages (I or II TNM stage). In addition, the mortality rate of cancer among the FCCX probands was 22/48 (45.8%).

4. Discussion

In this study, the V600E BRAF mutation was evaluated in 48 FCCX probands. The hot-spot V600E BRAF mutation can be applied as a prognostic factor and a predictive marker for anti-EGFR targeted-therapy in CRC. It is also used to distinguish sporadic CRC from familial CRC and as a surrogate marker for the evaluation of MMR deficiency due to MLH1 promoter hypermethylation, an event happening in an average of 15% of CRCs (21). Moreover, differences in the clinicopathologic features of familial CRCs between Iranians and other populations can be related to different genomic structures and molecular pathways involved in tumorigenesis (6, 22, 23).

4.1. The Prevalence of BRAF Mutation in Tumor DNA

In this study, none of the 48 assessed probands presented with the V600E BRAF mutation, as evidenced by sequencing tumor extracted DNA samples. The frequency of this mutation in CRC tumors has been variable in different studies, ranging from 1 to 22% and from a lower prevalence in some Asian populations to a higher prevalence in some western nations (24-28). Meanwhile, the frequency of the V600E BRAF mutation in early-onset right-sided MSI-H CRC has been reported to be higher than in other CRC types (26-28). For example, despite the low frequency of the mutation in unselected Taiwanian CRC patients (about 1%) (25), this mutation was found in 19% (11 of 59 cases) of Taiwanian patients with early-onset CRC (26). There are limited surveys on the prevalence of the V600E BRAF mutation in patients with familial CRC. In a Swedish study, 194 CRC patients with a positive family history of the disease were investigated, 26 (13.4%) of whom revealed the V600E BRAF mutation in their tumors; however, hereditary syndromes such as familial adenomatous polyposis (FAP) and LS had been excluded from this study (11).
Based on different studies, it seems that the prevalence of the V600E BRAF mutation in CRC tumor tissues is lower in the West and South of Asia compared to Western populations (25, 29, 30). For example, the prevalence of this mutation has been estimated 2.5 and 6.7% in two studies performed in Saudia Arabia and Turkey, respectively (25, 29).
There is insufficient data on the prevalence of the V600E mutation among Iranians; meanwhile, given the presence of several ethnicities in Iran, the prevalence of this mutation may vary in different areas of the country. In an Iranian study performed in the southwest of the country, 37 of 80 (46.2%) non-selective CRC cases had a heterozygous genotype for the V600E BRAF mutation (30). In another study in the northwest of Iran, the mutation was found in none of 30 non-selective CRC cases (31). Nevertheless, no survey has been done yet on Iranians with familial CRC in terms of V600E BRAF mutation prevalence. Given the low sample size of the present study, more evaluations on other Iranian populations with larger numbers of patients with familial CRC can deliver a more accurate estimation of V600E BRAF mutation prevalence.

4.2. Clinicopathologic Features

Most CRC tumors with mutant BRAF, according to different studies, present characteristic clinicopathological features such as older age at diagnosis, right-sided location, and an advanced pathologic stage at diagnosis (32). According to our findings, about one-third of the cases studied here were diagnosed at early pathological stages (stage I and II), and most of them were identified at advanced stages. Given that all of the samples showed the wild-type BRAF, the identification of the patients at more advanced stages may be due to delayed diagnosis because of the lack of active CRC screening programs in Iran. Moreover, just one-fifth of the tumors were located at the right side of the colon, and most of them were left-sided. This feature is compatible with non-mutant BRAF tumors, an issue that was approved by our findings.

4.3. Predictive Value of BRAF Mutation

According to several studies, tumor DNA analysis for BRAF and KRAS mutations can help clinicians to choose a cost-effective and efficient drug to treat the patient by targeted therapy (33). The BRAF and KRAS are effector proteins in the mitogen-activated protein kinase (MAPK) pathway, which is triggered by ligand-bound epidermal growth factor receptor (EGFR) (34). The monoclonal antibodies (mAbs) manufactured against EGFR are now used as key drugs in cancer targeted-therapy to treat metastatic CRCs (35). Gain-of-function mutations in both oncogenes (i.e., BRAF and KRAS) can be used as strong predictors of resistance to targeted anti-EGFR therapy (36, 37). Accordingly, BRAF mutations can be used as predictors of the therapeutic response, particularly in metastatic CRCs (Figure 2). Given that wild-type BRAF was identified in all tumor DNA samples in our study, targeted therapy with anti-EGFR agents could be considered for the patients.
The MAPK signaling pathway in CRC. KRAS and BRAF mutations lead to the independent activation of downstream signaling cascades resulting in unlimited cellular proliferation and tumorigenesis. Mutant tumors are resistant to anti-EGFR therapies. CRC, colorectal cancer; EGFR, epidermal growth factor receptor; MEK, mitogen-activated protein kinase.
Figure 2.

The MAPK signaling pathway in CRC. KRAS and BRAF mutations lead to the independent activation of downstream signaling cascades resulting in unlimited cellular proliferation and tumorigenesis. Mutant tumors are resistant to anti-EGFR therapies. CRC, colorectal cancer; EGFR, epidermal growth factor receptor; MEK, mitogen-activated protein kinase.

4.4. Prognostic Value of BRAF Mutation

As mentioned, the BRAF V600E mutation is a prognostic marker in CRC, predicting a higher recurrence rate and a shorter survival (15). According to our results, two-thirds of the patients had been diagnosed at late stages, and nearly half of them were deceased at the time of the study. Nevertheless, regarding the lack of mutant BRAF in all the studied probands, late diagnosis could justify the relatively high mortality rate in our patients. So, the survival of patients would be improved through implementing regular screening programs, an essential health-related process which is currently not performed in Iran.

Acknowledgments

Footnotes

References

  • 1.
    Haggar FA, Boushey RP. Colorectal cancer epidemiology: Incidence, mortality, survival, and risk factors. Clin Colon Rectal Surg. 2009;22(4):191-7. [PubMed ID: 21037809]. [PubMed Central ID: PMC2796096]. https://doi.org/10.1055/s-0029-1242458.
  • 2.
    Zeinalian M, Emami MH, Salehi R, Naimi A, Kazemi M, Hashemzadeh-Chaleshtori M. Molecular analysis of Iranian colorectal cancer patients at risk for Lynch syndrome: A new molecular, clinicopathological feature. J Gastrointest Cancer. 2015;46(2):118-25. [PubMed ID: 25722176]. https://doi.org/10.1007/s12029-015-9696-1.
  • 3.
    Liccardo R, De Rosa M, Izzo P, Duraturo F. Novel implications in molecular diagnosis of lynch syndrome. Gastroenterol Res Pract. 2017;2017:2595098. [PubMed ID: 28250766]. [PubMed Central ID: PMC5303590 manuscript]. https://doi.org/10.1155/2017/2595098.
  • 4.
    Vasen HF, Moslein G, Alonso A, Bernstein I, Bertario L, Blanco I, et al. Guidelines for the clinical management of Lynch syndrome (hereditary non-polyposis cancer). J Med Genet. 2007;44(6):353-62. [PubMed ID: 17327285]. [PubMed Central ID: PMC2740877]. https://doi.org/10.1136/jmg.2007.048991.
  • 5.
    Lynch HT, de la Chapelle A. Genetic susceptibility to non-polyposis colorectal cancer. J Med Genet. 1999;36(11):801-18. [PubMed ID: 10544223]. [PubMed Central ID: PMC1734258].
  • 6.
    Zeinalian M, Hashemzadeh-Chaleshtori M, Salehi R, Kazemi M, Emami MH. Tumor microsatellite instability and clinicopathologic features in Iranian colorectal cancer patients at risk for Lynch syndrome. J Res Med Sci. 2015;20(2):154-60. [PubMed ID: 25983768]. [PubMed Central ID: PMC4400710].
  • 7.
    Gatalica Z, Vranic S, Xiu J, Swensen J, Reddy S. High microsatellite instability (MSI-H) colorectal carcinoma: A brief review of predictive biomarkers in the era of personalized medicine. Fam Cancer. 2016;15(3):405-12. [PubMed ID: 26875156]. [PubMed Central ID: PMC4901118]. https://doi.org/10.1007/s10689-016-9884-6.
  • 8.
    Hamilton SR. BRAF mutation and microsatellite instability status in colonic and rectal carcinoma: Context really does matter. J Natl Cancer Inst. 2013;105(15):1075-7. [PubMed ID: 23878351]. https://doi.org/10.1093/jnci/djt189.
  • 9.
    Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417(6892):949-54. [PubMed ID: 12068308]. https://doi.org/10.1038/nature00766.
  • 10.
    de Vogel S, Weijenberg MP, Herman JG, Wouters KA, de Goeij AF, van den Brandt PA, et al. MGMT and MLH1 promoter methylation versus APC, KRAS and BRAF gene mutations in colorectal cancer: Indications for distinct pathways and sequence of events. Ann Oncol. 2009;20(7):1216-22. [PubMed ID: 19164452]. https://doi.org/10.1093/annonc/mdn782.
  • 11.
    Vandrovcova J, Lagerstedt-Robinsson K, Pahlman L, Lindblom A. Somatic BRAF-V600E mutations in familial colorectal cancer. Cancer Epidemiol Biomarkers Prev. 2006;15(11):2270-3. [PubMed ID: 17119056]. https://doi.org/10.1158/1055-9965.EPI-06-0359.
  • 12.
    Rajagopalan H, Bardelli A, Lengauer C, Kinzler KW, Vogelstein B, Velculescu VE. Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature. 2002;418(6901):934. [PubMed ID: 12198537]. https://doi.org/10.1038/418934a.
  • 13.
    Kambara T, Simms LA, Whitehall VL, Spring KJ, Wynter CV, Walsh MD, et al. BRAF mutation is associated with DNA methylation in serrated polyps and cancers of the colorectum. Gut. 2004;53(8):1137-44. [PubMed ID: 15247181]. [PubMed Central ID: PMC1774130]. https://doi.org/10.1136/gut.2003.037671.
  • 14.
    Deng G, Bell I, Crawley S, Gum J, Terdiman JP, Allen BA, et al. BRAF mutation is frequently present in sporadic colorectal cancer with methylated hMLH1, but not in hereditary nonpolyposis colorectal cancer. Clin Cancer Res. 2004;10(1 Pt 1):191-5. [PubMed ID: 14734469]. https://doi.org/10.1158/1078-0432.ccr-1118-3.
  • 15.
    Ducreux M, Chamseddine A, Laurent-Puig P, Smolenschi C, Hollebecque A, Dartigues P, et al. Molecular targeted therapy of BRAF-mutant colorectal cancer. Ther Adv Med Oncol. 2019;11:1758835919856490. [PubMed ID: 31244912]. [PubMed Central ID: PMC6582307]. https://doi.org/10.1177/1758835919856494.
  • 16.
    Zeinalian M, Hadian M, Hashemzadeh-Chaleshtori M, Salehi R, Emami MH. Familial colorectal cancer type X in central Iran: A new clinicopathologic description. Int J Hematol Oncol Stem Cell Res. 2017;11(3):240-5. [PubMed ID: 28989591]. [PubMed Central ID: PMC5625475].
  • 17.
    Francisco I, Albuquerque C, Lage P, Belo H, Vitoriano I, Filipe B, et al. Familial colorectal cancer type X syndrome: two distinct molecular entities? Fam Cancer. 2011;10(4):623-31. [PubMed ID: 21837511]. https://doi.org/10.1007/s10689-011-9473-7.
  • 18.
    Dominguez-Valentin M, Therkildsen C, Da Silva S, Nilbert M. Familial colorectal cancer type X: Genetic profiles and phenotypic features. Mod Pathol. 2015;28(1):30-6. [PubMed ID: 24743215]. https://doi.org/10.1038/modpathol.2014.49.
  • 19.
    Vasen HF, Watson P, Mecklin JP, Lynch HT. New clinical criteria for hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) proposed by the International collaborative group on HNPCC. Gastroenterology. 1999;116(6):1453-6. [PubMed ID: 10348829]. https://doi.org/10.1016/s0016-5085(99)70510-x.
  • 20.
    Kokkat TJ, Patel MS, McGarvey D, LiVolsi VA, Baloch ZW. Archived formalin-fixed paraffin-embedded (FFPE) blocks: A valuable underexploited resource for extraction of DNA, RNA, and protein. Biopreserv Biobank. 2013;11(2):101-6. [PubMed ID: 24845430]. [PubMed Central ID: PMC4077003]. https://doi.org/10.1089/bio.2012.0052.
  • 21.
    Boland CR, Goel A. Microsatellite instability in colorectal cancer. Gastroenterology. 2010;138(6):2073-2087 e3. [PubMed ID: 20420947]. [PubMed Central ID: PMC3037515]. https://doi.org/10.1053/j.gastro.2009.12.064.
  • 22.
    Dolatkhah R, Somi MH, Bonyadi MJ, Asvadi Kermani I, Farassati F, Dastgiri S. Colorectal cancer in Iran: Molecular epidemiology and screening strategies. J Cancer Epidemiol. 2015;2015:643020. [PubMed ID: 25685149]. [PubMed Central ID: PMC4312646]. https://doi.org/10.1155/2015/643020.
  • 23.
    Esmaeilzadeh A, Akhavan Rezayat K, Masannen Mozaffari H, Bahari A, Ghanaei O, Ganji A, et al. Prevalence of hereditary nonpolyposis colorectal cancer in patients with colorectal cancer in Iran: A systematic review. Reviews in Clinical Medicine. 2016;3(3):98-104.
  • 24.
    Kalady MF, Dejulius KL, Sanchez JA, Jarrar A, Liu X, Manilich E, et al. BRAF mutations in colorectal cancer are associated with distinct clinical characteristics and worse prognosis. Dis Colon Rectum. 2012;55(2):128-33. [PubMed ID: 22228154]. https://doi.org/10.1097/DCR.0b013e31823c08b3.
  • 25.
    Siraj AK, Bu R, Prabhakaran S, Bavi P, Beg S, Al Hazmi M, et al. A very low incidence of BRAF mutations in Middle Eastern colorectal carcinoma. Mol Cancer. 2014;13:168. [PubMed ID: 25005754]. [PubMed Central ID: PMC4109832]. https://doi.org/10.1186/1476-4598-13-168.
  • 26.
    Hsieh LL, Er TK, Chen CC, Hsieh JS, Chang JG, Liu TC. Characteristics and prevalence of KRAS, BRAF, and PIK3CA mutations in colorectal cancer by high-resolution melting analysis in Taiwanese population. Clin Chim Acta. 2012;413(19-20):1605-11. [PubMed ID: 22579930]. https://doi.org/10.1016/j.cca.2012.04.029.
  • 27.
    Zlobec I, Bihl MP, Schwarb H, Terracciano L, Lugli A. Clinicopathological and protein characterization of BRAF- and K-RAS-mutated colorectal cancer and implications for prognosis. Int J Cancer. 2010;127(2):367-80. [PubMed ID: 19908233]. https://doi.org/10.1002/ijc.25042.
  • 28.
    Li HT, Lu YY, An YX, Wang X, Zhao QC. KRAS, BRAF and PIK3CA mutations in human colorectal cancer: relationship with metastatic colorectal cancer. Oncol Rep. 2011;25(6):1691-7. [PubMed ID: 21424126]. https://doi.org/10.3892/or.2011.1217.
  • 29.
    Baskin Y, Calibasi G, Amirfallah A, Dagdeviren YK, Canda AE, Sarioglu S, et al. KRAS and BRAF mutation frequencies in a series of Turkish colorectal cancer patients. Transl Cancer Res. 2014;3(2):160-6.
  • 30.
    Asl JM, Almasi S, Tabatabaiefar MA. High frequency of BRAF proto-oncogene hot spot mutation V600E in cohort of colorectal cancer patients from Ahvaz City, southwest Iran. Pak J Biol Sci. 2014;17(4):565-9. [PubMed ID: 25911848]. https://doi.org/10.3923/pjbs.2014.565.569.
  • 31.
    Dolatkhah R, Dastgiri S, Somi MH, Jabbarpour Bonyadi M, Kermani IA, Farassati F. KRAS and BRAF mutations in colorectal cancer patients in northwest of Iran. J Clin Oncol. 2015;33(15_suppl):e14508. https://doi.org/10.1200/jco.2015.33.15_suppl.e14508.
  • 32.
    Fanelli GN, Dal Pozzo CA, Depetris I, Schirripa M, Brignola S, Biason P, et al. The heterogeneous clinical and pathological landscapes of metastatic Braf-mutated colorectal cancer. Cancer Cell Int. 2020;20:30. [PubMed ID: 32015690]. [PubMed Central ID: PMC6990491]. https://doi.org/10.1186/s12935-020-1117-2.
  • 33.
    Behl AS, Goddard KA, Flottemesch TJ, Veenstra D, Meenan RT, Lin JS, et al. Cost-effectiveness analysis of screening for KRAS and BRAF mutations in metastatic colorectal cancer. J Natl Cancer Inst. 2012;104(23):1785-95. [PubMed ID: 23197490]. [PubMed Central ID: PMC3514165]. https://doi.org/10.1093/jnci/djs433.
  • 34.
    Clarke CN, Kopetz ES. BRAF mutant colorectal cancer as a distinct subset of colorectal cancer: clinical characteristics, clinical behavior, and response to targeted therapies. J Gastrointest Oncol. 2015;6(6):660-7. [PubMed ID: 26697199]. [PubMed Central ID: PMC4671844]. https://doi.org/10.3978/j.issn.2078-6891.2015.077.
  • 35.
    Shaib W, Mahajan R, El-Rayes B. Markers of resistance to anti-EGFR therapy in colorectal cancer. J Gastrointest Oncol. 2013;4(3):308-18. [PubMed ID: 23997942]. [PubMed Central ID: PMC3712296]. https://doi.org/10.3978/j.issn.2078-6891.2013.029.
  • 36.
    Oikonomou E, Koustas E, Goulielmaki M, Pintzas A. BRAF vs RAS oncogenes: Are mutations of the same pathway equal? Differential signalling and therapeutic implications. Oncotarget. 2014;5(23):11752-77. [PubMed ID: 25361007]. [PubMed Central ID: PMC4322985]. https://doi.org/10.18632/oncotarget.2555.
  • 37.
    Barras D. BRAF mutation in colorectal cancer: An update. Biomark Cancer. 2015;7(Suppl 1):9-12. [PubMed ID: 26396549]. [PubMed Central ID: PMC4562608]. https://doi.org/10.4137/BIC.S25248.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles