Zahedan J Res Med Sci

Image Credit:Zahedan J Res Med Sci

Upregulated Expression of Janus Kinase Genes in T Cell-Mediated Acute Kidney Allograft Rejection

Author(s):
Mahboobeh FreidoonMahboobeh FreidoonMahboobeh Freidoon ORCID1, Fatemeh Pour-Reza-GholiFatemeh Pour-Reza-GholiFatemeh Pour-Reza-Gholi ORCID2, Sara AssadiaslSara AssadiaslSara Assadiasl ORCID3, 4,*, Azam AlamdariAzam AlamdariAzam Alamdari ORCID5, Narjes SoleimanifarNarjes SoleimanifarNarjes Soleimanifar ORCID3, Maryam SadrMaryam SadrMaryam Sadr ORCID3, Hanieh MojtahediHanieh MojtahediHanieh Mojtahedi ORCID3, Mohammad Hossein NicknamMohammad Hossein NicknamMohammad Hossein Nicknam ORCID3, 6
1Department of Nephrology, Shohada-ye-Tajrish Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Nephrology, Labbafi-Nejad Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3Molecular Immunology Research Center, Tehran University of Medical Sciences, Tehran, Iran
4Iranian Tissue Bank and Research Center, Tehran University of Medical Sciences, Tehran, Iran
5Nephrology Research Center, Imam Khomeini Hospital, Tehran University of Medical Sciences, Tehran, Iran
6Department of Immunology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Zahedan Journal of Research in Medical Sciences:Vol. 26, issue 3; e144450
Published online:Sep 03, 2024
Article type:Research Article
Received:Dec 31, 2023
Accepted:May 25, 2024
How to Cite:Freidoon M, Pour-Reza-Gholi F, Assadiasl S, Alamdari A, Soleimanifar N, et al. Upregulated Expression of Janus Kinase Genes in T Cell-Mediated Acute Kidney Allograft Rejection. Zahedan J Res Med Sci. 2024;26(3):e144450. doi: https://doi.org/10.5812/zjrms-144450

Abstract

Background:

T-cell-mediated acute kidney transplant rejection (TCMR) is a post-transplantation complication characterized by the infiltration of immune cells into the tissue and sudden dysfunction of the allograft. To develop effective diagnostic and therapeutic methods, it is crucial to understand the molecular mechanisms involved in the initiation and progression of TCMR. Janus kinase (JAK) enzymes, which are involved in proinflammatory cytokine signal transduction, may play a role in TCMR. Given the recent development of JAK inhibitors, the role of JAK molecules should be explored to determine whether they could be potential targets for the treatment of TCMR.

Objectives:

The study aimed to compare the relative expression of JAK-1, JAK-2, and JAK-3 genes between patients diagnosed with TCMR and stable recipients.

Methods:

The expression of JAK-1, JAK-2, and JAK-3 genes was evaluated in peripheral blood monocytes of 30 patients with TCMR and 30 stable patients using the RT-PCR method.

Results:

Janus kinase-1 gene expression in TCMR patients was significantly higher compared to stable patients (P-value = 0.02). However, the relative expression of JAK-2 and JAK-3 genes was comparable between the two groups. Additionally, there was a negative correlation between JAK-1 and JAK-3 gene expression and the estimated glomerular filtration rate in the studied population (P-value = 0.01 and 0.029, respectively).

Conclusions:

Janus kinase-1 gene expression increased significantly during TCMR of the kidney transplant. Therefore, specific inhibition of this molecule by JAK inhibitor drugs might be considered a therapeutic option for treating TCMR.

1. Background

In recent years, organ transplantation has become the standard treatment for patients with end-stage organ failure. The survival rates of patients and allografts have been improving due to the development of effective immunosuppressive (IS) agents; however, acute rejection of allografts remains a major obstacle to successful transplantation. Moreover, repeated episodes of acute rejection are considered a major risk factor for developing chronic rejection (1). In addition, the side effects of conventional immunosuppressive drugs, which must be administered for life, necessitate the introduction of alternatives with fewer adverse effects. Current immunosuppressive drugs can disrupt glucose and lipid metabolism, affect bone density, exert neurologic effects, and increase the rates of infection and malignancy in transplant recipients (2). Thus, there is a need to develop more specific drugs for the efficient suppression of alloimmune responses.
A novel category of IS agents that has recently been used to treat refractory forms of autoimmune and allergic disorders is JAK inhibitors (JAKinibs). Janus kinases (JAKs) are enzymes involved in the JAK/signal transducer and activator of transcription (STAT) signaling pathway, which conveys cytokine signals to the nucleus through phosphorylated STAT dimers (3). Therefore, it is presumed that JAK inhibition might modulate immune responses and increase tolerance to the allograft (4). Accordingly, there have been some reports on the efficacy of the JAK-3 inhibitor tofacitinib in preventing renal transplant rejection and improving allograft survival, comparable to cyclosporine, while lower interstitial fibrosis/tubular atrophy (IF/TA) and higher estimated glomerular filtration rates were observed in patients treated with tofacitinib (5, 6).
Despite these findings, there are few studies on the gene expression of JAK enzymes in kidney diseases. For instance, one study has shown elevated tubulointerstitial expression of JAK genes in progressive diabetic nephropathy compared to healthy individuals (7). Further, enhanced JAK/STAT activation, demonstrated by increased levels of transcriptomes, has been reported in the peripheral blood monocytes and biopsy samples of patients with focal segmental glomerular sclerosis (FSGS) (8). However, there is no evidence of JAK expression alterations in kidney allografts.

2. Objectives

Therefore, our aim was to evaluate the gene expression of JAK-1, -2, and -3 in transplanted patients with TCMR compared to stable transplant recipients. In addition to the diagnostic and prognostic value of altered JAK expression, significant upregulation of these genes might suggest them as potential targets for treating TCMR with JAKinibs.

3. Methods

3.1. Patients

Thirty kidney transplant recipients with TCMR, along with 30 age- and sex-matched stable transplant recipients from three medical centers in Tehran, were enrolled in the study between June 2021 and March 2023. Peripheral blood sampling was performed after the diagnosis of TCMR and before the initiation of treatment. The diagnosis of TCMR was made based on either pathological (n = 11) or clinical findings (n = 19) (9). Patients with autoimmunity, allergies, malignancies, or active infections were excluded from the study. All participants provided informed consent. The Ethics Committee of Tehran University of Medical Sciences approved the study (approval code: IR.TUMS.CHMC.REC.1400.005).

3.2. RNA Extraction and CDNA Synthesis

Isolation of ribonucleic acid (RNA) was performed using the High Pure RNA Isolation Kit (ROJE Technologies, Tehran, Iran) according to the manufacturer’s instructions. The quality of the RNA was evaluated with a spectrophotometer (NanoDrop ND1000; Thermo Scientific, USA). RNA samples with an A260/A280 absorbance ratio of 1.8 - 2.2 and an A260/A230 ratio of 2 - 2.2 were considered acceptable. Reverse transcription to complementary deoxyribonucleic acid (cDNA) was performed using the transcriptor first strand cDNA Synthesis Kit (ROJE Technologies, Tehran, Iran). cDNA samples with A260/A280 ratios of 1.8 - 2 were stored in a -70°C freezer for the RT-PCR test.

3.3. Real-time Polymerase Chain Reaction

Relative gene expression was analyzed using SYBR-Green real-time polymerase chain reaction (RT-PCR). Glyceraldehyde 3-phosphate dehydrogenase (GPDH) was used as the internal control, with reverse and forward primer sequences shown in Table 1.
Table 1.The Sequences of Primers Used in RT-PCR Test
GeneSequence (5’ – 3’)Company
JAK1
ForwardGAGACAGGTCTCCCACAAACACOriGene Technologies
ReverseGTGGTAAGGACATCGCTTTTCCOriGene Technologies
JAK2
ForwardCCAGATGGAAACTGTTCGCTCAGOriGene Technologies
ReverseGAGGTTGGTACATCAGAAACACCOriGene Technologies
JAK3
ForwardAGTGACCCTCACTTCCTGCTGTOriGene Technologies
ReverseGGCTGAACCAAGGATGATGTGGOriGene Technologies
GAPDH
ForwardGTCTCCTCTGACTTCAACAGCGOriGene Technologies
ReverseACCACCCTGTTGCTGTAGCCAAOriGene Technologies
To perform the test, 10 μL of master mix (RealQ Plus Green, Ampliqon, Denmark), 7 μL of distilled water, 1 μL of assay mix (forward and reverse primers), and 2 μL of diluted sample cDNA (5 ng/μL) were combined in the wells. The reaction cycles were as follows: 50°C for 2 minutes, 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 minute, provided by the StepOnePlus real-time PCR System (Applied Biosystems, USA). Nontemplate controls were included in each run. All tests were performed in duplicate and quantified relative to the expression of the internal control. The threshold cycle number was used to calculate the relative expression of the samples, which was determined using the Livak formula: Relative mRNA expression = (2–∆Ct) (10).

3.4. Statistical Analysis

Data analysis was performed using IBM SPSS 26.0 (IBM Corp., Armonk, NY, USA). The data were presented as mean ± standard deviation (SD). The normality of the distribution was evaluated with the Kolmogorov-Smirnov test. An independent samples t-test was used to compare variables with a normal distribution, while the Mann-Whitney U test was applied for non-normal distributions. The correlation between variables was assessed using Pearson's correlation for normal distributions and Spearman's correlation for non-normal distributions. P-values lower than 0.05 were considered significant.

4. Results

4.1. Demographic Findings of the Renal Transplant Recipients

The patients were middle-aged, with an average age of 45 ± 10 years (mean ± SD). There were significant differences in creatinine (P < 0.0001), urea (P = 0.001), and e[glomerular filtration rate (GFR)] (P < 0.0001) between the stable recipients and the patients diagnosed with TCMR. The clinical information of the study population is presented in Table 2.
Table 2.Clinical and Laboratory Data of Patients with TCMR and Stable Recipients a
VariablesStable RecipientsTCMRP-Value
No.3030
Age (y)45.9 ± 10.544.9 ± 11.80.6
Gender ratio (M/F)18/1218/121
Creatinine1.26 ± 0.42.67 ± 1.2< 0.0001
Urea32.28 ± 7.947 ± 14.50.001
eGFR65.04 ± 13.828.9 ± 10.6< 0.0001
TX duration (y)4.43 ± 1.93.45 ± 20.5
IS protocol
CsA/MMF/PRED76
Tac/MMF/PRED1816
AZA/CsA/PRED34
Tac/Rap/PRED24

Abberivitions: IS, immunosuppressive; WBC, white blood cells; CsA, Cyclosporine; TCMR, T cell-mediated rejection; GFR, glomerular filtration rate; TX, transplantation; AZA, azathioprine; Tac, tacrolimus; MMF, mycophenolate; PRED, prednisone; Rap, rapamycin.

a Values are expressed as mean ± SD or No. (%).

4.2. Increased JAK-1 Expression in TCMR Compared to the Stable Recipients

Janus kinase-1 gene expression analysis showed a significant difference between patients with cellular rejection and stable patients (P-value = 0.02). The expression of this gene was significantly higher in patients with TCMR compared to stable recipients (1.64 ± 1.02 vs. 1.07 ± 0.75 [mean ± SD]) (Figure 1).
Relative expression of Janus kinase-1 (JAK-1) gene in PBMCs from T-cell-mediated acute kidney transplant rejection (TCMR) cases and stable recipients (P-value = 0.02)
Figure 1.

Relative expression of Janus kinase-1 (JAK-1) gene in PBMCs from T-cell-mediated acute kidney transplant rejection (TCMR) cases and stable recipients (P-value = 0.02)

4.3. Comparable mRNA Level of JAK-2 and a Slight Increase in JAK-3 Expression in the TCMR Group

Janus kinase-2 gene expression in PBMCs did not show any significant difference between the two groups (0.63 ± 0.46 vs. 0.51 ± 0.36 [mean ± SD]). Moreover, despite the upregulation of the JAK-3 gene in the TCMR group, the difference did not reach a significant level (0.99 ± 0.57 vs. 0.72 ± 0.47 [mean ± SD]) (Figure 2).
A, relative expression of Janus kinase-2 (JAK-2); and B, Janus kinase-3 (JAK-3) genes in PBMCs from patients with T-cell-mediated acute kidney transplant rejection (TCMR) and stable recipients
Figure 2.

A, relative expression of Janus kinase-2 (JAK-2); and B, Janus kinase-3 (JAK-3) genes in PBMCs from patients with T-cell-mediated acute kidney transplant rejection (TCMR) and stable recipients

4.4. Negative Correlation Between JAK-1/JAK-3 Expression and eGFR in Kidney Transplant Recipients

Correlation analysis between JAK expression and renal allograft function, as measured by eGFR, demonstrated a significant correlation between JAK-1 and eGFR (correlation coefficient: -0.33, P-value = 0.01) as well as between JAK-3 and eGFR (correlation coefficient: -0.28, P-value = 0.029) in the studied population, including both TCMR and stable patients (Figure 3). However, there was no significant correlation between JAK-2 and glomerular filtration rate.
A, negative correlation between gene expression of Janus kinase (JAK)-1 and glomerular filtration rate (GFR) (P-value = 0.01); B, no significant correlation between JAK-2 gene expression and GFR; C, negative correlation between JAK-3 gene expression and GFR in renal transplant recipients (P-value = 0.029).
Figure 3.

A, negative correlation between gene expression of Janus kinase (JAK)-1 and glomerular filtration rate (GFR) (P-value = 0.01); B, no significant correlation between JAK-2 gene expression and GFR; C, negative correlation between JAK-3 gene expression and GFR in renal transplant recipients (P-value = 0.029).

5. Discussion

In recent decades, renal transplantation has become a routine therapeutic option for treating patients with end-stage renal disease. The development of advanced surgical methods and novel immunosuppressive drugs has significantly improved organ and patient survival. However, immunologic barriers, including acute, chronic, and antibody-mediated rejection, still affect transplantation outcomes (11). Therefore, several immune components are being studied to identify the most effective targets with the fewest side effects, such as immunodeficiency and metabolic disturbances. To date, the roles of many cytokines and co-stimulatory molecules in allograft rejection, particularly in TCMR, have been studied (12). Our lab has already identified correlations between the gene expression and polymorphism of Toll-like receptor (TLR)-4, TLR-2, Myeloid differentiation primary response 88 (MyD88), Programmed death-ligand 1 (PD-1), Interferon regulatory factor 4 (IRF-4), Helios, Transforming growth factor beta (TGF-β), and interleukins IL-12, IL-15, and IL-18, and T-cell-mediated acute or chronic rejection (13-16).
However, none of these molecules has been considered a promising therapeutic target for treating TCMR, as there are no approved drugs to inhibit these molecules. JAK enzymes, given the growing number of approved JAK inhibitor agents (JAKinibs), appear to be more convenient to suppress compared to other molecules involved in alloimmune responses (17, 18). The benefits of JAKinibs have been demonstrated in a wide range of immune-mediated disorders, such as allergic, rheumatologic, and infectious diseases (19). Since JAK enzymes play a critical role in the signal transduction of cytokines, their inhibition might reduce inflammation in the allograft due to ischemia-reperfusion injury, rejection episodes, and infections such as cytomegalovirus (CMV) (20).
According to this hypothesis, there is a need to evaluate the expression levels of JAK molecules in kidney tissue and peripheral blood in kidney transplant recipients in different states of allograft. Therefore, we aimed to compare the gene expression of JAKs between patients with TCMR and stable renal transplant recipients, which revealed a significant upregulation of JAK-1 and a non-significant elevation of JAK-3 expression in the TCMR group compared to the control patients. Moreover, there was a significant correlation between the expression levels of JAK-1/3 and allograft function as determined by estimated glomerular filtration rates. However, neither the expression assay nor correlation analysis showed a significant difference in JAK-2 expression, but this result might not be conclusive due to the small study population.
These findings suggest that JAK-1 and JAK-3 molecules could be potential targets for managing alloimmune responses in TCMR. Previous findings on the efficacy of tofacitinib, a JAK-3 inhibitor, in preventing acute rejection support these results (5, 6, 21, 22). However, further studies are required to provide compelling data on the efficacy and safety of JAKinibs in the prevention and treatment of TCMR in kidney transplantation. It is also recommended to evaluate the mRNA expression and protein levels of JAKs in renal tissue under different clinical conditions, including rejection, stability, and healthy controls.

5.1. Conclusion

To summarize, the upregulated expression of JAK-1 and JAK-3 genes in the peripheral blood of renal transplant recipients diagnosed with TCMR and the significant correlation between JAK1/3 gene expression and eGFR suggest a probable involvement of the JAK/STAT signaling pathway in rejection. Therefore, JAK inhibitors might be useful in the prevention and treatment of recurrent or refractory forms of TCMR.

Footnotes

References

  • 1.
    Halloran PF. T cell-mediated rejection of kidney transplants: A personal viewpoint. Am J Transplant. 2010;10(5):1126-34. [PubMed ID: 20346061]. https://doi.org/10.1111/j.1600-6143.2010.03053.x.
  • 2.
    Hsu DC, Katelaris CH. Long-term management of patients taking immunosuppressive drugs. Australian Prescriber. 2009;32(3). https://doi.org/10.18773/austprescr.2009.035.
  • 3.
    Villarino AV, Kanno Y, O'Shea JJ. Mechanisms and consequences of Jak-STAT signaling in the immune system. Nat Immunol. 2017;18(4):374-84. [PubMed ID: 28323260]. https://doi.org/10.1038/ni.3691.
  • 4.
    Borie DC, O'Shea JJ, Changelian PS. JAK3 inhibition, a viable new modality of immunosuppression for solid organ transplants. Trends Mol Med. 2004;10(11):532-41. [PubMed ID: 15519279]. https://doi.org/10.1016/j.molmed.2004.09.007.
  • 5.
    Vincenti F, Silva HT, Busque S, O'Connell PJ, Russ G, Budde K, et al. Evaluation of the effect of tofacitinib exposure on outcomes in kidney transplant patients. Am J Transplant. 2015;15(6):1644-53. [PubMed ID: 25649117]. https://doi.org/10.1111/ajt.13181.
  • 6.
    Busque S, Vincenti FG, Tedesco Silva H, O'Connell PJ, Yoshida A, Friedewald JJ, et al. Efficacy and safety of a tofacitinib-based immunosuppressive regimen after kidney transplantation: Results from a long-term extension trial. Transplant Direct. 2018;4(9). e380. [PubMed ID: 30234149]. [PubMed Central ID: PMC6133407]. https://doi.org/10.1097/TXD.0000000000000819.
  • 7.
    Berthier CC, Zhang H, Schin M, Henger A, Nelson RG, Yee B, et al. Enhanced expression of Janus kinase-signal transducer and activator of transcription pathway members in human diabetic nephropathy. Diabetes. 2009;58(2):469-77. [PubMed ID: 19017763]. [PubMed Central ID: PMC2628622]. https://doi.org/10.2337/db08-1328.
  • 8.
    Tao J, Mariani L, Eddy S, Maecker H, Kambham N, Mehta K, et al. JAK-STAT signaling is activated in the kidney and peripheral blood cells of patients with focal segmental glomerulosclerosis. Kidney Int. 2018;94(4):795-808. [PubMed ID: 30093081]. [PubMed Central ID: PMC6744284]. https://doi.org/10.1016/j.kint.2018.05.022.
  • 9.
    Jeong HJ. Diagnosis of renal transplant rejection: Banff classification and beyond. Kidney Res Clin Pract. 2020;39(1):17-31. [PubMed ID: 32164120]. [PubMed Central ID: PMC7105630]. https://doi.org/10.23876/j.krcp.20.003.
  • 10.
    Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101-8. [PubMed ID: 18546601]. https://doi.org/10.1038/nprot.2008.73.
  • 11.
    Townamchai N, Avihingsanon Y. Updated management for antibody-mediated rejection: Opportunity to prolong kidney allograft survival. Curr Opin Nephrol Hypertens. 2023;32(1):13-9. [PubMed ID: 36250450]. https://doi.org/10.1097/MNH.0000000000000843.
  • 12.
    Rampersad C, Balshaw R, Gibson IW, Ho J, Shaw J, Karpinski M, et al. The negative impact of T cell-mediated rejection on renal allograft survival in the modern era. Am J Transplant. 2022;22(3):761-71. [PubMed ID: 34717048]. [PubMed Central ID: PMC9299170]. https://doi.org/10.1111/ajt.16883.
  • 13.
    Freidoon M, Pour-Reza-Gholi F, Alamdari A, Minoo FS, Soleimanifar N, Ansaripour B, et al. Comparing IRF-4 Gene Expression Between Acute T cell- Mediated Rejection and Stable Renal Transplant Recipients. Iran J Kidney Dis. 2021;15(3):222-8. [PubMed ID: 33994382].
  • 14.
    Alamdari A, Minoo FS, Assadiasl S, Freidoon M, Pour-Reza-Gholi F, Soleimanifar N, et al. Expression of programmed cell death 1 and helios genes correlates with rs872071A>G and rs12203592C>T single-nucleotide polymorphisms of interferonregulatory factor 4 in patients with T-Cell-mediated rejection of renal allograft. Exp Clin Transplant. 2022;20(2):190-8. [PubMed ID: 34981715]. https://doi.org/10.6002/ect.2021.0326.
  • 15.
    Assadiasl S, Sepanjnia A, Aghili B, Nafar M, Ahmadpoor P, Pourrezagholi F, et al. Natural killer cell subsets and IL-2, IL-15, and IL-18 genes expressions in chronic kidney allograft dysfunction and graft function in kidney allograft recipients. Int J Organ Transplant Med. 2016;7(4):212-7. [PubMed ID: 28078060]. [PubMed Central ID: PMC5219582].
  • 16.
    Sharbafi MH, Assadiasl S, Pour-Reza-Gholi F, Barzegari S, Mohammadi Torbati P, Samavat S, et al. TLR-2, TLR-4 and MyD88 genes expression in renal transplant acute and chronic rejections. Int J Immunogenet. 2019;46(6):427-36. [PubMed ID: 31286693]. https://doi.org/10.1111/iji.12446.
  • 17.
    Morris R, Kershaw NJ, Babon JJ. The molecular details of cytokine signaling via the JAK/STAT pathway. Protein Sci. 2018;27(12):1984-2009. [PubMed ID: 30267440]. [PubMed Central ID: PMC6237706]. https://doi.org/10.1002/pro.3519.
  • 18.
    Assadiasl S, Mojtahedi H, Nicknam MH. JAK inhibitors in solid organ transplantation. J Clin Pharmacol. 2023;63(12):1330-43. [PubMed ID: 37500063]. https://doi.org/10.1002/jcph.2325.
  • 19.
    Assadiasl S, Fatahi Y, Mosharmovahed B, Mohebbi B, Nicknam MH. Baricitinib: From rheumatoid arthritis to COVID-19. J Clin Pharmacol. 2021;61(10):1274-85. [PubMed ID: 33870531]. [PubMed Central ID: PMC8250677]. https://doi.org/10.1002/jcph.1874.
  • 20.
    Kubo S, Nakayamada S, Sakata K, Kitanaga Y, Ma X, Lee S, et al. Janus kinase inhibitor baricitinib modulates human innate and adaptive immune system. Front Immunol. 2018;9:1510. [PubMed ID: 30002661]. [PubMed Central ID: PMC6031708]. https://doi.org/10.3389/fimmu.2018.01510.
  • 21.
    Myrvang H. Transplantation: Tofacitinib safe and effective in renal transplant recipients. Nat Rev Nephrol. 2012;8(8):432. [PubMed ID: 22735765]. https://doi.org/10.1038/nrneph.2012.120.
  • 22.
    Zand MS. Tofacitinab in renal transplantation. Transplant Rev (Orlando). 2013;27(3):85-9. [PubMed ID: 23849222]. [PubMed Central ID: PMC3713609]. https://doi.org/10.1016/j.trre.2013.04.001.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles