Molecular Detection of Antibiotic Resistance Genes Among Enterococcus faecalis Isolated From Fecal and Urine Samples of Patients With Community-Acquired Urinary Tract Infections

Authors

Marjan Rashidan1, Zohreh Ghalavand1, Gita Eslami1, Latif Gachkar2, Mohammad Rahbar3, Ronak Khosravi1, Ghazaleh Ghandchi4, Fatemeh FallahFatemeh Fallah ORCID2,*
1Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
2Infectious Diseases and Tropical Medicine Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
3Department of Microbiology, Reference Health Laboratories, Ministry of Health, Tehran, IR Iran
4Pediatric Infections Research Center, Mofid Children’s Hospital, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
*Corresponding Author: Corresponding author: Fatemeh Fallah, Infectious Diseases and Tropical Medicine Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran, E-mail: Email: [email protected]

Archives of Pediatric Infectious Diseases:Vol. 4, issue 3; e36262
Published online:May 30, 2016
Article type:Research Article
Received:Jan 11, 2016
Accepted:Apr 04, 2016
How to Cite:Rashidan M, Ghalavand Z, Eslami G, Gachkar L, Rahbar M, et al. Molecular Detection of Antibiotic Resistance Genes Among Enterococcus faecalis Isolated From Fecal and Urine Samples of Patients With Community-Acquired Urinary Tract Infections. Arch Pediatr Infect Dis. 2016;4(3):e36262. doi: https://doi.org/10.5812/pedinfect.36262

Abstract

Background:

Urinary tract infection (UTI) is one of the most common bacterial infections in outpatient settings. Enterococcus species is currently considered the second most common cause of UTI.

Objectives:

The aim of this study was to investigate antibiotic resistance patterns among Enterococcus faecalis strains and evaluate the association of antibiogram patterns from urine and fecal samples in community-acquired UTIs using phenotypic and molecular methods.

Materials and Methods:

A total of 144 urine and fecal samples were obtained from outpatients with UTI who had been referred to Labbafinejad hospital and Milad hospital from August 2014 to April 2015. For bacteriological study, samples were cultured in enterococcosel and blood agar. Antimicrobial susceptibility tests were evaluated using the disk diffusion method and the E. test according to criteria recommended by the clinical and laboratory standards institute (CLSI). PCR was performed for the detection of specific species and the antibiotic resistance genes tetM and vanA.

Results:

Of the 72 E. faecalis strains isolated from urine samples, 63 (87.5%) were also isolated from fecal samples. 40 (63.4%) of the isolates found in both urine and feces had similar antibiotic sensitivity patterns. 17 (26.9%) of the isolates found in both specimens were different in a class of antibiotic (related) and 8 (12.6%) isolates in more than one or two class of antibiotics (difference). The results of the disk diffusion methods were analyzed according to CLSI breakpoints. The antibiotic resistance of strains isolated from urine samples was evaluated for tetracycline (65 strains [90.3%] resistant), minocycline (64 [88.9%]), gentamicin (120 µg) (21 [29.2%]), ciprofloxacin (17 [23.6%]), levofloxacin (12 [16.7%]), and gatifloxacin (11 [15.3%]). The same evaluation was conducted for the strains isolated from fecal samples for tetracycline (48 [76.1%]), minocycline (45 [71.4%]), gentamicin (10 [15.8%]), ciprofloxacin (8 [12.6%]), and gatifloxacin (4 [6.3%]). All strains were sensitive to vancomycin, ampicillin, penicillin, nitrofurantoin, linezolid, and daptomycin. According to the PCR results as a gold standard and molecular method, 67 (93%) of the isolates from urine and 52 (82.5%) of the isolates from feces were positive for tetM genes. The vanA gene was not found in any strain.

Conclusions:

The simultaneous detection of E. faecalis in a patient’s gastrointestinal and urine tracts can indicate the presence of uropathogenic Enterococcus. Further study is essential to identify virulence factors involved in the colonization of these isolates in the urinary tract.

Highlights

1. Background

Urinary tract infections (UTIs) are the most common human bacterial infections in both community and hospital settings for all ages (1, 2). It is estimated that every year about 150 million people are infected with UTIs at a cost of 6 billion US dollars worldwide (3). UTIs may involve the lower and sometimes both the upper and lower urinary tracts (4). In community-acquired UTIs (CA-UTIs), women are more likely to contract these infections in their life cycle than men (5, 6). The most common problem is recurrent infection which can affect women of all ages, especially pregnant and elderly women (7).
Both host factors and virulence factors released by the pathogens are involved in the pathogenesis of recurrent infections. Predisposing host factors to recurrent infections include genetic factors, aging, menopause, and urogenital dysfunction (7, 8).
Previous studies have shown that Escherichia coli are the most common organisms isolated from uncomplicated UTIs (4). However, enterococci, particularly Enterococcus faecalis, have been identified as second agents for CA-UTIs in some countries (9-12) and are reported to be responsible for 6 - 10% of CA-UTIs (13-16). This bacterium is a normal inhabitant of the gastrointestinal tract in animals and humans. However, it can also be an important pathogen that causes endocarditis, surgical wound infection, bacteraemia, and sepsis (17, 18).
The use of broad-spectrum antibiotics to treat UTIs can lead to an emergence of enterococci such as E. faecalis that are resistant to beta-lactam antibiotics, aminoglycosides, and glycopeptides, which is a major, global problem in the treatment of this illness (19-21).
The resistance patterns of E. faecalis in both urine and fecal specimens have not been studied extensively (22). In the past few years, the antibiotic resistance patterns of E. faecalis causing UTIs have changed in both the community and health care centers (23-25). This information is a reflection of changes over the years. A monitoring period appears to be necessary for the reduction of the number of UTIs (26-28). Tetracycline resistance in many commensal and pathogenic bacteria can be related to transferable genetic elements like plasmids (29). The vanA gene is one of the important causes of resistance to vancomycin and teicoplanin. The vanA gene can be located on a plasmid or transposon and can be spread among bacterial species rapidly (30).
Moreover, several studies have recorded that enterococcal infections are often caused by the patient’s own commensal flora (31). Determining the antibiotic resistance patterns of enterococci that have been isolated from both urine and feces and antibiotyping can be useful for discovering endogenous CA-UTIs. However, there is little data for antibiotic resistance patterns of E. faecalis in urine and fecal samples of outpatients with UTIs in Iran.

2. Objectives

The present study was designed and performed in Mofid hospital and Labbafinejad hospital to investigate the antibiotic resistance patterns among E. faecalis strains isolated from fecal and urine samples of patients with CA-UTIs using phenotypic and molecular methods to detect the vanA and tetM genes.

3. Materials and Methods

3.1. Isolate Collection and Identification

A descriptive study was conducted from August 2014 to March 2015 on outpatients attending Milad hospital and Labbafinejad hospital in Tehran, Iran. A total of 72 urine and fecal specimens were collected from consecutive outpatients with a UTI. An early morning midstream urine specimen was collected in a sterile container from these patients. Fresh fecal samples were also collected at the same time. Samples were transferred to the Pediatric Infections Research Center of Shahid Beheshti University of Medical Sciences at Mofid children’s hospital.
Urine specimens were inoculated on blood agar plates using calibrated loops and fecal specimens were inoculated on enterococcosel agar (BBL, USA) plates and incubated at 37°C for 24 hours. Colony forming units per milliliter numbering more than 105 was considered as bacteriuria. The colony morphology and culture characteristics were observed macroscopically. Standard biochemical procedures such as gram staining, the catalase test, the bile esculin hydrolysis test, growth in 6.5% sodium chloride, and the arabinose fermentation test were used for the isolation of E. faecalis strains (32, 33). All strains were stored at -70°C in trypticase soy broth with 20% glycerol. The PCR method was performed with primers specific for the E. faecalis species (see the Molecular examinations section).

3.2. Antibiotic Susceptibility Testing

The antibiotic susceptibility patterns of E. faecalis isolates in both samples were determined using the standard Kirby-Bauer disk diffusion method and the E. test according to the CLSI’s recommendations (CLSI 2014). After inoculation and preparing the disks, the Mueller-Hinton agar plates were incubated for 24 hours and the inhibition zones were measured with a metric ruler. A total of 12 antimicrobial agents were tested. These agents were penicillin G (10 units), ampicillin (10 µg), vancomycin (30 µg), tetracycline (30 µg), minocycline (30 µg), ciprofloxacin (5 µg), levofloxacin (5 µg), gatifloxacin (5 µg), nitrofurantoin (300 µg), gentamicin (120 µg) and linezolid (30 µg) (MAST GROUP Ltd., United Kingdom). MIC Test Strips (Liofilchem®, Italy) were used for detection of antimicrobial susceptibility to daptomycin. The E. faecalis strain ATCC 29212 and Staphylococcus aureus ATCC 25923 were used on each day of testing as quality controls. Multidrug resistance (MDR) was defined as resistance to three or more different classes of the antimicrobial agents tested.

3.3. Molecular Examinations

Extraction of the genomic DNA was performed using the High Pure PCR Template Preparation Kit (Roche, Germany), with some modifications. The bacterial pellet was mixed with 200µl PBS, digested in 5µl lysozyme, and incubated at 37°C for 15 minutes. The mixture was then lysed using a short incubation with a lysis buffer and proteinase k. The solution was then transferred to a spin column to remove any contaminating cellular components. Finally, the DNA was eluted using an elution buffer at 70°C.
PCR was carried out in a total volume of 25 μL Master mix 2x (Cinnagen, Iran) containing 50 pmol of primers, 100 ng of genomic DNA, 0.4 mmol L-1 of each of four dNTPs, 3 mmol L-1 MgCl2, and 0.08 U of Taq DNA polymerase. The primer sequences used were ddlE1 (ATCAAGTACAGTTAGTCTTTATTAG) and ddIE2 (ACGATTCAAAGCTAACTGAATCAGT) for E. faecalis isolates (32) with an amplicon size of 941 bp, vanA-F (5’-CATGAATAGAATAAAAGTTGCAATA-3’) and vanA-R (5’-CCCCTTTAACGCTAATACGATCAA-3’) with an amplicon size of 1030 bp (32), and tetM-F (5’-GGACAAAGGTACAACGAGGAC-3’) and tetM-R (5’- GGTCATCGTTTCCCTCTATTACC-3’) with an amplicon size of 446 bp (33). PCR was performed in a thermal cycler (Eppendorf, Germany) under the following conditions: initial denaturation step at 95°C for 5 minutes followed by 35 cycles consisting of denaturation at 95°C for 1 minute, annealing at 49°C (for ddlE), 57°C (for vanA), and 54°C (for tetM) for 1 minute, and 72°C for 1 minute followed by a final extension at 72°C for 10 minutes to ensure full extension of the PCR products.
The PCR amplification products were detected through electrophoresis in a 1% agarose gel followed by staining with red safe solution and a 100 bp DNA ladder (Fermentas, Germany). The results were visualized under a UV transilluminator. Internal positive controls have been used for the detection of tetM and vanA genes in this study. The direct sequencing of PCR amplified products was carried out using an ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea).

4. Results

4.1. Bacterial Isolation

Of the 72 strains of E. faecalis isolated from the urine of patients with CA-UTI, 63 (87.5%) strains were also isolated from the feces of patients. Amplification of the E. faecalis-specific target produced a 941 bp band (Figure 1). The mean age for the studied group was 41.6 years, and the range was from 6 and 87 years. Thirty-seven isolates were collected from females (51.38%) and 35 from males (48.61%). In females, the majority of isolates came from patients who were 41 to 50 years old. In males, the majority of isolates came from patients who were 31 to 60 years old. The demographic characteristics of patients with CA-UTIs are shown in Table 1.
M, marker 100 bp; C+, standard <i>E. faecalis</i> strain 29212 as a positive control; 1, testing strain; C-, negative control.
Figure 1.
M, marker 100 bp; C+, standard E. faecalis strain 29212 as a positive control; 1, testing strain; C-, negative control.
Table 1.
Patient Age and Sex Distribution
Age Groups, yFemales, No. (%)Males, No. (%)
0 - 1001 (2.85)
11 - 204 (10.81)3 (8.57)
21 - 305 (13.51)4 (11.42)
31 - 408 (21.62)6 (17.14)
41 - 5011 (29.72)7 (20)
51 - 607 (18.91)6 (17.14)
61 - 702 (5.4)5 (14.28)
71 - 8001 (2.85)
81 - 9002 (5.71)
Total37 (51.38)35 (48.61)

4.2. Antimicrobial Resistance

The susceptibility of E. faecalis isolates to various antibiotics in both urine and fecal samples is shown in Table 2. In general, the antibiotic resistance of strains isolated from urine was evaluated for tetracycline (65 strains [90.3%] resistant), minocycline (64 [88.9%]), gentamicin (120 µg) (21 [29.2%]), ciprofloxacin (17 [23.6%]), levofloxacin (12 [16.7%]), and gatifloxacin (11 [15.3%]). The same evaluation was conducted for the strains isolated from feces for tetracycline (48 [76.1%]), minocycline (45 [71.4%]), gentamicin (10 [15.8%]), ciprofloxacin (8 [12.6%]) and gatifloxacin (4 [6.3%]). In the present study we did not detect any resistance to vancomycin, ampicillin, penicillin, nitrofurantoin, or linezolid in isolates from urine or fecal specimens. All studied isolates in both samples were susceptible to daptomycin with a minimum inhibitory concentration (MIC) value of ≤ 4µg/mL. The number of strains with the MDR phenotype isolated from the 72 urine specimens was 9 (12.5%) and for the 63 fecal specimens was 7 (11.1%), as shown in Table 3.
Table 2.
Rate of Resistance and Susceptibility to Antimicrobial Resistance in E. faecalis Isolates from Urine and Fecal Specimens in CA-UTIs
Antibiotic DisksUrine Sample, N = 72Fecal Sample, N = 63
R, %I, %S, %R, %I, %S, %
Ampicillin0-1000-100
Penicillin G0-1000-100
Vancomycin0-1000-100
Linezolid0-1000-100
Nitrofurantoin0-1000-100
Gatifloxacin15.3-84.76.3-93.6
Levofloxacin16.7-83.36.3-93.6
Ciprofloxacin23.6-76.412.6-87.3
Gentamycin (120 µg)29.2-70.815.8-84.1
Minocycline88.9-11.171.4-28.5
Tetracycline90.3-9.776.1-23.8
Daptomycin0-1000-100
Table 3.
Antibiotic Resistance Patterns in E. faecalis Isolates from Urine and Fecal Specimens in CA-UTIa
Antibiotic Resistance PatternsUrine Sample, N = 72Fecal Sample, N = 63
TET, MIN, GM120, CP, LEV, GAT7 (9.7)5 (7.9)
TET, MN, GM120, CP2 (2.7)2 (3.1)
TET, MN, GM12011 (15.2)10 (15.8)
TET, MN, CP, LEV, GAT4 (5.5)3 (4.7)
TET, MN, CP3 (4.1)2 (3.1)
TET, MN37 (51.3)33 (52.3)
CP, LEV1 (1.3)1 (1.5)
TET1 (1.3)2 (3.1)
GM1201 (1.3)0
Abbreviations: CP, ciprofloxacin; GAT, gatifloxacin; GM120, gentamicin (120 µg); LEV, levofloxacin; MIN: minocycline.
aValues are presented as No. (%).
The most common MDR phenotype in strains isolated from both urine and fecal specimens was tetracycline/minocycline/gentamicin (120 µg)/ciprofloxacin/levofloxacin/gatifloxacin and for fecal specimens (Table 3).
In this study, 40 (63.4%) of the isolates from urine and fecal specimens shared similar antibiotic sensitivity and resistance patterns. 17 (26.9%) of the isolates in both samples were different in one class of antimicrobial agent that considered as related and 8 (12.6%) of the isolates in more than one or two classes of antimicrobial agents as difference. A similar correlation of antibiotic resistance patterns in these isolates is presented in Table 4.
Table 4.
Similar Correlation of Antibiotic Resistance Patterns in E. faecalis Isolates Between Urine and Fecal Samples from CA-UTI Patientsa
Antibiotic Resistance PatternsUrine /Fecal Samples N = 63
TET, MN, GM120, CP, GAT, LEV2 (3.7)
TET, MN, CP, GAT, LEV1 (1.5)
TET, MN, GM1206 (9.5)
TET, MN25 (39.6)
TET, MN, CP1 (1.5)
LEV, CP1 (1.5)
TET1 (1.5)
Total37
Abbreviations: CP, ciprofloxacin; GAT, gatifloxacin; GM120, gentamicin (120 µg); LEV, levofloxacin; MIN: minocycline.
aValues are presented as No. (%).
PCR results showed that the vanA gene was not found in any strain and 58 (92%) of the isolates from urine and 52 (82.5%) of the isolates from feces were positive for tetM genes. The amplification of tetM genes produced a 446 bp band (Figure 2). The sequencing pattern of the tetM gene confirmed the PCR results.
1, <i>E. faecalis</i> strain with <i>tetM</i> gene; C-, <i>E. faecalis</i> strain 29212 as negative control; M, marker 100 bp.
Figure 2.
1, E. faecalis strain with tetM gene; C-, E. faecalis strain 29212 as negative control; M, marker 100 bp.

5. Discussion

UTIs represent one of the most common infectious diseases both in the community and hospital settings, and influence all age groups including men, women, and children around the world (34, 35). Enterococci, especially E. faecalis, have been considered as second agents for CA-UTIs in some countries (9, 10, 12). Our study showed a higher prevalence of CA-UTIs in females (51.38%) than in males (48.61%), which is similar to other findings (36-38).This high prevalence in women can be due to sexual intercourse, incontinence, and poor toilet hygiene (39-41).
In our study, all E. faecalis strains isolated from urine specimens were susceptible to penicillin G and ampicillin, which is lower than the 100% and 97.8% resistance rates reported in India (16), 57.1% in Iraq (15), and 59.8% in Portugal (42). Our results were comparable to the 0.02% and 0.04% resistance rates reported in Taiwan (43) and 0.3% in Brazil from urine specimens of patients with CA-UTIs (44). In this study, all isolates showed no resistance to linezolid and daptomycin, which is comparable to the 100% sensitivity rate from urine specimens reported in Taiwan (43). All of the strains were susceptible to nitrofurantoin, which is comparable to the 0.8% resistance rate from urine specimens reported in Brazil (44) and 100% sensitivity rate in India (16). In this study, vancomycin-resistant E. faecalis were not found in these samples which is comparable to the 100% sensitivity rate reported from urine specimens in Saudi Arabia (9) and 0.08% in Taiwan (43) and is higher than the 25% resistance rate reported from India (16). The reason for the absence of resistance to these antibiotics in this study and the low rates of resistance in other countries (43, 44) can be related to the fact that these antibiotics are not used as therapeutic antimicrobial agents in infections other than UTIs in Iran. Therefore, these antibiotics could be a good choice of antibiotic therapy for enterococcal CA-UTIs in Iran. On the other hand, high antibiotic resistance rates in other countries can be associated with the indiscriminative use of antibiotics. In this study, the vanA gene was not found in any strain. There are few studies about the prevalence of this gene in CA-UTIs around the world. A study in America and Canada was performed on inpatients and outpatients with UTIs, and 56.8% of the E. faecalis isolates displayed the vanA phenotype (45). The high prevalence of this gene could be due to the excessive use of vancomycin in these countries.
A low percentage of quinolone resistance was found in the strains studied here. The results from this study revealed that 23.6% of the E. faecalis strains from urine specimens were resistant to ciprofloxacin, which is comparable to the 25% resistance rate reported in India (16), lower than the 42.9% resistance rate reported in Iraq (15) and 38.1% in Portugal (42), and higher than the 9.7% resistance rate reported in Taiwan in CA-UTIs (46). The 16.7% resistance rate to levofloxacin in these isolates was higher than the 9.8% resistance rate reported in Taiwan (43).
Enterococci, including E. faecalis, have an intrinsic low-level resistance to aminoglycosides (46). In our study, the 29.9% resistance rate to gentamicin (120 µg) in these isolates from urine specimens was lower than the 50% and 42.9% resistance rates reported in Iraq and Taiwan, respectively (15, 43).
In our study, the majority of E. faecalis isolates from urine specimens were resistant to tetracycline (90.3%) and minocycline (88.9%), which is comparable to the 91.8% resistance rate reported in Taiwan (44) and lower than the 50% and 59.2% resistance rates reported in India and Brazil, respectively (16, 43). The resistance gene tetM that mediates resistance through ribosomal protection was detected in 92% of the urine specimens in the current study. The prevalence of this gene in the present study is significantly higher compared to other studies. In a study conducted in China by Jia et al., the prevalence of the tetM gene was reported in 31.6% of the E. faecalis strains (47). No information has been reported about the frequency of this gene in CA-UTIs in Iran. The high rate of tetracycline resistance in E. faecalis isolates may be related to the indiscriminate use of antibiotics in these patients and animal agriculture in Iran (48). Therefore, surveillance of the use of antibiotics in the community and surveys of animal reservoirs of tetracycline-resistant E. faecalis are essential (49).
There is little information about the MDR phenotype of E. faecalis isolates in CA-UTIs around the world. In this study, the percentage of the MDR phenotype was found to be 12.5% in E. faecalis isolated from urine specimens, which is lower than the 30% resistance rate from outpatients reported in Taiwan (43). No information has been reported about the frequency of the MDR phenotype in these isolates in Iran. The low prevalence of multiple antibiotic-resistant strains may be due to the large population of bacterial isolates which have not been exposed to several antibiotics.
Information is scarce about the antibiotic resistance of E. faecalis isolated from fecal specimens of patients with CA-UTIs. In a study conducted in Ethiopia on the antibiotic resistance of Enterococcus species isolated from the intestinal tracts of hospitalized patients, it was revealed that a high rate of fecal colonization by vancomycin-resistant enterococci was due to the use of vancomycin in hospitalized patients (48).
In this study, 63.4% of the isolates from urine and fecal specimens have similar antibiotic sensitivity and resistance patterns. This suggests the involvement of uropathogenic E. faecalis in the infection of these patients. The colonization of the gastrointestinal tract with different strains of E. faecalis or contamination was possibly responsible for the UTI in these patients. Further studies are essential to identify virulence factors involved in the colonization of these isolates and to determine the clonal relatedness of these strains using molecular fingerprinting methods in the urinary tract.

Acknowledgments

Footnotes

  • Authors’ Contribution:Study concept and design was done by Fatemeh Fallah and Marjan Rashidan. Collection, assembly, and possession of the raw data were done by Latif Gachkar, Mohammad Rahbar, and Ghazaleh Ghandchi. Analysis and interpretation of data was conducted by Fatemeh Fallah, Zohreh Ghalavand, Gita Eslami, and Marjan Rashidan. Drafting of the manuscript was done by Fatemeh Fallah, Zohreh Ghalavand, and Ronak Khosravi. Final approval of the study was done by Fatemeh Fallah, Marjan Rashidan, Zohreh Ghalavand, Gita Eslami, Latif Gachkar, and Mohammad Rahbar.

  • Funding/Support:This work was fully supported by the infectious diseases and tropical medicine research center (IDTMRC) of Shahid Beheshti University of Medical Sciences located in Tehran, Iran.

References

  • 1.
    Tice AD. Short-course therapy of acute cystitis: a brief review of therapeutic strategies. J Antimicrob Chemother. 1999;43 Suppl A:85-93. [PubMed ID: 10225577].
  • 2.
    Sharifian M, Sharifian S. Diagnostic challenges in Urinary Tract Infections in Children. Arch Pediatr Infect Dis. 2015;3(2).
  • 3.
    Gonzalez CM, Schaeffer AJ. Treatment of urinary tract infection: what's old, what's new, and what works. World J Urol. 1999;17(6):372-82. [PubMed ID: 10654368].
  • 4.
    Hotchandani R, Aggarwal KK. Urinary tract infections in women. Indian J Clin Pract. 2012;23(4):187-92.
  • 5.
    Foxman B. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Am J Med. 2002;113 Suppl 1A:5S-13S. [PubMed ID: 12113866].
  • 6.
    Stamm WE. An epidemic of urinary tract infections? N Engl J Med. 2001;345(14):1055-7. [PubMed ID: 11586959]. https://doi.org/10.1056/NEJM200110043451409.
  • 7.
    Dwyer PL, O'Reilly M. Recurrent urinary tract infection in the female. Curr Opin Obstet Gynecol. 2002;14(5):537-43. [PubMed ID: 12401984].
  • 8.
    Ronald A. The etiology of urinary tract infection: traditional and emerging pathogens. Am J Med. 2002;113 Suppl 1A:14S-9S. [PubMed ID: 12113867].
  • 9.
    Tantry BA, Rahiman S. Antibacterial resistance and trend of urinary tract pathogens to commonly used antibiotics in Kashmir Valley. West Indian Med J. 2012;61(7):703-7. [PubMed ID: 23620968].
  • 10.
    Gupta S, Kapur S, Padmavathi D. Comparative prevalence of antimicrobial resistance in community-acquired urinary tract infection cases from representative States of northern and southern India. J Clin Diagn Res. 2014;8(9):9-12. [PubMed ID: 25386432].
  • 11.
    Edlin RS, Shapiro DJ, Hersh AL, Copp HL. Antibiotic resistance patterns of outpatient pediatric urinary tract infections. J Urol. 2013;190(1):222-7. [PubMed ID: 23369720]. https://doi.org/10.1016/j.juro.2013.01.069.
  • 12.
    Lee SJ, Lee DS, Choe HS, Shim BS, Kim CS, Kim ME, et al. Antimicrobial resistance in community-acquired urinary tract infections: results from the Korean Antimicrobial Resistance Monitoring System. J Infect Chemother. 2011;17(3):440-6. [PubMed ID: 21140281]. https://doi.org/10.1007/s10156-010-0178-x.
  • 13.
    Schmiemann G, Gagyor I, Hummers-Pradier E, Bleidorn J. Resistance profiles of urinary tract infections in general practice--an observational study. BMC Urol. 2012;12:33. [PubMed ID: 23171154]. https://doi.org/10.1186/1471-2490-12-33.
  • 14.
    Xiao Y, Wei Z, Shen P, Ji J, Sun Z, Yu H, et al. Bacterial-resistance among outpatients of county hospitals in China: significant geographic distinctions and minor differences between central cities. Microbes Infect. 2015;17(6):417-25. [PubMed ID: 25708671]. https://doi.org/10.1016/j.micinf.2015.02.001.
  • 15.
    NS H. Clinical, Etiology and Antibiotic Susceptibility Profiles of Community-Acquired Urinary Tract Infection in a Baghdad Hospital. JCU. 2014;3(2).
  • 16.
    Singhal A, Sharma R, Jain M, Vyas L. Hospital and Community Isolates of Uropathogens and their Antibiotic Sensitivity Pattern from a Tertiary Care Hospital in North West India. Ann Med Health Sci Res. 2014;4(1):51-6. [PubMed ID: 24669331]. https://doi.org/10.4103/2141-9248.126611.
  • 17.
    Hidron AI, Edwards JR, Patel J, Horan TC, Sievert DM, Pollock DA, et al. NHSN annual update: antimicrobial-resistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2006-2007. Infect Control Hosp Epidemiol. 2008;29(11):996-1011. [PubMed ID: 18947320]. https://doi.org/10.1086/591861.
  • 18.
    Sood S, Malhotra M, Das BK, Kapil A. Enterococcal infections & antimicrobial resistance. Indian J Med Res. 2008;128(2):111-21. [PubMed ID: 19001673].
  • 19.
    Matsumoto T, Hamasuna R, Ishikawa K, Takahashi S, Yasuda M, Hayami H, et al. Nationwide survey of antibacterial activity against clinical isolates from urinary tract infections in Japan (2008). Int J Antimicrob Agents. 2011;37(3):210-8. [PubMed ID: 21242062]. https://doi.org/10.1016/j.ijantimicag.2010.10.032.
  • 20.
    Kacmaz B, Aksoy A. Antimicrobial resistance of enterococci in Turkey. Int J Antimicrob Agents. 2005;25(6):535-8. [PubMed ID: 15908184]. https://doi.org/10.1016/j.ijantimicag.2005.02.020.
  • 21.
    Ishikawa K, Matsumoto T, Yasuda M, Uehara S, Muratani T, Yagisawa M, et al. The nationwide study of bacterial pathogens associated with urinary tract infections conducted by the Japanese Society of Chemotherapy. J Infect Chemother. 2011;17(1):126-38. [PubMed ID: 21174142]. https://doi.org/10.1007/s10156-010-0174-1.
  • 22.
    Gupta V, Yadav A, Joshi RM. Antibiotic resistance pattern in uropathogens. Indian J Med Microbiol. 2002;20(2):96-8. [PubMed ID: 17657041].
  • 23.
    Kahan NR, Chinitz DP, Waitman DA, Dushnitzky D, Kahan E, Shapiro M. Empiric treatment of uncomplicated urinary tract infection with fluoroquinolones in older women in Israel: another lost treatment option? Ann Pharmacother. 2006;40(12):2223-7. [PubMed ID: 17105833]. https://doi.org/10.1345/aph.1H396.
  • 24.
    Lee G. Ciprofloxacin Resistance in Enterococcus faecalis Strains Isolated From Male Patients With Complicated Urinary Tract Infection. Korean J Urol. 2013;54(6):388-93. [PubMed ID: 23789048]. https://doi.org/10.4111/kju.2013.54.6.388.
  • 25.
    Bosch FJ, van Vuuren C, Joubert G. Antimicrobial resistance patterns in outpatient urinary tract infections--the constant need to revise prescribing habits. S Afr Med J. 2011;101(5):328-31. [PubMed ID: 21837876].
  • 26.
    Alos JI. Epidemiology and etiology of urinary tract infections in the community. Antimicrobial susceptibility of the main pathogens and clinical significance of resistance. Enferm Infecc Microbiol Clin. 2005;23 Suppl 4:3-8. [PubMed ID: 16854352].
  • 27.
    den Heijer CD, Donker GA, Maes J, Stobberingh EE. Antibiotic susceptibility of unselected uropathogenic Escherichia coli from female Dutch general practice patients: a comparison of two surveys with a 5 year interval. J Antimicrob Chemother. 2010;65(10):2128-33. [PubMed ID: 20682565]. https://doi.org/10.1093/jac/dkq286.
  • 28.
    Dias Neto JA, Martins ACP, Silva LDM, Tiraboschi RB, Domingos ALA, Cologna AJ, et al. Community acquired urinary tract infection: etiology and bacterial susceptibility. Acta Cir Bras. 2003;18:33-6.
  • 29.
    Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001;65(2):232-60. [PubMed ID: 11381101]. https://doi.org/10.1128/MMBR.65.2.232-260.2001.
  • 30.
    Cetinkaya Y, Falk P, Mayhall CG. Vancomycin-resistant enterococci. Clin Microbiol Rev. 2000;13(4):686-707. [PubMed ID: 11023964].
  • 31.
    Boost M, Lai L, O'Donoghue M. Drug resistance in fecal enterococci in Hong Kong. J Infect Chemother. 2004;10(6):326-30. [PubMed ID: 15614455]. https://doi.org/10.1007/s10156-004-0337-z.
  • 32.
    Facklam RR, Collins MD. Identification of Enterococcus species isolated from human infections by a conventional test scheme. J Clin Microbiol. 1989;27(4):731-4. [PubMed ID: 2656745].
  • 33.
    Manero A, Blanch AR. Identification of Enterococcus spp. with a biochemical key. Appl Environ Microbiol. 1999;65(10):4425-30. [PubMed ID: 10508070].
  • 34.
    Arjunan M, Al-Salamah AA, Amuthan M. Prevalence and Antibiotics Susceptibility of Uropathogens in Patients from a Rural Environment, Tamilnadu. Am J Infect Dis. 2010;6(2):29-33.
  • 35.
    Kalsoom B, Jafar K, Begum H, Munir S, Akbar N, Ansari JA, et al. Patterns of antibiotic sensitivity of bacterial pathogens among urinary tract infections (UTI) patients in a Pakistani population. Afr J Microbiol Res. 2012;6(2). https://doi.org/10.5897/ajmr11.1171.
  • 36.
    Rangari AA, Sharma S, Tyagi N, Singh P, Singh G, Thakur R. Antibiotic Susceptibility Pattern of Bacterial Uropathogens Isolated from Patients at a Tertiary Care Hospital in Western Uttar Pradesh of India. Int J Curr Microbiol App Sci. 2015;4(10):646-57.
  • 37.
    Orrett FA. Urinary tract infections in general practice in a rural community in South Trinidad. Saudi Med J. 2001;22(6):537-40. [PubMed ID: 11426248].
  • 38.
    Garcia-Morua A, Hernandez-Torres A, Salazar-de-Hoyos JL, Jaime-Davila R, Gomez-Guerra LS. Community-acquired urinary tract infection etiology and antibiotic resistance in a Mexican population group. Rev Mex Urol. 2009;69(2):45-8.
  • 39.
    Ochei J, Kolhatkar A. Diagnosis of infection by specific anatomic sites/antimicrobial susceptibility tests, in Medical Laboratory Science Theory and Practice reprint. 6 ed. India: McGraw-Hill; 2007.
  • 40.
    Aiyegoro OA, Igbinosa OO, Ogunmwonyi IN, Odjadjare EE, Igbinosa OE, Okoh AI. Incidence of urinary tract infections (UTI) among children and adolescents in Ile-Ife, Nigeria. Afr J Microbiol Res. 2007;1:13-9.
  • 41.
    Orrett FA, Davis GK. A comparison of antimicrobial susceptibility profile of urinary pathogens for the years, 1999 and 2003. West Indian Med J. 2006;55(2):95-9.
  • 42.
    Linhares I, Raposo T, Rodrigues A, Almeida A. Frequency and antimicrobial resistance patterns of bacteria implicated in community urinary tract infections: a ten-year surveillance study (2000-2009). BMC Infect Dis. 2013;13:13-9. [PubMed ID: 23327474]. https://doi.org/10.1186/1471-2334-13-19.
  • 43.
    Wang JT, Chang SC, Wang HY, Chen PC, Shiau YR, Lauderdale TL, et al. High rates of multidrug resistance in Enterococcus faecalis and E. faecium isolated from inpatients and outpatients in Taiwan. Diagn Microbiol Infect Dis. 2013;75(4):406-11. [PubMed ID: 23414747]. https://doi.org/10.1016/j.diagmicrobio.2013.01.004.
  • 44.
    Kiffer CR, Mendes C, Oplustil CP, Sampaio JL. Antibiotic resistance and trend of urinary pathogens in general outpatients from a major urban city. Int Braz J Urol. 2007;33(1):42-8. [PubMed ID: 17335597].
  • 45.
    Zhanel GG, Laing NM, Nichol KA, Palatnick LP, Noreddin A, Hisanaga T, et al. Antibiotic activity against urinary tract infection (UTI) isolates of vancomycin-resistant enterococci (VRE): results from the 2002 North American Vancomycin Resistant Enterococci Susceptibility Study (NAVRESS). J Antimicrob Chemother. 2003;52(3):382-8. [PubMed ID: 12888592]. https://doi.org/10.1093/jac/dkg352.
  • 46.
    Dallal MMS, Saifi M, Pourshafie MR, Eshraghian MR. High-Level Gentamicin-Resistant Enterococcal Isolates From Urinary Tract Infection in Iran. Infect Dis Clin Prac. 2008;16(1):41-5. https://doi.org/10.1097/ipc.0b013e31815f6586.
  • 47.
    Jia W, Li G, Wang W. Prevalence and antimicrobial resistance of Enterococcus species: a hospital-based study in China. Int J Environ Res Public Health. 2014;11(3):3424-42. [PubMed ID: 24662964]. https://doi.org/10.3390/ijerph110303424.
  • 48.
    Asadpour L. Antibacterial drug resistance patterns in poultry isolated enterococci. Afr J Microbiol Res. 2012;6(29). https://doi.org/10.5897/ajmr12.187.
  • 49.
    Hammerum AM. Enterococci of animal origin and their significance for public health. Clin Microbiol Infect. 2012;18(7):619-25. [PubMed ID: 22487203]. https://doi.org/10.1111/j.1469-0691.2012.03829.x.

Copyright

Copyright © 2016, Pediartric Infections Research Center. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

19
Jan
2021
Biotyping and Antimicrobial Susceptibility of Enterococcus faecalis and E. faecium Isolated from Urine and Stool Samples

Biotyping and Antimicrobial Susceptibility of Enterococcus faecalis and E. faecium Isolated from Urine and Stool Samples

Gülşah Tollu,
Ismail Hakkı Ekin

Tollu G, Ekin IH. Biotyping and Antimicrobial Susceptibility of Enterococcus faecalis and E. faecium Isolated from Urine and Stool Samples. Jundishapur J Microbiol. 2020;13(10):e105136. doi: https://doi.org/10.5812/jjm.105136

1
Jul
2013

Virulence Gene’s Relationship With Biofilm Formation and Detection of aac (6’)/aph (2”) in Enterococcus faecalis Isolated From Patients With Urinary Tract Infection

Rezvan Moniri,
Ahmad Ghasemi,
Seyed Gholam Abbas Moosavi,
Kamran Dastehgoli,
Maryam Rezaei

Moniri R, Ghasemi A, Moosavi SGA, Dastehgoli K, Rezaei M. Virulence Gene’s Relationship With Biofilm Formation and Detection of aac (6’)/aph (2”) in Enterococcus faecalis Isolated From Patients With Urinary Tract Infection. Jundishapur J Microbiol. 2013;6(5):e94137. doi: https://doi.org/10.5812/jjm.6244

13
Jul
2022
Genetic Diversity, Antimicrobial Resistance, and Virulence Factors of Enterococcus faecalis Isolates Obtained from Stool Samples of Hospitalized Patients

Genetic Diversity, Antimicrobial Resistance, and Virulence Factors of Enterococcus faecalis Isolates Obtained from Stool Samples of Hospitalized Patients

Mitra Motallebi,
Zahra Sadat Seyyedi,
Mohammad Javad Azadchehr

Motallebi M, Seyyedi ZS, Azadchehr MJ. Genetic Diversity, Antimicrobial Resistance, and Virulence Factors of Enterococcus faecalis Isolates Obtained from Stool Samples of Hospitalized Patients. Jundishapur J Microbiol. 2022;15(6):e121379. doi: https://doi.org/10.5812/jjm-121379

1
Oct
2013

Antibiotic Resistance of Isolated Gram Negative Bacteria From Urinary Tract Infections (UTIs) in Isfahan

Mahsa Mirzarazi,
Seyedeh Elham Rezatofighi,
Mahdi Pourmahdi,
Mohamad Reza Mohajeri

Mirzarazi M, Rezatofighi SE, Pourmahdi M, Mohajeri MR. Antibiotic Resistance of Isolated Gram Negative Bacteria From Urinary Tract Infections (UTIs) in Isfahan. Jundishapur J Microbiol. 2013;6(8):e6883. doi: https://doi.org/10.5812/jjm.6883

7
Sep
2017

Community Acquired Urinary Tract Infections’ Etiological Organisms and Antibiotics Susceptibility Patterns

Hossein Keyhan,
Sepideh Sedighi,
Behruz Mashayekhi,
Mehrnoush Fathi,
Majeed Mokhtari

Keyhan H, Sedighi S, Mashayekhi B, Fathi M, Mokhtari M. Community Acquired Urinary Tract Infections’ Etiological Organisms and Antibiotics Susceptibility Patterns. Nephro-Urol Mon. 2017;9(5):e62146. doi: https://doi.org/10.5812/numonthly.62146

More by these authors

Marjan RashidanPubMedScholar
Zohreh GhalavandPubMedScholar
Gita EslamiPubMedScholar
Latif GachkarPubMedScholar
Mohammad RahbarPubMedScholar
Ronak KhosraviPubMedScholar
Ghazaleh GhandchiPubMedScholar
Fatemeh FallahPubMedScholar
Share
Cited by
Metrics