Curcumin Effect on the Expressional Profile of OCT4, Nanog and Nucleostemin Genes in AGS (Adenocarcinoma) Cancer Cell Line

Author(s):
Fahmideh BagrezaeiFahmideh Bagrezaei1, Mehdi MahmoodiMehdi Mahmoodi2, Mohammad Reza HajizadehMohammad Reza Hajizadeh2, Vajihe AkbarpoorVajihe Akbarpoor1, Reza BahramabadiReza Bahramabadi3, Mohammad Reza MirzaeiMohammad Reza Mirzaei2,*
1Faculty of Medicine, Department of Biochemistry, Rafsanjan University of Medical Sciences, Rafsanjan, IR Iran
2Faculty of Medicine, Department of Medical Biochemistry, Molecular Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, IR Iran
3Department of Microbiology, Rafsanjan University of Medical Sciences, Rafsanjan, IR Iran

Zahedan Journal of Research in Medical Sciences:Vol. 18, issue 7; e7555
Published online:Jul 02, 2016
Article type:Research Article
Received:May 14, 2015
Accepted:Oct 29, 2015
How to Cite:Bagrezaei F, Mahmoodi M, Hajizadeh MR, Akbarpoor V, Bahramabadi R, et al. Curcumin Effect on the Expressional Profile of OCT4, Nanog and Nucleostemin Genes in AGS (Adenocarcinoma) Cancer Cell Line. Zahedan J Res Med Sci. 2016;18(7):e7555. doi: https://doi.org/10.17795/zjrms-7555

Abstract

Background:

Curcumin is the natural yellow pigment in turmeric isolated from the rhizome of the plant Curcuma longa. Curcumin inhibits formation and invasive cancer cells and destroys cancer cells resistant to chemotherapeutic drugs.

Objectives:

The purpose of this study was the survey of effects of different concentrations of alcoholic curcumin on the octamer-binding transcription factor 4 (OCT4) Nanog and Nucleostemin genes in the AGS (human gastric adenocarcinoma) cell line.

Materials and Methods:

In this experimental study the AGS cell line was cultured in RPMI-1640, supplemented with penicillin/streptomycin (100 U/mL and 100 mg/mL, respectively) and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. In 60 - 70% cell confluence, the cells were treated with curcumin concentration (20, 40, 100) μL and incubated for 24, 48 and 72 hours. Finally, total RNA were extracted and cDNA were synthesized and the expression of mentioned genes was detected. The data were analyzed by excel software.

Results:

Expression rate of OCT4A, OCT4B, Nanog and Nucleostemin (GLN3) at concentrations less than 20 μg/mL were reduced but OCT4B1 expression showed increased by hours respectively.

Conclusions:

The results showed that curcumin inhibited cell division; also, this study could be the basis for more extensive studies on the anti-cancer effect of the combined plants.

1. Background

Curcuma longa is a herbaceous plant that the rhizome is widely used to flavor and color in foods [1]. It is a dietary source of curcuminoid compounds included curcumin (75 - 95%), dimethoxycurcumin and bisdimethoxy-curcumin. Several chemical compounds, as volatile oil, zynjybrn alpha and beta, turmeric and as well as glucose, arabinose, fructose, glucose and starch in the rhizome of turmeric [2]. Previouslyconciderable studies have been designed to evaluate therapeutic significance of the crude extracts in cancer cell lines of breast, ovarian, colon, liver, leukemia, pancreatic and prostate [3]. Moreover several studies have shown that curcumin prevents from the formation of tumor cells and reduces the speed of many cancers development. In addition several research have shown that the use of turmeric as a spice prevent the growth of cancers of the stomach and colon [4].
Cancer stem cells capable of self-renewal as cancer cells, matched and non-matched cell divisions, resulting in the creation of tumor is known [5]. Recent cells cancer stem cells (CSCs) isolated from the tumor of the breast [6], brain [7], melanoma [8], prostate [9], Osteosarcoma [4] and many other tumors. This observation led to the theory of cancer stem cells. According to this theory within a tumor, a small number of these cells have unlimited proliferative capacity, cause tumor growth. In theory, by the finding that most tumors consist of a heterogeneous population of cells with varying degrees of differentiation match. Perhaps also because the current treatment that target dividing cells in the tumor mass and reduces but not prevents tumor regrowth is that this treatment does not destroy cancer stem cells [10]. The genes that control stem cell self-renewal are a new class of cancer molecular markers that uncontrolled expression of cancer is very important in the process [11]. The genes included OCT4, Nanog, SOX2, KLF4 and Nucleostemin [12, 13]. OCT4 a pronounced pow (POU) domain transcription factor has been that all pluripotent cells during mouse embryogenesis and widely expressed by undifferentiated mouse embryonic stem cells and embryonic cancer cell lines also expressed. However, to date, tests have shown that OCT4 expression in stem cells generally weaker sex as well as OCT4 marker used for human Gennady tumors is poor [14]. These gene produce differential three variants (OCT4A, OCT4B, OCT4B1) with alternative splicing that the protein structure and function are different [15].
Nanog a transcription factor that has homeodomain those stem cells are capable of self-renewal. This gene is one of several factors that can be expressed in pluripotent cells and reduced expression of will in the beginning of differentiation [16]. Nucleostemin gene belongs to the family of binding proteins and protein Guanosine triphosphate (Gtp) single subunit synthesis of this gene, there are mainly low in the nucleolus and nuclear sap. This gene plays an important role in the regulation of P53 protein and the regulation of the cell cycle [17].

2. Objectives

According to the available evidence on the role of curcumin in the treatment and prevention of cancer, this study investigated the effects of curcumin on genes as genes that control the way in gastric cancer cell immortality as representative cell lines.

3. Materials and Methods

3.1. AGS Cancer Cell Line

In this experimental study, gastric cancer cell line (AGS) was purchased from Pasteur institute of Iran. The cells were cultured in RPMI-1640 containing 10% fetal calf serum, penicillin and streptomycin antibiotics and incubated at 37°C with 5% Co2 and 90% humidity.

3.2. Preparation of Curcumin Concentrations

Root of curcumin were obtained from the herbarium of medicinal plants and was extracted with Soxhlet apparatus, similar to previous studies [18], concentrations of 20, 40 and 100 µg/mL of extract (curcumin) was prepared.

3.3. Cell Culture

To investigate the effect of curcumin on studied cell lines, the cells were cultured and passaged several times to ensure the accuracy of the cells and the proliferation finally 2 × 105 cells/mL as adequate levels of cells in primary culture was selected. Cells in the test and control groups with three repetitions for each concentration were cultured. To each well of the six plates for 200 µL cells (40,000 cells), culture medium containing cells was added. Plates incubated and after 24 hours the concentration of the desired three blank cells in plates dedicated to groups the test were added. The control group received sterile distilled water (as a buffer).
RNA extraction and cDNA synthesis: After three times of 24, 48 and 72 hours, cells in test groups (three different levels) and control, harvesting and washing with phosphate-buffered saline (PBS) buffer, total cell RNA (RNA purification kit) was isolated. For cDNA synthesis, RNA obtained from the previous step, were used (conversion kit cDNA synthesis), synthesized cDNAs incubated in -20°C condition.

3.4. Primer Design

Forward and reverse primers of studied genes, OCT4 (variants A, B, B1), Nanog, Nucleostemin and β-actin (as internal housekeeping control gene) were designed with software version 3 design primer and then control at NCBI BLAST software (Table 1).
Table 1.Sequence of OCT4 Variants, Nanog, Nucleostemin and β-Actin Gens Primers
Target genesDesigned OligoRelative SequenceFragment Length
OCT4A111
FCGCAAGCCCTCATTTCAC
RCATCACCTCCACCACCTG
OCT4B177
FAGAACCGAGTGAGAGGCAAC
RTGAGAAAGGAGACCCAGCA
OCT4B1128
FGCACTTCTACAGACTATTCCTTGG
RTGATCCTCTTCTGCTTCAGG
NANOG165
FCCTATGCCTGTGATTTGTGG
RAGTGGGTTGTTTGCCTTTG
Nucleostemin174
FCAGAGATCCTCTTGGTTGCAG
RAATGAGGCACCTGTCCACTC
β-actin160
FCACACCTTCTACAATGAGC
RATAGCACAGCCTGGATAG

3.5. Amplification of the Desired Genes

Followed, the cDNA synthesized and preparation of primers of target genes, the real-time PCR was used for detection of interested genes expression. Briefly, 4 µL of specific primers (forward and reverse), 3 µL of DNA, 10 µL mastermix (SYBR Green, Iran) and 3 µL DNase free water (final volume of 20 µL) was added to each well of the PCR plate and covered with special tape to prevent evaporation. The real-time reaction was reproduced with the company’s proposed synthesis of primers (one cycle of 95°C for 30 seconds and 45 cycles with the conditions of 95°C for 10 seconds, 58 - 62°C for 15 seconds, 72°C for 20 seconds). Charts and data devices (numbers ct) were analyzed and evaluated and β-actin gene was used as an internal control.

4. Results

4.1. Expression Pattern of OCT4 Variations

OCT4 expression patterns showed variations in the concentrations studied turmeric extract and after periods of 24, 48 and 72 hours, the expression of both variants OCT4A and OCT4B reduced, while OCT4B1 variants show increased expression (Figure 1).
Expressional Profile of OCT4 Variants (A, B and B1), After Curcumin Concentrations (20, 40 and 100 µg/mL) Effects for 24, 48 and 72 hours in AGS cancer cell line
Figure 1.

Expressional Profile of OCT4 Variants (A, B and B1), After Curcumin Concentrations (20, 40 and 100 µg/mL) Effects for 24, 48 and 72 hours in AGS cancer cell line

The results showed the highest rate of decrease in OCT4A and OCT4B variants expression in concentration of 20 µg/mL after 24 hours. Unlike the two other variants (A and B), OCTB1 variants showed increased expression, the highest concentration of 100 µg and 48 hours.

4.2. Expression Pattern of Nanog

As shown in Figure 2 Nanog gene expression were decreased by the concentration of turmeric extract, the maximum reduction occurs in the concentration of 100 µg/mL for 48 hours.
Expressional Profile of Nanog Gene, After Curcumin Concentrations (20, 40 and 100 µg/mL) Effects for 24, 48 and 72 Hours in AGS Cancer Cell Line
Figure 2.

Expressional Profile of Nanog Gene, After Curcumin Concentrations (20, 40 and 100 µg/mL) Effects for 24, 48 and 72 Hours in AGS Cancer Cell Line

4.3. Expression Pattern of Nucleostemin

Nucleostemin gene expression pattern in studied cell line suggested, turmeric extract concentration were decreased this gene expression after impact with the increase and decrease over time also increased gene expression (Figure 3). The highest reduced expression of this gene was observed in concentration of 100 µg/mL and 72 hours.
Expressional Profile of Nucleostemin Gene, After Curcumin Concentrations (20, 40 and 100 µg/mL) Effects For 24, 48 and 72 Hours in AGS Cancer Cell Line
Figure 3.

Expressional Profile of Nucleostemin Gene, After Curcumin Concentrations (20, 40 and 100 µg/mL) Effects For 24, 48 and 72 Hours in AGS Cancer Cell Line

5. Discussion

In this study, the effects of turmeric extract (curcumin) on the expressional profile of genes that control immortality pathway in AGS cancer cell lines were studied. The results showed that turmeric extract have decreased expression variant, OCT4 variants except OCT4B1, Nanog and Nucleostemin genes, a dose-dependent decrease, also change of genes expression was time dependent and may be a mechanism of cell death in response to extract. About all of diseases, including cancers, resulting in dysfunction and changes in the expression of various genes [19].
There are two main hypotheses about cancer, based first, all of tissue cells can converted to cancer cell and established a cancer colon on tissues. According to the second theory, the cells called adult stem cells (ASCs), presented in nearly all tissues, and are origin of cancer. According to “cancer stem cell” hypothesis, many tumors originate from differentiated tissues stem cells [20]. This theory is based on the factors that control the differentiation of stem cells or uncontrolled proliferation of tissue may be the most important factors involved in the approval process are considered carcinogenic [21]. Other evidence supporting this theory resembles a small population of cancer stem cells are tissue cells, the small population of cells capable of escaping of apoptosis and resistance to chemotherapy, so, cancer coming back after the destruction of tumors [13].
OCT4, Nanog, Nucleostemin gene expression capable to create self-renewal state in cells [22]. OCT4 gene includes three variants (A, B, B1), the OCT4B1 variant recently been detected and up-regulated in cancer cells [20]. The increase will vary according to grade that can be useful in cancer diagnosis and determine the degree of malignancy [12, 23]. OCT4 gene includes three variants (A, B, B1), the variant OCT4B1 recently been detected in cancer cells express high. The increase will vary according to grade that can detect cancer and determine its grade. Variant OCT4B1 addition to the cell lines and cancer stem cells expressed similar behavior OCT4A. The zygote to blastocyst stage continues to express the start and after differentiation, cancer stem cells express both reduced but only expressed OCT4B1 seen again. In a previous study related to cancer and cancer genes on tissues belonging to different cancers or cancer cell lines, interesting results have been obtained [15, 24]. In this study, Atlasi et al. showed cytoplasmic expression OCT4B1 directly related to nuclear expression in stem cells is OCT4A. But in cancer cells, while expression of speech stops OCT4A but OCT4B1 will continue. In other words, aberrant expression of epithelial activates genes OCT4 reproductive cells to reproduce and turn these cells into cancer cells, the variant is expressed in these cells OCT4B1 [15].
Conventional cancer treatments have serious side effects and, at best, only a few years, the life expectancy of the patient increases. Complementary medicine therapies can be beneficial in cancer control and anti-tumor compounds suitable for further studies in various countries have done.
Several studies have shown that consumption of certain foods and herbs can inhibit the growth of cancer cells. Dixon et al. effects of curcumin in anti-metastatic breast cancer were investigated. [25]. Wong et al. demonstrated that curcumin may induce apoptosis in specific doses in many cancer cells. Curcumin is the release of cytochrome c and stability of P53 [23]. Curcumin inhibits the transcriptional network in stages and thus prevents the cell proliferation [26]. In another study of cell cycle arrest and growth of curcumin on gastric cancer cells was observed [27]. In this study, the time of differentiated cells gradually stopped path are programmed cell death after treatment with curcumin formulation dendrosome, Bax gene expression levels increased by 50% indicated that the mitochondrial death pathway gradual activation of the indicator programmed cell. To increase the stability and solubility of curcumin, Konecks et al., after examining the antitumor activity of liposomal curcumin on pancreatic cancer cells found that curcumin inhibits the growth of cells in the pancreas [28].
According to emphasize the use of herbal medicines in the treatment of cancer, in this study the effect of different concentrations of curcumin on the expression of genes OCT4 (OCT4A, OCT4B, OCT4B1), Nanog and Nucleostemin in gastric cancer cell was tested and the summery our datas showed that turmeric extract (curcumin) the effect of genes that control immortality pathway and decreased expression help them to reduce the rate of cell division, and this loss leads to the development of cancerous tissue. The results can be used as an example of the use of herbal medicines in the study of the molecular mechanisms of cancer pathways, is used.

Acknowledgments

Footnotes

References

  • 1.
    Feitelson MA, Arzumanyan A, Kulathinal RJ, Blain SW, Holcombe RF, Mahajna J, et al. Sustained proliferation in cancer: Mechanisms and novel therapeutic targets. Semin Cancer Biol. 2015;35 Suppl:S25-54. [PubMed ID: 25892662]. https://doi.org/10.1016/j.semcancer.2015.02.006.
  • 2.
    Teiten MH, Dicato M, Diederich M. Curcumin as a regulator of epigenetic events. Mol Nutr Food Res. 2013;57(9):1619-29. [PubMed ID: 23754571]. https://doi.org/10.1002/mnfr.201300201.
  • 3.
    Yallapu MM, Jaggi M, Chauhan SC. Curcumin nanoformulations: a future nanomedicine for cancer. Drug Discov Today. 2012;17(1-2):71-80. [PubMed ID: 21959306]. https://doi.org/10.1016/j.drudis.2011.09.009.
  • 4.
    Singh S, Khar A. Biological effects of curcumin and its role in cancer chemoprevention and therapy. Anticancer Agents Med Chem. 2006;6(3):259-70. [PubMed ID: 16712454].
  • 5.
    Cihova M, Altanerova V, Altaner C. Stem cell based cancer gene therapy. Mol Pharm. 2011;8(5):1480-7. [PubMed ID: 21755953]. https://doi.org/10.1021/mp200151a.
  • 6.
    Charafe-Jauffret E, Ginestier C, Birnbaum D. Breast cancer stem cells: tools and models to rely on. BMC Cancer. 2009;9:202. [PubMed ID: 19555472]. https://doi.org/10.1186/1471-2407-9-202.
  • 7.
    Palm T, Schwamborn JC. Brain tumor stem cells. Biol Chem. 2010;391(6):607-17. [PubMed ID: 20370314]. https://doi.org/10.1515/BC.2010.059.
  • 8.
    Shakhova O. Neural crest stem cells in melanoma development. Curr Opin Oncol. 2014;26(2):215-21. [PubMed ID: 24441506]. https://doi.org/10.1097/CCO.0000000000000046.
  • 9.
    Oldridge EE, Pellacani D, Collins AT, Maitland NJ. Prostate cancer stem cells: are they androgen-responsive? Mol Cell Endocrinol. 2012;360(1-2):14-24. [PubMed ID: 21802490]. https://doi.org/10.1016/j.mce.2011.07.008.
  • 10.
    Nicolini A, Ferrari P, Fini M, Borsari V, Fallahi P, Antonelli A, et al. Cancer stem cells: perspectives of new therapeutical approaches for breast cancer. Front Biosci (Schol Ed). 2011;3:1486-99. [PubMed ID: 21622284].
  • 11.
    Ombrato L, Lluis F, Cosma MP. Regulation of self-renewal and reprogramming by TCF factors. Cell Cycle. 2012;11(1):39-47. [PubMed ID: 22186782]. https://doi.org/10.4161/cc.11.1.18759.
  • 12.
    Wang KH, Kao AP, Chang CC, Lin TC, Kuo TC. Upregulation of Nanog and Sox-2 genes following ectopic expression of Oct-4 in amniotic fluid mesenchymal stem cells. Biotechnol Appl Biochem. 2015;62(5):591-7. [PubMed ID: 25385323]. https://doi.org/10.1002/bab.1315.
  • 13.
    Afsah Hejri SJ, Mirzaei MR, Arababadi MK, Hassanshahi G, Mahmoodi M. OCT4B1 Down-Regulates Self-Renewal Genes in Cancer Cell Lines. Pharm Sci. 2014;19(4):117.
  • 14.
    Cheng X, Meng S, Deng J, Lai W, Wang H. Identification and characterization of the Oct4 extended transcriptional regulatory region in Guanzhong dairy goat. Genome. 2011;54(10):812-8. [PubMed ID: 21929360]. https://doi.org/10.1139/g11-047.
  • 15.
    Atlasi Y, Mowla SJ, Ziaee SA, Gokhale PJ, Andrews PW. OCT4 spliced variants are differentially expressed in human pluripotent and nonpluripotent cells. Stem Cells. 2008;26(12):3068-74. [PubMed ID: 18787205]. https://doi.org/10.1634/stemcells.2008-0530.
  • 16.
    Pan H, Schultz RM. Sox2 modulates reprogramming of gene expression in two-cell mouse embryos. Biol Reprod. 2011;85(2):409-16. [PubMed ID: 21543769]. https://doi.org/10.1095/biolreprod.111.090886.
  • 17.
    Wang X, Gingrich DK, Deng Y, Hong Z. A nucleostemin-like GTPase required for normal apical and floral meristem development in Arabidopsis. Mol Biol Cell. 2012;23(8):1446-56. [PubMed ID: 22357616]. https://doi.org/10.1091/mbc.E11-09-0797.
  • 18.
    Sogi DS, Sharma S, Oberoi DP, Wani IA. Effect of extraction parameters on curcumin yield from turmeric. J Food Sci Technol. 2010;47(3):300-4. [PubMed ID: 23572641]. https://doi.org/10.1007/s13197-010-0047-8.
  • 19.
    Kontos CK, Scorilas A, Papavassiliou AG. The role of transcription factors in laboratory medicine. Clin Chem Lab Med. 2013;51(8):1563-71. [PubMed ID: 23612552]. https://doi.org/10.1515/cclm-2013-0077.
  • 20.
    Mirzaei MR, Najafi A, Arababadi MK, Asadi MH, Mowla SJ. Altered expression of apoptotic genes in response to OCT4B1 suppression in human tumor cell lines. Tumour Biol. 2014;35(10):9999-10009. [PubMed ID: 25008565]. https://doi.org/10.1007/s13277-014-2238-9.
  • 21.
    Rahman M, Deleyrolle L, Vedam-Mai V, Azari H, Abd-El-Barr M, Reynolds BA. The cancer stem cell hypothesis: failures and pitfalls. Neurosurgery. 2011;68(2):531-45. discussion 545. [PubMed ID: 21135745]. https://doi.org/10.1227/NEU.0b013e3181ff9eb5.
  • 22.
    Juhasz K, Lipp AM, Nimmervoll B, Sonnleitner A, Hesse J, Haselgruebler T, et al. The complex function of hsp70 in metastatic cancer. Cancers (Basel). 2013;6(1):42-66. [PubMed ID: 24362507]. https://doi.org/10.3390/cancers6010042.
  • 23.
    Wong TF, Takeda T, Li B, Tsuiji K, Kitamura M, Kondo A, et al. Curcumin disrupts uterine leiomyosarcoma cells through AKT-mTOR pathway inhibition. Gynecol Oncol. 2011;122(1):141-8. [PubMed ID: 21450334]. https://doi.org/10.1016/j.ygyno.2011.03.001.
  • 24.
    Mirzaei MR, Hassanshahi G, Mahmoodi M, Hajizadeh MR, Bagrezaei F, Chehardoli M. RNA-Interference-Mediated Silencing of OCT4B1, Alters Expression Profile of Several TNF Ligand/Receptor Transcripts in Human Tumor Cell Lines. Pharm Sci. 2014;20(3):114-21.
  • 25.
    Dixon-Shanies D, Shaikh N. Growth inhibition of human breast cancer cells by herbs and phytoestrogens. Oncol Rep. 1999;6(6):1383-7. [PubMed ID: 10523716].
  • 26.
    Mudduluru G, George-William JN, Muppala S, Asangani IA, Kumarswamy R, Nelson LD, et al. Curcumin regulates miR-21 expression and inhibits invasion and metastasis in colorectal cancer. Biosci Rep. 2011;31(3):185-97. [PubMed ID: 20815812]. https://doi.org/10.1042/BSR20100065.
  • 27.
    Lim TG, Lee SY, Huang Z, Lim do Y, Chen H, Jung SK, et al. Curcumin suppresses proliferation of colon cancer cells by targeting CDK2. Cancer Prev Res (Phila). 2014;7(4):466-74. [PubMed ID: 24550143]. https://doi.org/10.1158/1940-6207.CAPR-13-0387.
  • 28.
    Li B, Konecke S, Wegiel LA, Taylor LS, Edgar KJ. Both solubility and chemical stability of curcumin are enhanced by solid dispersion in cellulose derivative matrices. Carbohydr Polym. 2013;98(1):1108-16. [PubMed ID: 23987452]. https://doi.org/10.1016/j.carbpol.2013.07.017.

Similar Articles

2
Jul
2025
Jentashapir J Cell Mol Biol

Investigating How Nano-Curcumin Affects the Expression of the p53 Gene and Inhibits the Cell Cycle in the A549 Lung Cancer Cell Line

Amirali Mousavi Salehi,
Mohammadreza Hajjari,
Nahid Pourreza,
Ali Khodadadi

Mousavi Salehi A, Hajjari M, Pourreza N, Khodadadi A. Investigating How Nano-Curcumin Affects the Expression of the p53 Gene and Inhibits the Cell Cycle in the A549 Lung Cancer Cell Line. Jentashapir J Cell Mol Biol. 2025;16(2):e159105. doi: https://doi.org/10.5812/jjcmb-159105

30
Mar
2025
Jundishapur J Nat Pharm Prod

Down-Regulation of HOTAIR, SUZ12, and DNMT3A by Curcumin Nanoparticles in Glioblastoma

Hassan Maghsoudi,
Nahid Pourreza,
Maryam Naderi Soorki,
Mohammadreza Hajjari

Maghsoudi H, Pourreza N, Naderi Soorki M, Hajjari M. Down-Regulation of HOTAIR, SUZ12, and DNMT3A by Curcumin Nanoparticles in Glioblastoma. Jundishapur J Nat Pharm Prod. 2025;20(2):e157405. doi: https://doi.org/10.5812/jjnpp-157405

25
May
2024
Thrita J Neu

Curcumin Affects the Proliferation and Neurogenesis of Embryonic Neural Stem Cells in Rats

Majid Rajabi,
Siamak Yari,
Nahid Fakhraei,
Javad Fahanik-Babaei,
Abdollah Amini

Rajabi M, Yari S, Fakhraei N, Fahanik-Babaei J, Amini A. Curcumin Affects the Proliferation and Neurogenesis of Embryonic Neural Stem Cells in Rats. Thrita J Neu. 2023;12(2):e143850. doi: https://doi.org/10.5812/thrita-143850

25
May
2015

Anticancer Activity of Curcumin on Human Breast Adenocarcinoma: Role of Mcl-1 Gene

Zeinab Khazaei Koohpar,
Maliheh Entezari,
Abolfazl Movafagh,
Mehrdad Hashemi

Khazaei Koohpar Z, Entezari M, Movafagh A, Hashemi M. Anticancer Activity of Curcumin on Human Breast Adenocarcinoma: Role of Mcl-1 Gene. Int J Cancer Manag. 2015;8(3):e2331. doi: https://doi.org/10.17795/ijcp2331

28
Sep
2016

Effects of all trans retinoic acid on apoptosis induction and notch1, hes1 genes expression in gastric cancer cell line MKN-45

nazila niapour,
samira shokri gara geshlagi,
mojtaba amani,
marzieh sharifi pasandi,
hossein salehi,
ali niapour

niapour N, shokri gara geshlagi S, amani M, sharifi pasandi M, salehi H, et al. Effects of all trans retinoic acid on apoptosis induction and notch1, hes1 genes expression in gastric cancer cell line MKN-45. koomesh. 2016;17(4):e151198. doi:


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles