The Effect of Resistance Training and Phoenix dactylifera L. Extract on DRP1 and MFN1 Protein Expression, and the Apoptotic Status of Rat Liver: A Safe Alternative to Testosterone Injection

Author(s):
Zahra AlikaeiZahra Alikaei1, Mohammad Ali AzarbayjaniMohammad Ali AzarbayjaniMohammad Ali Azarbayjani ORCID1,*, Sirvan AtashakSirvan AtashakSirvan Atashak ORCID2, Maghsoud PeeriMaghsoud PeeriMaghsoud Peeri ORCID1, Saleh Rahmati-AhmadabadSaleh Rahmati-AhmadabadSaleh Rahmati-Ahmadabad ORCID3
1Department of Exercise Physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran
2Department of Physical Education and Sports Sciences, Mahabad Branch, Islamic Azad University, Mahabad, Iran
3Department of Physical Education, Pardis Branch, Islamic Azad University, Pardis, Iran

Thrita Journal of Neuron:Vol. 12, issue 1; e139245
Published online:Aug 14, 2023
Article type:Research Article
Received:Jul 19, 2023
Accepted:Jul 26, 2023
How to Cite:Alikaei Z, Azarbayjani MA, Atashak S, Peeri M, Rahmati-Ahmadabad S. The Effect of Resistance Training and Phoenix dactylifera L. Extract on DRP1 and MFN1 Protein Expression, and the Apoptotic Status of Rat Liver: A Safe Alternative to Testosterone Injection. Thrita J Neu. 2023;12(1):e139245. doi: https://doi.org/10.5812/thrita-139245

Abstract

Background:

Testosterone enhances athletic performance in men and women, but its consumption has several side effects and is banned from most competitive sports. This study aimed to examine the effect of date palm pollen extracts (DPPE or Phoenix dactylifera L.), testosterone enanthate (T), and resistance training (RT) alone and in combination on hepatic damage and mitochondrial function of adult male rats.

Methods:

Thirty male Sprague–Dawley rats were randomly divided into six groups: Control (C), RT-treated, DPPE-treated, T-treated, DPPE+RT-treated, and T+RT-treated. The DPPE-treated animals received 100 mg/kg DPPE by gavage (five days/week for four weeks). T was injected subcutaneously into the target groups at a dose of 2 mg/kg daily (five days/week for four weeks). Moreover, the RT program was performed using a vertical ladder with weights (five days/week for four weeks).

Results:

RT, T, and DPPE significantly reduced collagen degradation, apoptotic cells, dynamin-related protein 1 (DRP1) protein expression, and increased mitofusin-1 (Mfn-1) gene and protein expression in liver tissue. RT with T/DPPE showed a synergic effect regarding present study variables.

Conclusions:

It seems that DPP, which is a natural compound, has less damaging effects than T on liver tissue. It can be used as a safe alternative to T injection for the enhancement of athletic performance and T deficiency.

1. Background

Most athletes use exercise supplements comprising anabolic-androgenic steroids (AAS), such as testosterone, to improve performance (1). Testosterone was first isolated in 1935, and then its synthesis methods were founded by Butenandt and Ruzicka (2). In the early 1950s, AASs were initially introduced to muscle building, and their use gradually moved on to other sports to increase muscle strength. Ultimately, the Olympic games and other athletic associations banned the use of these supplements in 1967 (3). Testosterone and its derivatives increase fat-free mass, lean muscle mass, overall body weight, skeletal muscle strength, and athletic performance (4-6). There are several side effects associated with the use of androgens, including testicular atrophy, gynecomastia, dyslipidemia, infertility, and severe liver damage (4, 7). There are three distinct patterns of liver injury due to AAS, including peliosis hepatis, liver tumors, and rarely nodular regenerative hyperplasia (NRH), which can occur with any route of administration. The use of steroid supplements is becoming a primary public health concern, with evidence of increased use among men over 40 and young gym attendees (8).
Liver failure is closely related to the incidence of mitochondria dysfunction. Mitochondria are the most critical organelles for energy metabolism (9, 10). Mitochondria perform their biological function through fusion and continuous divisions (11) using many proteins, including dynamin-related protein (DRP1), mitofusin 1 (Mfn1), mitofusin 2 (Mfn2), and mitochondrial fission one protein (Fis1) (12-14). Mitochondrial shape maintenance is dependent on the balance between fission and fusion events. Mitofusins (Mfn2 and Mfn1) were revealed to promote endomembrane docking and outer membrane fusion (15). DRP1 and Fis1 were displayed to induce mitochondrial fission and self-assemble into spiral- and ring-like structures that could fit the size of mitochondrial constriction sites (16, 17). Based on studies, Mfn2 has an essential effect on cell apoptosis and autophagy and plays distinct roles among different tissues (11, 18).
Date palm pollen (DPP or Phoenix dactylifera L., from the Palmae family) is the male reproductive cells of palm flowers, which was used by the early Chinese and Egyptian people as a rejuvenating therapeutic agent (19). DPP extracts were shown to possess a myriad of pharmacological properties, like antioxidants (20). Furthermore, it has been used in traditional medicine to treat various disorders, including liver and kidney diseases, memory impairment, complete paralysis, inflammation, fever, consciousness loss, and many neurological diseases (21, 22).
It has been shown that strength and hypertrophy are developed by resistance training (RT) for people with wasting diseases and elite athletes seeking to maximize their performance (23). Testosterone can also increase strength and hypertrophy, even without resistance training in both young (24) and older men (25). Many studies have demonstrated the role of RT in increasing blood serum testosterone (26, 27).

2. Objectives

In the present study, we tested the effect of DPP Extract (DPPE) and testosterone alone (T) and in combination with resistance exercise on liver tissue in adult male rats. To this end, the gene expression of MFN1 and protein expression of DRP1 and MFN1 were evaluated. Also, cell apoptotic status in the liver was assessed using tunnel assay. Moreover, collagen deposition in the liver was detected by Masson’s trichrome staining.

3. Methods

3.1. Animal and Ethic

Thirty 8-week Sprague–Dawley male rats were purchased from the Tehran Pasteur Institute. All animals were housed in standard cages with standard laboratory conditions (temperature was 22°C, the humidity was about 45%, and light-dark cycles were 12/12 hours) and free access to food and water. To perform the project, the animals were randomly divided into six groups (n = 5 in each group), including (1) Control (C) group, (2) RT-treated group, (3) DPPE-treated group, (4) Testosterone (T)-treated group, (5) DPPE+RT- treated group, and (6) T+RT-treated group.

3.2. Animal Treatments

We gave 100 mg/kg DPPE to animals of groups 3 and 5 (five days/week for four weeks) (28). Then, 100 mg testosterone enanthate was purchased from the pharmacy and subcutaneously injected into animal groups 4 and 6 at a dose of 2 mg/kg daily (five days/week for four weeks) (29).

3.3. RT Program

Climbing from the vertical ladder (110 cm height, 80-degree incline, and 2 cm separation between steps) were used for the exercise of animal groups 2, 5, and 6. After being familiarized with the ladder without load, the first load was 75% of each rat’s body weight, and the load was increased by 30 g for each following set until the rats were no longer able to travel the entire ladder. The second phase of progressive training was begun after 48 hours, consisting of four to seven ladder climbs a day for four weeks. Each of the first four sets of climbing was performed using loads that were 50, 75, 90, and 100% of the rat’s body weight. After that, the weight became heavy until the rats could no longer climb the ladder (30).

3.4. DPPE Preparation and Biochemical Methods

Phoenix dactylifera were collected from palm groves (Shahdad, Kerman, Iran). Extracted, and the efficiency of extraction was 87.17%. The extraction process, tissue histological assay, Masson’s trichrome staining, immunohistochemistry, and real-time PCR were carried out exactly according to the article by Nazarian et al. (31). Table 1 summarizes primers used for the real-time PCR.
Table 1.Primers Used for the Real-time PCR
Gene NameForward PrimerReverse Primer
MFN1CTCCTG TAATCTTGCCTGATCGGATCTTTTTTGTTTCAGC
GAPDHAAGTTCAACGGCACAGTCAAGGCATACTCAGCACCAGCATCACC

3.5. Statistical Method

Data were reported based on the mean ± standard deviation (SD). A two-way analysis of variance (ANOVA) was used to determine the effect of RT, DDPE, and T and their interaction with the present study’s variables. The Bonferroni post hoc test was used to determine the location of the difference. The significance level was also considered for all calculations (P < 0.05). All statistical analyses were done using SPSS software version 24.

4. Results

In this study, RT significantly reduced the percentage of collagen degradation (F = 499.56, P = 0.001, η = 0.943). Receiving drugs also had a significant effect on the percentage of collagen degradation (F = 61.27, P = 0.001, η = 0.803). Moreover, DPPE (P = 0.001 and synthetic T (P = 0.001) significantly reduced collagen degradation. The interaction of RT and DPPE also significantly reduced the percentage of collagen degradation (F = 8.46, P = 0.001, η = 0.361). Simultaneous RT and DPPE or synthetic T enhanced the effect of each other on reducing collagen degradation. However, when synthetic T was accompanied by exercise, the percentage of reduction in collagen degradation was higher than when exercise was with DPPE (Figure 1).
Percentage of collagen degradation in the studied groups (A and B). RT-PD, resistance training-<i>Phoenix dactylifera</i>; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, <i>Phoenix dactylifera</i>; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.
Figure 1.

Percentage of collagen degradation in the studied groups (A and B). RT-PD, resistance training-Phoenix dactylifera; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, Phoenix dactylifera; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.

The RT significantly increased MFN-1 gene expression. (F = 37.56, P = 0.001, η = 0.556). Receiving the drug (synthetic T and DPPE) also significantly affected the MFN-1 gene expression (F = 14.53, P = 0.001, η = 0.492). So, DPPE (P = 0.001) and synthetic T (P = 0.001) might increase the expression of this gene. Also, RT and DPPE interaction caused a significant increase in MFN-1 gene expression (F = 6.04, P = 0.006, η = 0.287). In other words, RT, DPPE, and synthetic T might enhance the effect of each other on the expression of this gene. However, the effect of synthetic T was greater than that of DPPE (Figure 2).
MFN-1 gene expression in the studied groups. RT-PD, resistance training-<i>Phoenix dactylifera</i>; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, <i>Phoenix dactylifera</i>; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.
Figure 2.

MFN-1 gene expression in the studied groups. RT-PD, resistance training-Phoenix dactylifera; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, Phoenix dactylifera; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.

The RT significantly reduced DRP-1 protein expression (F = 270.77, P = 0.001, η = 0.900). Receiving drugs also had a significant effect on DRP-1 protein expression (F = 351.29, P = 0.001, η = 0.959). DRP-1 protein expression was significantly reduced by receiving DPPE supplements (P = 0.001 and synthetic T (P = 0.001). The interaction of RT and drug significantly reduced DRP-1 protein expression (F = 15.65, P = 0.001, η = 0.511). Simultaneous RT and DPPE or synthetic T enhanced the effect of each other on reducing DRP-1 protein expression. However, when synthetic testosterone was accompanied by training, the percentage of decreased DRP-1 protein expression was higher than the time when training was done with DPPE (Figure 3).
DRP-1 protein expression in the studied groups. RT-PD, resistance training-<i>Phoenix dactylifera</i>; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, <i>Phoenix dactylifera</i>; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.
Figure 3.

DRP-1 protein expression in the studied groups. RT-PD, resistance training-Phoenix dactylifera; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, Phoenix dactylifera; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.

Moreover, RT significantly increased MFN-1 protein expression (F = 916.99, P = 0.001, η = 0.968). Receiving drugs also had a significant effect on MFN-1 protein expression (F = 372.42, P = 0.001, η = 0.961). In a way that both DPPE (P = 0.001) and synthetic T (P = 0.001) significantly increased the expression of this protein. The interaction of training and DPPE also significantly increased MFN-1 protein expression (F = 133.15, P = 0.001, η = 0.899). In other words, these two interventions were able to enhance the effect of each other on the expression of this protein. However, when synthetic testosterone was accompanied by training, the enhancement rate of this protein expression was higher than when training was done with DPPE (Figure 4).
MFN-1 protein expression in the studied groups. RT-PD, resistance training-<i>Phoenix dactylifera</i>; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, <i>Phoenix dactylifera</i>; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.
Figure 4.

MFN-1 protein expression in the studied groups. RT-PD, resistance training-Phoenix dactylifera; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, Phoenix dactylifera; T, testosterone enanthate; C, control. * Denotes significant differences from the C group. † Denotes significant interaction. Data are expressed as mean and standard deviation.

Training significantly reduced the percentage of apoptotic cells (F = 545.32, P = 0.001, η = 0.948). Receiving drugs also had a significant effect on the percentage of apoptotic cells (F = 160.37, P = 0.001, η = 0.914). Both DPPE (P = 0.001) and synthetic T (P = 0.001) significantly reduced the percentage of apoptotic cells. Also, the interaction of training and DPPE significantly reduced the percentage of apoptotic cells (F = 47.61, P = 0.001, η = 0.760). Simultaneous RT and DPPE or synthetic testosterone enhanced the effect of each other on the percentage of apoptotic cells. However, when synthetic testosterone was accompanied by exercise, the percentage of apoptotic cells was higher than when exercise was done with DPPE (Figure 5).
Percentage of apoptotic cells in the studied groups (A and B). RT-PD, resistance training-<i>Phoenix dactylifera</i>; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, <i>Phoenix dactylifera</i>; T, testosterone enanthate; C, control. *Denotes significant differences from the C group. †Denotes significant interaction. Data are expressed as mean and standard deviation.
Figure 5.

Percentage of apoptotic cells in the studied groups (A and B). RT-PD, resistance training-Phoenix dactylifera; RT-T, resistance training-testosterone enanthate; Rt, resistance training; PD, Phoenix dactylifera; T, testosterone enanthate; C, control. *Denotes significant differences from the C group. †Denotes significant interaction. Data are expressed as mean and standard deviation.

5. Discussion

Exogenous T increases athletic performance, but it is prohibited from most female and male competitions. Health risks can be produced by the long-term use of AAS and can result in several adverse events in different tissues and the incidence of drug-induced liver injury (DILI) (1, 6, 32). Consequently, finding herbs as natural supplements that can help the body make T, on the other hand, reduce the adverse health effects of T therapy in an athletic and older man, is of particular importance.
In the present study, we conducted a comparative evaluation between DPPE with T treatment alone and in combination with RT. Based on the results, combination therapy reduced the fission gene and protein expression levels in the liver compared to testosterone alone and DPPE alone treated groups. Furthermore, a combination of RT with T or DPPE reduced apoptosis and collagen deposition in the liver tissue.
Our results revealed that RT results in mitochondrial damage, apoptosis, and fibrosis in the liver. Indeed, RT includes performing low to moderate-intensity workouts for a long time. It has been shown to heighten muscle oxidation capacity and enhance mitochondrial biogenesis in skeletal muscle. In addition, RT activates mitochondrial stress by activating complexes I, IV, and V. Exercise has different effects on liver function. Sun and colleagues reported that exercise could cause oxidative and mitochondrial stress in the liver. They explained that exercise-induced oxidative and mitochondrial stress might be either damaging by causing injury or beneficial by activating defense systems (33). Mikami et al. showed that exercise increased the resting level of HSP70 in the liver and that HSP70 accumulation helps protect stress-loaded cells from damage caused by increased chaperone activity and suppression of apoptosis (34). Oxidative stress results in macromolecular damage to cellular DNA, proteins, and lipids. Reactive oxygen species (ROS) is one of the mitochondrial DNA-damaging agents and is known to be apoptosis-inducing.
Mitochondria are one of the essential ROS production sites. For example, eliminating fusion proteins, OPA1 or Mfns, causes mitochondrial fragmentation with increasing ROS levels. Fission protein knockdown (such as Fis1 and dynamin one protein (Drp1) does not affect ROS production in human bronchial epithelial cells while indicating mitochondrial fusion (35). Mitochondrial membrane potential reduction, defective ATP synthesis, and the overproduction of ROS are interrelated and lead to mitochondrial dysfunction (36). These factors are related to mitochondrial morphology changes. Li et al. reported that activation and overexpression of Drp1 exacerbated hepatic apoptosis (37). However, Zhang et al. revealed that activation of Drp1 remarkably diminished the apoptosis of hepatocytes (38). In contrast, in another research, it was shown that inhibition of Drp1 by small interfering RNAs could significantly improve the lost potential of the mitochondrial membrane in HT-22 cells (39). DRP1 activation and intracellular ROS increase are directly related to each other (40). Based on the cell’s metabolic needs, mitochondrial morphology is varied by regulated cycles of fusion (increases metabolic efficiency) and fission (favors uncoupled respiration to reduce oxidative stress) (41). Energy demand and stress induce the fusion of mitochondria. Studies have shown that Mfn2 preserves normal hepatic metabolism, and its erosion reduces mitochondrial respiration, decreases glucose tolerance, and increases hepatic glucose production (42). Therefore, our results were in line with previous studies that show a decrease in the expression of Mfn1 and Mfn2 genes and an increase in the Drp1 and Fis1 genes in RT.
Mitochondrial fission usually occurs under calm conditions, but it can also happen during high cellular stress levels when it activates apoptosis. Mitochondrial dynamics may play a significant role in liver fibrosis pathophysiology. It is demonstrated that hepatocyte epithelial-mesenchymal transition (EMT) is related to the mitochondrial dynamic imbalance induced by oxidative stress so that mitochondrial dynamics modulation can reverse liver fibrosis. Hepatic fibrosis occurs in many liver disorders and leads to scarring and liver damage (43-45). Liver fibrosis is a wound-healing response characterized by excessive deposition of extracellular matrix (ECM) proteins, hepatocyte damage, distortion of the hepatic lobules, and changes in vascular architecture. If left untreated, it can proceed to cirrhosis or liver carcinoma (46). It is supposed that exercises, probably via activating defense systems and a significant increase in enzyme activities, cope with the excess of free radicals produced by oxidative stress (33, 47).
Our results revealed that DPPE could reduce oxidative stress induced by RT, thus diminishing mitochondrial damage, apoptosis, and fibrosis in the liver. In line with our results, Saafi et al. showed the protective effect of date palm fruit extract (Phoenix dactylifera L.) on oxidative stress induced by dimethoate in rats’ livers (48). We supposed that the DPPE is likely to exert its beneficial effects by strengthening the immune system against exercise-induced oxidative stress.

5.1. Conclusions

The effects of a six-week RT program on mitochondrial mitofusin and mito-fission gene and protein expression and tissue damage in rats’ livers and the consequences of a combination of T and DPPE were investigated. The results showed that RT increased mitochondrial fragmentation in the liver. Treatment with the combination of DPPE and T caused expression elevation of the mitofusin gene and proteins. Also, apoptosis and collagen deposition in the liver were significantly reduced in combination therapy. These results suggest that DPPE is a natural compound that has characteristics like testosterone. With the ability to reduce the side effects of oxidative stress created during exercise in the liver and the positive impact in treating many diseases, it can be an excellent alternative to testosterone.

Acknowledgments

Footnotes

References

  • 1.
    Alhajjaj AH, Aldarweesh HH. Anabolic Androgenic Steroid Use Prevalence, Knowledge, and Practice Among Male Athletes in Eastern Province of Saudi Arabia. Electron J Gen Med. 2020;17(2):em187. https://doi.org/10.29333/ejgm/7617.
  • 2.
    Ruzicka L. The male sex hormones. J Chem Educ. 1936;13(1):3. https://doi.org/10.1021/ed013p3.
  • 3.
    Wade N. Anabolic Steroids: Doctors Denounce Them, but Athletes Aren't Listening. Science. 1972;176(4042):1399-403. [PubMed ID: 17834639]. https://doi.org/10.1126/science.176.4042.1399.
  • 4.
    Hartgens F, Kuipers H. Effects of androgenic-anabolic steroids in athletes. Sports Med. 2004;34(8):513-54. [PubMed ID: 15248788]. https://doi.org/10.2165/00007256-200434080-00003.
  • 5.
    Kicman AT. Pharmacology of anabolic steroids. Br J Pharmacol. 2008;154(3):502-21. [PubMed ID: 18500378]. [PubMed Central ID: PMC2439524]. https://doi.org/10.1038/bjp.2008.165.
  • 6.
    Takyar V, Stolz A. Spectrum of Drug Induced Liver Injury Caused by Anabolic Androgenic Steroids Abuse. Curr Hepat Rep. 2019;18(4):417-24. https://doi.org/10.1007/s11901-019-00490-0.
  • 7.
    Fronczak CM, Kim ED, Barqawi AB. The insults of illicit drug use on male fertility. J Androl. 2012;33(4):515-28. [PubMed ID: 21799144]. https://doi.org/10.2164/jandrol.110.011874.
  • 8.
    Martin SJ, Sherley M, McLeod M. Adverse effects of sports supplements in men. Aust Prescr. 2018;41(1):10-3. [PubMed ID: 29507454]. [PubMed Central ID: PMC5828928]. https://doi.org/10.18773/austprescr.2018.003.
  • 9.
    Mansouri A, Gattolliat CH, Asselah T. Mitochondrial Dysfunction and Signaling in Chronic Liver Diseases. Gastroenterology. 2018;155(3):629-47. [PubMed ID: 30012333]. https://doi.org/10.1053/j.gastro.2018.06.083.
  • 10.
    Waltz PK, Kautza B, Luciano J, Dyer M, Stolz DB, Loughran P, et al. Heme Oxygenase-2 Localizes to Mitochondria and Regulates Hypoxic Responses in Hepatocytes. Oxid Med Cell Longev. 2018;2018:2021645. [PubMed ID: 29849867]. [PubMed Central ID: PMC5925001]. https://doi.org/10.1155/2018/2021645.
  • 11.
    Xue R, Meng Q, Lu D, Liu X, Wang Y, Hao J. Mitofusin2 Induces Cell Autophagy of Pancreatic Cancer through Inhibiting the PI3K/Akt/mTOR Signaling Pathway. Oxid Med Cell Longev. 2018;2018:2798070. [PubMed ID: 30046371]. [PubMed Central ID: PMC6038474]. https://doi.org/10.1155/2018/2798070.
  • 12.
    Singh SP, Bellner L, Vanella L, Cao J, Falck JR, Kappas A, et al. Downregulation of PGC-1alpha Prevents the Beneficial Effect of EET-Heme Oxygenase-1 on Mitochondrial Integrity and Associated Metabolic Function in Obese Mice. J Nutr Metab. 2016;2016:9039754. [PubMed ID: 28097021]. [PubMed Central ID: PMC5206458]. https://doi.org/10.1155/2016/9039754.
  • 13.
    Sacerdoti D, Singh SP, Schragenheim J, Bellner L, Vanella L, Raffaele M, et al. Development of NASH in Obese Mice is Confounded by Adipose Tissue Increase in Inflammatory NOV and Oxidative Stress. Int J Hepatol. 2018;2018:3484107. [PubMed ID: 30057822]. [PubMed Central ID: PMC6051135]. https://doi.org/10.1155/2018/3484107.
  • 14.
    Kumar S, Pan CC, Shah N, Wheeler SE, Hoyt KR, Hempel N, et al. Activation of Mitofusin2 by Smad2-RIN1 Complex during Mitochondrial Fusion. Mol Cell. 2016;62(4):520-31. [PubMed ID: 27184078]. [PubMed Central ID: PMC4877164]. https://doi.org/10.1016/j.molcel.2016.04.010.
  • 15.
    Koshiba T, Detmer SA, Kaiser JT, Chen H, McCaffery JM, Chan DC. Structural basis of mitochondrial tethering by mitofusin complexes. Science. 2004;305(5685):858-62. [PubMed ID: 15297672]. https://doi.org/10.1126/science.1099793.
  • 16.
    Smirnova E, Griparic L, Shurland DL, van der Bliek AM. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell. 2001;12(8):2245-56. [PubMed ID: 11514614]. [PubMed Central ID: PMC58592]. https://doi.org/10.1091/mbc.12.8.2245.
  • 17.
    Ingerman E, Perkins EM, Marino M, Mears JA, McCaffery JM, Hinshaw JE, et al. Dnm1 forms spirals that are structurally tailored to fit mitochondria. J Cell Biol. 2005;170(7):1021-7. [PubMed ID: 16186251]. [PubMed Central ID: PMC2171542]. https://doi.org/10.1083/jcb.200506078.
  • 18.
    Karbowski M, Lee YJ, Gaume B, Jeong SY, Frank S, Nechushtan A, et al. Spatial and temporal association of Bax with mitochondrial fission sites, Drp1, and Mfn2 during apoptosis. J Cell Biol. 2002;159(6):931-8. [PubMed ID: 12499352]. [PubMed Central ID: PMC2173996]. https://doi.org/10.1083/jcb.200209124.
  • 19.
    Tahvilzadeh M, Hajimahmoodi M, Rahimi R. The Role of Date Palm (Phoenix dactylifera L) Pollen in Fertility: A Comprehensive Review of Current Evidence. J Evid Based Complementary Altern Med. 2016;21(4):320-4. [PubMed ID: 26438718]. https://doi.org/10.1177/2156587215609851.
  • 20.
    El Arem A, Saafi EB, Ghrairi F, Thouri A, Zekri M, Ayed A, et al. Aqueous date fruit extract protects against lipid peroxidation and improves antioxidant status in the liver of rats subchronically exposed to trichloroacetic acid. J Physiol Biochem. 2014;70(2):451-64. [PubMed ID: 24573459]. https://doi.org/10.1007/s13105-014-0323-6.
  • 21.
    Elberry AA, Mufti ST, Al-Maghrabi JA, Abdel-Sattar EA, Ashour OM, Ghareib SA, et al. Anti-inflammatory and antiproliferative activities of date palm pollen (Phoenix dactylifera) on experimentally-induced atypical prostatic hyperplasia in rats. J Inflamm (Lond). 2011;8(1):40. [PubMed ID: 22195697]. [PubMed Central ID: PMC3310814]. https://doi.org/10.1186/1476-9255-8-40.
  • 22.
    Al-Asmari AK, Al-Said MS, Abbasmanthiri R, Al-Buraidi A, Ibrahim KE, Rafatullah S. Impact of date palm pollen (Phoenix dactylifera) treatment on paracetamol-induced hepatorenal toxicity in rats. Clinical Phytoscience. 2020;6(1). https://doi.org/10.1186/s40816-020-0151-x.
  • 23.
    American College of Sports Medicine. American College of Sports Medicine position stand. Progression models in resistance training for healthy adults. Med Sci Sports Exerc. 2009;41(3):687-708. [PubMed ID: 19204579]. https://doi.org/10.1249/MSS.0b013e3181915670.
  • 24.
    Bhasin S, Woodhouse L, Casaburi R, Singh AB, Bhasin D, Berman N, et al. Testosterone dose-response relationships in healthy young men. Am J Physiol Endocrinol Metab. 2001;281(6):E1172-81. [PubMed ID: 11701431]. https://doi.org/10.1152/ajpendo.2001.281.6.E1172.
  • 25.
    Bhasin S, Woodhouse L, Casaburi R, Singh AB, Mac RP, Lee M, et al. Older men are as responsive as young men to the anabolic effects of graded doses of testosterone on the skeletal muscle. J Clin Endocrinol Metab. 2005;90(2):678-88. [PubMed ID: 15562020]. https://doi.org/10.1210/jc.2004-1184.
  • 26.
    Kraemer WJ, Ratamess NA. Hormonal responses and adaptations to resistance exercise and training. Sports Med. 2005;35(4):339-61. [PubMed ID: 15831061]. https://doi.org/10.2165/00007256-200535040-00004.
  • 27.
    Ahtiainen JP, Pakarinen A, Alen M, Kraemer WJ, Hakkinen K. Muscle hypertrophy, hormonal adaptations and strength development during strength training in strength-trained and untrained men. Eur J Appl Physiol. 2003;89(6):555-63. [PubMed ID: 12734759]. https://doi.org/10.1007/s00421-003-0833-3.
  • 28.
    Jiheel MJ, Arrak JK. Effect of different doses of ethanolic extract of date palm pollen grains on serum gonadotropin and total Glutathione in mature female rats. Kufa J Vet Med Sci. 2015;6(2):109-16. https://doi.org/10.36326/kjvs/2015/v6i23992.
  • 29.
    Chodari L, Mohammadi M, Mohaddes G, Alipour MR, Ghorbanzade V, Dariushnejad H, et al. Testosterone and Voluntary Exercise, Alone or Together Increase Cardiac Activation of AKT and ERK1/2 in Diabetic Rats. Arq Bras Cardiol. 2016;107(6):532-41. [PubMed ID: 28558078]. [PubMed Central ID: PMC5210457]. https://doi.org/10.5935/abc.20160174.
  • 30.
    Hornberger TA, Farrar RP. Physiological hypertrophy of the FHL muscle following 8 weeks of progressive resistance exercise in the rat. Can J Appl Physiol. 2004;29(1):16-31. [PubMed ID: 15001801]. https://doi.org/10.1139/h04-002.
  • 31.
    Nazarian A, Azarbayjani MA, Atashak S, Peeri M. Effects of resistance training, palm pollen grain extracts, and testosterone injection on luteinizing hormone receptors, claudin-1, cingulin, and zonula occludens in the prostate tissues of adult male rats. Andrologia. 2022;54(5). e14394. [PubMed ID: 35226967]. https://doi.org/10.1111/and.14394.
  • 32.
    Moss JL, Crosnoe LE, Kim ED. Effect of rejuvenation hormones on spermatogenesis. Fertil Steril. 2013;99(7):1814-20. [PubMed ID: 23663992]. https://doi.org/10.1016/j.fertnstert.2013.04.003.
  • 33.
    Sun L, Shen W, Liu Z, Guan S, Liu J, Ding S. Endurance exercise causes mitochondrial and oxidative stress in rat liver: effects of a combination of mitochondrial targeting nutrients. Life Sci. 2010;86(1-2):39-44. [PubMed ID: 19913560]. https://doi.org/10.1016/j.lfs.2009.11.003.
  • 34.
    Mikami T, Sumida S, Ishibashi Y, Ohta S. Endurance exercise training inhibits activity of plasma GOT and liver caspase-3 of mice [correction of rats] exposed to stress by induction of heat shock protein 70. J Appl Physiol (1985). 2004;96(5):1776-81. [PubMed ID: 15075310]. https://doi.org/10.1152/japplphysiol.00795.2002.
  • 35.
    Hara H, Araya J, Ito S, Kobayashi K, Takasaka N, Yoshii Y, et al. Mitochondrial fragmentation in cigarette smoke-induced bronchial epithelial cell senescence. Am J Physiol Lung Cell Mol Physiol. 2013;305(10):L737-46. [PubMed ID: 24056969]. https://doi.org/10.1152/ajplung.00146.2013.
  • 36.
    Smith RA, Hartley RC, Cocheme HM, Murphy MP. Mitochondrial pharmacology. Trends Pharmacol Sci. 2012;33(6):341-52. [PubMed ID: 22521106]. https://doi.org/10.1016/j.tips.2012.03.010.
  • 37.
    Li F, Zhou J, Li Y, Sun K, Chen J. Mitochondrial Damage and Drp1 Overexpression in Rifampicin- and Isoniazid-induced Liver Injury Cell Model. J Clin Transl Hepatol. 2019;7(1):40-5. [PubMed ID: 30944818]. [PubMed Central ID: PMC6441640]. https://doi.org/10.14218/JCTH.2018.00052.
  • 38.
    Zhang C, Huang J, An W. Hepatic stimulator substance resists hepatic ischemia/reperfusion injury by regulating Drp1 translocation and activation. Hepatology. 2017;66(6):1989-2001. [PubMed ID: 28646508]. https://doi.org/10.1002/hep.29326.
  • 39.
    Grohm J, Kim SW, Mamrak U, Tobaben S, Cassidy-Stone A, Nunnari J, et al. Inhibition of Drp1 provides neuroprotection in vitro and in vivo. Cell Death Differ. 2012;19(9):1446-58. [PubMed ID: 22388349]. [PubMed Central ID: PMC3422469]. https://doi.org/10.1038/cdd.2012.18.
  • 40.
    Rogers MA, Maldonado N, Hutcheson JD, Goettsch C, Goto S, Yamada I, et al. Dynamin-Related Protein 1 Inhibition Attenuates Cardiovascular Calcification in the Presence of Oxidative Stress. Circ Res. 2017;121(3):220-33. [PubMed ID: 28607103]. [PubMed Central ID: PMC5546003]. https://doi.org/10.1161/CIRCRESAHA.116.310293.
  • 41.
    Jacobi D, Liu S, Burkewitz K, Kory N, Knudsen NH, Alexander RK, et al. Hepatic Bmal1 Regulates Rhythmic Mitochondrial Dynamics and Promotes Metabolic Fitness. Cell Metab. 2015;22(4):709-20. [PubMed ID: 26365180]. [PubMed Central ID: PMC4598294]. https://doi.org/10.1016/j.cmet.2015.08.006.
  • 42.
    Hernández-Alvarez MI, Zorzano A. Alterations of Mitochondrial DNA in Liver Diseases. CRC Press; 2015. p. 349-60.
  • 43.
    Rezvani M, Espanol-Suner R, Malato Y, Dumont L, Grimm AA, Kienle E, et al. In Vivo Hepatic Reprogramming of Myofibroblasts with AAV Vectors as a Therapeutic Strategy for Liver Fibrosis. Cell Stem Cell. 2016;18(6):809-16. [PubMed ID: 27257763]. [PubMed Central ID: PMC5325707]. https://doi.org/10.1016/j.stem.2016.05.005.
  • 44.
    Shah R, Reyes-Gordillo K, Cheng Y, Varatharajalu R, Ibrahim J, Lakshman MR. Thymosin beta4 Prevents Oxidative Stress, Inflammation, and Fibrosis in Ethanol- and LPS-Induced Liver Injury in Mice. Oxid Med Cell Longev. 2018;2018:9630175. [PubMed ID: 30116499]. [PubMed Central ID: PMC6079392]. https://doi.org/10.1155/2018/9630175.
  • 45.
    Sun M, Kisseleva T. Reversibility of liver fibrosis. Clin Res Hepatol Gastroenterol. 2015;39 Suppl 1(0 1):S60-3. [PubMed ID: 26206574]. [PubMed Central ID: PMC4636085]. https://doi.org/10.1016/j.clinre.2015.06.015.
  • 46.
    Wang JN, Li L, Li LY, Yan Q, Li J, Xu T. Emerging role and therapeutic implication of Wnt signaling pathways in liver fibrosis. Gene. 2018;674:57-69. [PubMed ID: 29944952]. https://doi.org/10.1016/j.gene.2018.06.053.
  • 47.
    Ji LL. Oxidative stress during exercise: implication of antioxidant nutrients. Free Radic Biol Med. 1995;18(6):1079-86. [PubMed ID: 7628730]. https://doi.org/10.1016/0891-5849(94)00212-3.
  • 48.
    Saafi EB, Louedi M, Elfeki A, Zakhama A, Najjar MF, Hammami M, et al. Protective effect of date palm fruit extract (Phoenix dactylifera L.) on dimethoate induced-oxidative stress in rat liver. Exp Toxicol Pathol. 2011;63(5):433-41. [PubMed ID: 20359872]. https://doi.org/10.1016/j.etp.2010.03.002.

Similar Articles

28
Dec
2023
Jundishapur J Nat Pharm Prod

Phoenix dactylifera L. Pollen and Fluvoxamine Maleate Protect PC12 Cells Against H2O2-Induced Oxidative Stress by Involvement of Nrf2 and SIGMAR1 Gene Expression

Elham Lak Mazaheri,
Azadeh Niknejad,
Elaheh Amini,
Mohammad Nabiuni

Lak Mazaheri E, Niknejad A, Amini E, Nabiuni M. Phoenix dactylifera L. Pollen and Fluvoxamine Maleate Protect PC12 Cells Against H2O2-Induced Oxidative Stress by Involvement of Nrf2 and SIGMAR1 Gene Expression. Jundishapur J Nat Pharm Prod. 2024;19(1):e141738. doi: https://doi.org/10.5812/jjnpp-141738

10
Sep
2023
J Clin Res Paramed Sci

Palm Olein Oil Effect on the Heart Tissue of Male Rats

Saman Moradi,
Shayesteh Fathi,
Mohsen Zhaleh

Moradi S, Fathi S, Zhaleh M. Palm Olein Oil Effect on the Heart Tissue of Male Rats. J Clin Res Paramed Sci. 2023;12(1):e138496. doi: https://doi.org/10.5812/jcrps-138496

30
Apr
2010

Comparison of Antioxidant Activity and Total Phenol Contents of some Date Seed Varieties from Iran

Mohammad Reza Shams Ardekani,
Mahnaz Khanavi,
Mannan Hajimahmoodi,
Maryam Jahangiri,
Abbas Hadjiakhoondi

Shams Ardekani MR, Khanavi M, Hajimahmoodi M, Jahangiri M, Hadjiakhoondi A. Comparison of Antioxidant Activity and Total Phenol Contents of some Date Seed Varieties from Iran. Iran J Pharm Res. 2010;9(2):e126068. doi: https://doi.org/10.22037/ijpr.2010.849

31
Jul
2017

Effect of palmatine hydrochloride on testicular damage in streptozotocin-induced diabetic rats

Hamid Kalalianmoghaddam,
Vida Hojati,
Pirasteh Norouzi

Kalalianmoghaddam H, Hojati V, Norouzi P. Effect of palmatine hydrochloride on testicular damage in streptozotocin-induced diabetic rats. J Inflamm Dis. 2024;21(2):e156015. doi:


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles