Detection of Malassezia Species Isolated From Patients With Pityriasis Versicolor and Seborrheic Dermatitis Using Nested-PCR

Author(s):
Ali Zarei MahmoudabadiAli Zarei MahmoudabadiAli Zarei Mahmoudabadi ORCID1, 2,*, Majid ZarrinMajid Zarrin1, Maryam AzishMaryam Azish1
1Health Research Institute, Infectious and Tropical Diseases Research Centre, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran
2Department of Medical Mycology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran

Jentashapir Journal of Cellular and Molecular Biology:Vol. 5, issue 6; e26683
Published online:Dec 25, 2014
Article type:Research Article
Received:Dec 04, 2014
Accepted:Dec 23, 2014
How to Cite:Zarei Mahmoudabadi A, Zarrin M, Azish M. Detection of Malassezia Species Isolated From Patients With Pityriasis Versicolor and Seborrheic Dermatitis Using Nested-PCR. Jentashapir J Cell Mol Biol. 2014;5(6):e26683. doi: https://doi.org/10.17795/jjhr-26683

Abstract

Background:

The species of the genus Malassezia are lipophilic and dimorphic yeasts that are regarded as part of the normal flora of the skin of humans and warm-blooded animals. These organisms are the cause of superficial mycosis in humans and other animals, and are common in pityriasis versicolor and seborrheic dermatitis.

Objectives:

The purpose of this study was to determine the frequency of common Malassezia species in patients affected by pityriasis versicolor and seborrheic dermatitis using of the nested PCR method, in the city of Ahvaz.

Patients and Methods:

In the present study, 85 samples from patients with pityriasis versicolor and seborrheic dermatitis were analyzed by the nested-PCR method. During the first stage, the internal transcribed spacer (ITS) region from the ribosomal DNA was reproduced using primers ITS4-R and ITS1F-N. During the second stage, the product of the first step was used as DNA and using three special primer pairs, including Mf-F, 5.8SR and M.gl-F, 5.8SR and M.rt-F and M.rt-R, the inner part of the first phase was detected.

Results:

The most common isolate was Malassezia furfur (51.3%) followed by M. globosa (35.2%) and M. restricta (13.5%). Amongst the 30 patients with seborrheic dermatitis, in 15 cases (65.2%) M. restricta, in six cases (26.1%) M. globosa and in two cases (8.7%) M. furfur was detected and in seven patients no isolate was detected.

Conclusions:

The nested-PCR is a rapid and repeatable method for identification of important Malassezia species and this method is recommended for use on more patients. In addition the most common agents of pityriasis versicolor and seborrheic dermatitis were M. furfur and M. restricta, respectively.

1. Background

Malassezia yeasts include a group of lipophilic and/or lipid-dependent, unipolar budding yeasts. The natural habitant of these yeasts is the skin of humans and other warm blooded animals (1, 2); they are found in 90% of healthy adult’s skin. They can change their saprophytic state and become pathogenic under the influence of predisposing factors, for example changes in the cutaneous microflora and/or alterations in host defenses (3). Yeasts of the Malassezia species cause pityriasis versicolor and are associated with pathogenesis of skin of disorders such as seborrheic dermatitis and atopic dermatitis, and recent information suggests their involvement in psoriasis (4). The first pityriasis versicolor disease was observed in 1801 by Willan. In 1889, Baillon suggested that the genus of Malassezia was the cause pityriasis versicolor (5, 6). In 1996 Gemmer et al. based on 28S rRNA gene sequences classified Malassezia genus to seven species (7). Fourteen species of Malassezia genus have been identified based on phenotypic features and molecular methods (8). The genus Malassezia includes the following species: Malassezia furfur, M. globosa, M. restricta, M. obtuse, M. sympodialis, M. slooffiae, M. pachydermatis, M. dermatis, M. japonica, M. nana, M. yamatoensis, M. equina, M. capra and M. cuniculi (3).

2. Objectives

The aim of the present study was to determine the frequency of common Malassezia species in patients with pityriasis versicolor and seborrheic dermatitis using of the nested PCR, in the city of Ahvaz.

3. Patients and Methods

In this study 85 clinical samples were collected from patients suspected of pityriasis versicolor and seborrheic dermatitis that had referred to our department of medical mycology. In addition some samples were also taken from patients referred to clinical health centers of Ahvaz. The samples of pityriasis versicolor were taken from each portion of the body that is more frequently affected by Malassezia and in seborrheic dermatitis from scalp scales. Malassezia DNA was extracted from scotch tape and scalp scales and major rDNA complex was amplified using the nested PCR assay with the general fungal ITS 1/4 and special primers.

3.1. Sample Collection

In patients with pityriasis versicolor, samples were collected by applying scotch tapes to lesional skin and in patients with seborrheic dermatitis, skin scales were scraped off by a sterile blade. A portion of the pathological samples was microscopically examined with methylene blue, which resulted in the appearance of many yeast cells and hyphae.

3.2. DNA Extraction

The Malassezia DNA was extracted according to methods of Sugita et al. (8). Briefly, scotch tapes samples of pityriasis versicolor and shells obtained from patients with seborrheic dermatitis were divided into small pieces and separately placed in a 2 mL eppendorf tube with 1.5 mL of lysis buffer (100 mM Tris-HCL [pH 8.0], 30 mM EDTA[pH 8.0], 0.05% sodium dodecyl sulfate) and incubated for 30 minutes at 100ºC. The scotch tapes were removed from the eppendorf tub and discarded. The suspension was extracted with 250 µL of phenol chloroform-isoamyl alcohol (25:24:1 vol/vol/vol). The samples were then extracted with 250 µL chloroform-isoamyl alcohol (24:1, vol/vol) and DNA was precipitated from the aqueous fraction with 2-propanol. Eventually the DNA pellet was washed in 70% cold ethanol and re-suspended in 50 µL of deionized water.

3.3. Detection of Malassezia by Nested PCR

Nested PCR was conducted using two sets of primers as shown in Table 1. In first round of PCR, ITS1/4 was used and in the second round of PCR, species-specific primers were used that were derived from the ITS region of the rRNA gene (8). Extracted DNA (10 µL) from each sample was added to 40 µL of the PCR master mix which consisted of 5 µL of 10 × PCR buffer (Cinnagen, Iran), 1.5 µL of 50 mM MgCL2 (Cinnagen, Iran), 1 µL of a 10 µM deoxynucleotide triphosphate mixture (an equimolar mixture of dATP, dCTP, dGTP and dTTP, Cinnagen, Iran), 0.3 µL of each primer (18S forward primer and 28S reverse primer), 0.5 µL of 5 U/µL Tag DNA polymerase (Cinnagen, Iran) and 34.1 µL of deionized water.
Table 1. Oligonucleotides Used in the Nested-PCR at the ITS Region of the rRNA Gene
Species and Primers UsedSequence (5ʹ 3ʹ)DNA Fragment Size, bp
First PCR for three Malassezia species
ITS1F-NGGATCATTAGTGATTGCCTTTATA
ITS4-RTCCTCCGCTTATTGATATG
Second PCR for each Malassezia species
M. furfur230
M. f-FCTACTCGCGTACAACGTCTCTG
5.8S-RTTCGCTGCGTTCTTCATCGA
M. globosa270
M.gl-FCAATAAGTGTGTCTCTGCGG
5.8S-RTTCGCTGCGTTCTTCATCGA
M. restricta320
M. rt-FCTTGGTTGGACCGTCACTG
M. rt-RAGGCGGATGCAAAGTGTCTC
Amplification was performed in a thermocycler (BioRad, USA) with pre-denaturation for five minutes at 94ºC, followed by 30 cycles including 30 seconds at 94ºC, 1 minute at 57ºC and 50 seconds at 72ºC and a final extension for 10 minutes at 72ºC. During the nested PCR step, 1 µL of the first PCR product was added to a new reaction mixture consisting of the same components as the first PCR reaction mixture. The nested PCR procedure consisted of pre-denaturation at 94ºC for three minutes, followed by 30 cycles of 30 seconds at 94ºC, 60 seconds at 62ºC, 40 seconds at 72ºC and 10 minutes at 72ºC as the final extension. Nested PCR products were confirmed by electrophoresis on a 2% (wt/vol) agarose gel; stained with ethidium bromide using 0.5X tris-acetate-EDTA buffer and then visualized by the gel documentation system (Gel Doc, BioRad) (8, 9) (Figure 1).
Lane M: DNA size marker 100 bp; lane 1: negative control; line 2: <i>M. restricta</i> (320 bp); lane 3: <i>M. globosa</i> (270 bp); lane 4: <i>M. furfur</i> (230 bp).
Figure 1.

Lane M: DNA size marker 100 bp; lane 1: negative control; line 2: M. restricta (320 bp); lane 3: M. globosa (270 bp); lane 4: M. furfur (230 bp).

4. Results

Among the 85 isolates of patients that were clinically suspected of pityriasis versicolor and seborrheic dermatitis, 75 (88.23%) isolates were stained by methylene blue, indicating that they were from the Malassezia genus. By using the nested PCR assay, three Malassezia species were detected at different rates in the samples of patients with seborrheic dermatitis and pityriasis versicolor. In this study, the most common species in pityriasis versicolor and seborrheic dermatitis were M. furfur (51.3%) and M. restricta (65.2%), respectively. Other species were M. globosa (35.2%) and M. restricta (13.5%) in pityriasis versicolor and M. globosa (26.1%), M. furfur (8.7%) in seborrheic dermatitis. In our study we didn’t detect any other species (Table 2).
Table 2. Rate of Isolation of Malassezia Species From Pityriasis Versicolor and Seborrheic Dermatitis Using the Three Primers a
Malassezia speciesPityriasis Versicolor (n = 45)Seborrheic Dermatitis (n = 30)
M. furfur19 (51.3)2 (8.7)
M. globosa13 (35.2)6 (26.1)
M. restricta5 (13.5)15 (65.2)
Malassezia spp.8 (17.8)7 (23.3)

aData are presented as No. (%).

5. Discussion

The Malassezia genus belongs to the class of Ustilaginomycetes. Various species of the lipophilic yeast, Malassezia, are known as normal flora of the human skin and warm blooded animals, yet under certain conditions they can cause disease in humans and other animals, in which the seborrheic dermatitis and pityriasis versicolor disease are the most common (10). Since different Malassezia species respond differently to treatment, the disease caused by these agents doesn’t improve completely and recurrence is frequently observed. Therefore, for successful treatment, identifying the disease-causing agent is necessary. Methods for identifying these species include culture-dependent methods, such as physiological methods, and molecular methods (2, 10-12).
Using physiological methods has several disadvantages, for instance the high similarity in physiological test results between some species, such as M. furfur, M. sympodialis and M. slooffiae. Furthermore, in physiological methods, the need for specific environmental conditions, type of chemical materials and culture medium compounds limit the use of these methods for identify Malassezia species. Hence, it is essential to develop a sensitive method with high reproducibility that requires a small number of samples, to achieve correct identification of this yeast. Molecular methods are suitable for this purpose because these methods are very accurate, sensitive and rapid and can be used to identify organisms at the species level and even subspecies (13).
Methods based on PCR, such as single-step PCR, PCR-RFLP, ITS-rDNA regions sequencing, Real-time PCR, nested-PCR and genes encoding proteins are some of these methods (4, 8, 9, 14). The current study aimed to identify the dominant species in Ahvaz using the nested-PCR assay in patients with pityriasis versicolor and seborrheic dermatitis. In most studies around the world, the PCR-RFLP technique has been used to identify organisms isolated from culture medium (9, 10, 13, 15, 16), yet in this study for the first time we used of scotch tape technique for sampling of skin lesions and used nested-PCR assay to identify Malassezia species. In the nested-PCR technique specific primers with high sensitivity are used in the second phase. In our study this technique was performed, due to the low amount of yeast resulting in a low amount of DNA.
In this study, from 37 (82.22%) samples from patients with pityriasis versicolor, the most common species was M. furfur (51.3%) followed by M. globosa (35.2%) and M. restricta (13.5%), respectively. In most epidemiological studies in the world, M. globosa has been isolated more than any other species of Malassezia from patients with pityriasis versicolor (15, 17-21). In this study, M. furfur was the predominant species in patients, this difference with previous studies might be justified by Malassezia species dispersion in different geographic regions and also differences in methods used to identify the species. Morishita et al. during 2006 in Japan by using the nested-PCR assay, identified nine species of Malassezia where M. globosa and M. restricta (both 93.9%) were the most common (21); these results were different from that of our study. Shams et al. in Tehran during 2006 by using PCR-RFLP reported that M. globosa was the most common species isolated from samples (10). This result is in contrast with the results of our study.
One reason for this difference in results could be due to differences in the distribution of causing agents of pityriasis versicolor in Tehran and Ahvaz cities. Giusiano et al. in a study on patients with pityriasis versicolor in Argentina during the year 2010 reported M. sympodialis as the most common species (16). The results of this study confided with the results of our study and most other studies around the world. Since in that study the PCR-RFLP technique was used, perhaps the lack of consistent results with other studies, could be that some species are sensitive to changing of environmental conditions and some have low growth rates, such as M. globosa, M. obtuse and M. restricta. Mahmoudirad et al. performed a study in 2008 on 60 clinical isolates of pityriasis versicolor lesions using the PCR-RFLP method and reported that the most common species isolated was M. furfur (36.67%) followed by M. globosa (30%) (22). These results were consistent with the results of our study.
In most studies done around the world, the dominant species was M. restricta in patients with seborrheic dermatitis. Lim et al. (23) in 2008 using the nested-PCR, and Lee et al. in 2011 using the PCR-RFLP method, attempted to identify Malassezia species in patients with seborrheic dermatitis. In patients with seborrheic dermatitis, M. restricta (47%) and M. furfur (27%) were the dominant species (9). The results of the mentioned studies, was consistent with our results. In this study, we investigated the frequency of three species of M. furfur, M. globosa and M. restricta, due the commonality of these species in various studies done around the world on pityriasis versicolor and seborrheic dermatitis disease (8, 9, 16, 21). Other species were not surveyed due to their lower incidence in previous reports.
This study was not devoid of limitations, and limitations included a low sample size and also the fact that only three Malassezia species were considered. The importance of the present study was the application of the scotch tape as a method of sampling that was not used by any other relevant previous studies. In all previous studies, DNA extraction was performed using cultivated specimens or clinical samples were prepared using scraping shells. Furthermore there have been no previous studies on identification of Malassezia species in Ahvaz. The results can give an idea about disease causing species common in this region and since species have different sensitivities to antifungal drugs these results with further research could facilitate with choosing appropriate treatment options (13). The nested-PCR is a rapid and repeatable method for identification of important Malassezia species and should be used on more patients in the future. In conclusion, the most common agents of pityriasis versicolor and seborrheic dermatitis were M. furfur and M. restricta, respectively.

Acknowledgments

References

  • 1.
    Guého-Kellermann E, Boekhout T, Begerow D. Biodiversity, phylogeny and ultrastructure. Malassezia and the Skin. Springer Verlage Berlin Heidelberg; 2010. p. 17-63.
  • 2.
    Trabelsi S, Oueslati J, Fekih N, Kammoun MR, Khaled S. Identification of Malassezia species from Tunisian patients with pityriasis versicolor. Tunis Med. 2010;88(2):85-7. [PubMed ID: 20415164].
  • 3.
    Cafarchia C, Gasser RB, Figueredo LA, Latrofa MS, Otranto D. Advances in the identification of Malassezia. Mol Cell Probes. 2011;25(1):1-7. [PubMed ID: 21193026]. https://doi.org/10.1016/j.mcp.2010.12.003.
  • 4.
    Gaitanis G, Velegraki A, Alexopoulos EC, Chasapi V, Tsigonia A, Katsambas A. Distribution of Malassezia species in pityriasis versicolor and seborrhoeic dermatitis in Greece. Typing of the major pityriasis versicolor isolate M. globosa. Br J Dermatol. 2006;154(5):854-9. [PubMed ID: 16634886]. https://doi.org/10.1111/j.1365-2133.2005.07114.x.
  • 5.
    Hu SW, Bigby M. Pityriasis versicolor: a systematic review of interventions. Arch Dermatol. 2010;146(10):1132-40. [PubMed ID: 20956647]. https://doi.org/10.1001/archdermatol.2010.259.
  • 6.
    Crespo-Erchiga V, Florencio VD. Malassezia yeasts and pityriasis versicolor. Curr Opin Infect Dis. 2006;19(2):139-47. [PubMed ID: 16514338]. https://doi.org/10.1097/01.qco.0000216624.21069.61.
  • 7.
    Gemmer CM, DeAngelis YM, Theelen B, Boekhout T, Dawson Jr TJ. Fast, noninvasive method for molecular detection and differentiation of Malassezia yeast species on human skin and application of the method to dandruff microbiology. J Clin Microbiol. 2002;40(9):3350-7. [PubMed ID: 12202578].
  • 8.
    Sugita T, Suto H, Unno T, Tsuboi R, Ogawa H, Shinoda T, et al. Molecular analysis of Malassezia microflora on the skin of atopic dermatitis patients and healthy subjects. J Clin Microbiol. 2001;39(10):3486-90. [PubMed ID: 11574560]. https://doi.org/10.1128/JCM.39.10.3486-3490.2001.
  • 9.
    Lee YW, Byun HJ, Kim BJ, Kim DH, Lim YY, Lee JW, et al. Distribution of malassezia species on the scalp in korean seborrheic dermatitis patients. Ann Dermatol. 2011;23(2):156-61. [PubMed ID: 21747613]. https://doi.org/10.5021/ad.2011.23.2.156.
  • 10.
    Shams M, Amanlu S. Foruzandeh Moghadam, Mirza Hosseini H. Identification of the commone Malassezia species in Iran using PCR-RFLP. J Med Sci. 2009;9(1):37-42.
  • 11.
    Fisher AM, Rucker N, Wong S, Gomer CJ. Differential photosensitivity in wild-type and mutant p53 human colon carcinoma cell lines. J Photochem Photobiol B. 1998;42(2):104-7. [PubMed ID: 9540217].
  • 12.
    Oh BH, Song YC, Lee YW, Choe YB, Ahn KJ. Comparison of Nested PCR and RFLP for Identification and Classification of Malassezia Yeasts from Healthy Human Skin. Ann Dermatol. 2009;21(4):352-7. [PubMed ID: 20523823]. https://doi.org/10.5021/ad.2009.21.4.352.
  • 13.
    Shokuhi T, Haj Heidari Z, Barzegar A, Hashemi Sutah MB, Hedaiati MT, Aghili R, et al. Identification of Malassezia species were separated of patients affected with pityriasis versicolor and seborrheic dermatitis using PCR RFLP. J Med Sci. 2008;18(66):169-73.
  • 14.
    Nascente PS, Coimbra HS, Meinerz ARM, Meireles MCA, Mello JRB, Schuch LFD. Molecular heterogeneity of Malassezia pachydermatis through RAPD-PCR. Maringa. 2010;32(2):169-73.
  • 15.
    Shokohi T, Afshar P, Barzgar A. Distribution of Malassezia species in patients with pityriasis versicolor in Northern Iran. Indian J Med Microbiol. 2009;27(4):321-4. [PubMed ID: 19736400]. https://doi.org/10.4103/0255-0857.55445.
  • 16.
    Giusiano G, Sosa Mde L, Rojas F, Vanacore ST, Mangiaterra M. Prevalence of Malassezia species in pityriasis versicolor lesions in northeast Argentina. Rev Iberoam Micol. 2010;27(2):71-4. [PubMed ID: 20346299]. https://doi.org/10.1016/j.riam.2009.12.005.
  • 17.
    Rasi A, Naderi R, Behzadi AH, Falahati M, Farehyar S, Honarbakhsh Y, et al. Malassezia yeast species isolated from Iranian patients with pityriasis versicolor in a prospective study. Mycoses. 2010;53(4):350-5. [PubMed ID: 19500258]. https://doi.org/10.1111/j.1439-0507.2009.01727.x.
  • 18.
    Affes M, Ben Salah S, Makni F, Sellami H, Ayadi A. Molecular identification of Malassezia species isolated from dermatitis affections. Mycoses. 2009;52(3):251-6. [PubMed ID: 18643889]. https://doi.org/10.1111/j.1439-0507.2008.01589.x.
  • 19.
    Moniri R, Nazeri M, Amiri S, Asghari B. Isolation and identification of Malassezia spp. In pytiriasis versicolor in Kashan, Iran. Pak J Med Sci. 2009;25(5):837-40.
  • 20.
    Nazeri M, Shokuh Amiri M, Moniri R, Moaiieri M, Marvuji A, Asgharim B. Identification of various Malassezia species in pityriasis versicolor and seborrheic dermatitis patients in Kashan. J Med Kosar. 2008:293-6.
  • 21.
    Morishita N, Sei Y, Sugita T. Molecular analysis of malassezia microflora from patients with pityriasis versicolor. Mycopathologia. 2006;161(2):61-5. [PubMed ID: 16463088]. https://doi.org/10.1007/s11046-005-0149-4.
  • 22.
    Mahmoudirad M, Miramin Mohamadi A, Tusi P, Khamesipur A, Ehsani AH. Eskandari A. Identification of Malassezia species of pityriasis versicolor by using PCR-RFLP. J Skin Cosmetic. 2011;2(2):106-14.
  • 23.
    Lim SW, Shin MG, Lim JY, Yun SJ, Kim SJ, Lee SC, Won YH, Lee JB. Nested PCR for detection of Malassezia species from patient skin scales and clinical strains. Korean J Dermatol. 2008;46(4).

Similar Articles

1
Jul
2014

Molecular Identification and Prevalence of Malassezia Species in Pityriasis Versicolor Patients From Kashan, Iran

Rezvan Talaee,
Farzad Katiraee,
Maryam Ghaderi,
Mahzad Erami,
Azam Kazemi Alavi,
Mehdi Nazeri

Talaee R, Katiraee F, Ghaderi M, Erami M, Kazemi Alavi A, et al. Molecular Identification and Prevalence of Malassezia Species in Pityriasis Versicolor Patients From Kashan, Iran. Jundishapur J Microbiol. 2014;7(8):e11561. doi: https://doi.org/10.5812/jjm.11561

1
Aug
2013

Identification of Malassezia Species Isolated From Patients With Pityriasis Versicolor in Sari, Iran, 2012

Parvaneh Afshar,
Maryam Ghasemi,
Shamsi Kalhori

Afshar P, Ghasemi M, Kalhori S. Identification of Malassezia Species Isolated From Patients With Pityriasis Versicolor in Sari, Iran, 2012. Jundishapur J Microbiol. 2013;6(6):e8581. doi: https://doi.org/10.5812/jjm.8581

10
Sep
2013

Distribution of Malassezia Species in Patients with Pityriasis versicolor Compared with Healthy Individuals in Yazd, Iran

Abbas Ali Jafari,
Hossein Zarrinfar,
Farzanenh Mirzaei,
Farzad Katiraee

Jafari AA, Zarrinfar H, Mirzaei F, Katiraee F. Distribution of Malassezia Species in Patients with Pityriasis versicolor Compared with Healthy Individuals in Yazd, Iran. Jundishapur J Microbiol. 2013;6(7):e6873. doi: https://doi.org/10.5812/jjm.6873

31
Jul
2009

Pityriasis versicolor in Ahvaz, Iran

Ali Zarei Mahmoudabadi,
Zahra Mossavi,
Majid Zarrin

Mahmoudabadi AZ, Mossavi Z, Zarrin M. Pityriasis versicolor in Ahvaz, Iran. Jundishapur J Microbiol. 2009;2(3):. doi:

30
Jun
2015

Use of Restriction Fragment Length Polymorphism to Rapidly Identify Dermatophyte Species Related to Dermatophytosis

Rasoul Mohammadi,
Mahdi Abastabar,
Hossein Mirhendi,
Hamid Badali,
Shahla Shadzi,
Mustafa Chadeganipour
,et al.

Mohammadi R, Abastabar M, Mirhendi H, Badali H, Shadzi S, et al. Use of Restriction Fragment Length Polymorphism to Rapidly Identify Dermatophyte Species Related to Dermatophytosis. Jundishapur J Microbiol. 2015;8(6):e17296. doi: https://doi.org/10.5812/jjm.8(5)2015.17296


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles