1. Background
Breast cancer is a leading cause of cancer-related mortality in women worldwide (1). By 2030, the global incidence is expected to reach 3.2 million new cases annually. In Iran, the increasing prevalence of breast cancer is linked to lifestyle, diet, physical inactivity, and genetic predisposition. Surgical intervention remains primary, yet metastasis limits its use. Therefore, alternative strategies are required (2-5). Escitalopram, a selective serotonin reuptake inhibitor (SSRI), is commonly used to treat depression and anxiety. Beyond neurological roles, SSRIs may have cytotoxic effects on various cells, including cancerous ones (6-9). Escitalopram has shown potential in reducing MCF7 cell viability through BAX upregulation and BCL2 downregulation. Yet, few studies have explored the apoptotic mechanisms in depth (10, 11).
2. Objectives
The present study evaluates the cytotoxic effects of escitalopram on MCF7 and HEK293 cells, focusing on cell viability, gene expression, and possible apoptotic mechanisms.
3. Methods
Escitalopram (research grade) was obtained and dissolved in DMSO. Working concentrations were prepared at 15.625, 31.25, 62.5, 125, 250, and 500 µM. MCF7 and HEK293 cell lines were acquired from the Pasteur Institute of Iran and maintained in DMEM with 10% FBS and 1% penicillin-streptomycin at 37°C in a 5% CO2 incubator.
3.1. MTT Assay
MCF7 and HEK293 cells were seeded at 5 × 104 cells/well and treated with escitalopram concentrations for 48 hours. Post-treatment, MTT reagent (0.5 mg/mL) was added for 3 hours. Formazan crystals were dissolved in DMSO and absorbance measured at 570 nm using an ELISA reader. All experiments were performed in triplicate (12-19).
3.2. Gene Expression Analysis
Cells were treated with selected concentrations for 48 hours. Total RNA was extracted and cDNA synthesized using commercial kits. RT-PCR was performed using gene-specific primers with conditions: 95°C for 15, 60°C for 30, 72°C for 15 minutes. Relative gene expression was analyzed using the 2-ΔΔCt method (20-25). β-ACTIN was used as the housekeeping gene (Table 1).
Table 1.Primer Sequences of BCL2, and BAX Genes
| Genes | Sequences (5’-3’) | Accession Number |
|---|---|---|
| β-ACTIN | NM_001101.5 | |
| Forward | GGCACCCAGCACAATGAAG | |
| Reverse | CCGATCCACACGGAGTACTT | |
| BAX | NM_138761.4 | |
| Forward | CGGCAACTTCAACTGGGG | |
| Reverse | TTCAGCCCAACAGCCG | |
| BCL-2 | NM_000633.3 | |
| Forward | GGTGCCGGTTCAGGTACTCA | |
| Reverse | TTGTGGCCCTTCTTTGAGTTCG |
3.3. Statistical Analysis
IC50 values were calculated using nonlinear regression. Data were analyzed by one-way ANOVA with Tukey’s post hoc test. P-values < 0.05 were considered significant. Results are presented as mean ± SE.
4. Results
4.1. Effect of Escitalopram on MCF7 Viability
Escitalopram at 62.5, 125, 250, and 500 µM significantly reduced MCF7 viability compared to control (P < 0.001). No significant changes were observed at 15.625 and 31.25 µM (Figure 1).
Figure 1.
Comparison of the effects of various concentrations of escitalopram on the viability of MCF7 cells. *** indicates a statistically significant difference compared to the control group (P < 0.001).
4.2. Effect on HEK293 Cells
HEK293 cell viability significantly decreased at 125, 250, and 500 µM escitalopram (P < 0.001), and moderately at 62.5 µM (P < 0.01) (Figure 2).
Figure 2.
Comparison of the effects of various concentrations of escitalopram on the viability of HEK293 cells. *** indicates a statistically significant difference compared to the control group (P < 0.001).
4.3. Gene Expression Analysis in MCF7
A significant increase in BAX mRNA levels was found in treated MCF7 cells (** P < 0.01). Similarly, BCL2 expression increased significantly (** P < 0.01), contrary to expectations. Relative quantification (RQ) values are presented in (Figures 3 and 4).
Figure 3.
Comparison of the effects of escitalopram on the expression level of the BAX gene and in MCF7 cells. *Indicates significance compared to the control group. ** P < 0.01. (Abbreviation: RQ, relative quantification).
Figure 4.
Comparison of the effects of escitalopram on the expression level of the BCL2 gene and in MCF7 cells. *Indicates significance compared to the control group. ** P < 0.01. (Abbreviation: RQ, relative quantification).
5. Discussion
Given the ability of antidepressant drugs to inhibit cancer cells (1, 6, 7, 26), the impact of escitalopram on reducing the proliferation of breast cancer cells remains a highly debated topic. This study aimed to investigate the effects of escitalopram on breast cancer and normal cells using MTT assay and RT-PCR methods, to elucidate the cellular and molecular mechanisms by which escitalopram may eliminate breast cancer cells. The results of this study indicate that escitalopram exerts cytotoxic effects on MCF7 and HEK293 cell lines in a dose-dependent manner. In MCF7 cells, the cytotoxic effect may be linked to escitalopram’s ability to induce oxidative stress, mitochondrial dysfunction, or alterations in signaling pathways involved in cell survival (10, 11, 26-28). Previous studies have demonstrated that SSRIs, including escitalopram, can modulate calcium homeostasis, disrupt mitochondrial membrane potential, and activate apoptotic pathways, which could contribute to anticancer effects in breast cancer cells. The selective toxicity towards cancerous cells, if confirmed, could support further exploration of escitalopram as an adjuvant therapy in breast cancer treatment.
On the other hand, the cytotoxicity observed in HEK293 cells raises concerns regarding potential off-target effects in non-cancerous cells. HEK293 cells are widely used as a model for normal human cells, and significant cytotoxicity in these cells may indicate possible side effects of escitalopram beyond its neurological targets. This finding suggests that while escitalopram may have potential anticancer effects, its safety and specificity toward cancer cells must be carefully considered before clinical application.
Several studies support these findings, showing that SSRI antidepressants significantly reduce the viability of MCF7 cancer cells by increasing BAX gene expression and decreasing BCL2 gene expression (1, 10). Interestingly, despite previous studies indicating a downregulation of BCL2 by SSRIs, our findings showed a significant upregulation. This discrepancy may be due to differences in cell type, experimental conditions, or compensatory feedback mechanisms. Further investigation is warranted. Many studies have demonstrated that serotonin reuptake inhibitors can effectively inhibit breast cancer cells (27-30). Several studies indicated that escitalopram could reduce the viability of breast cancer cells (11, 28). Although further research is needed to comprehensively examine the effects of escitalopram on both cancerous and normal breast cells, this study focuses on the cytotoxic effects of escitalopram on breast cancer cells in a cell culture environment. The findings of this research may contribute to a better understanding of the potential and limitations of using escitalopram in breast cancer treatment and aid in developing more effective innovative therapeutic methods.
Future studies should focus on elucidating the precise molecular mechanisms underlying escitalopram-induced cytotoxicity, including its effects on apoptosis-related proteins, reactive oxygen species (ROS) generation, and mitochondrial integrity. Additionally, in vivo studies and clinical investigations are necessary to determine the therapeutic relevance of escitalopram in cancer treatment and its potential risks to normal tissues (31).
5.1. Conclusions
Escitalopram exerts dose-dependent cytotoxic effects on MCF7 breast cancer cells through BAX gene upregulation. However, observed cytotoxicity in HEK293 cells necessitates further safety evaluation.
