Quercetin Enhances the Suppressive Effects of Doxorubicin on the Migration of MDA-MB-231 Breast Cancer Cell Line

Author(s):
Mohammadreza  RoshanazadehMohammadreza Roshanazadeh1, Hossein  Babaahmadi RezaeiHossein Babaahmadi Rezaei2, Mojtaba RashidiMojtaba RashidiMojtaba Rashidi ORCID1,*
1Department of Clinical Biochemistry, Cellular and Molecular Research Center, Medical Basic Sciences Research Institution, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2Department of Clinical Biochemistry, Hyperlipidemia Research Center, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

International Journal of Cancer Management:Vol. 14, issue 11; e119049
Published online:Nov 27, 2021
Article type:Research Article
Received:Aug 31, 2021
Accepted:Nov 10, 2021
How to Cite:Roshanazadeh M, Babaahmadi Rezaei H, Rashidi M. Quercetin Enhances the Suppressive Effects of Doxorubicin on the Migration of MDA-MB-231 Breast Cancer Cell Line. Int J Cancer Manag. 2021;14(11):e119049. doi: https://doi.org/10.5812/ijcm.119049

Abstract

Background:

Cancer cell metastasis is facilitated by matrix-metalloproteinases through degradation of extracellular matrix (ECM) proteins and is a major cause of mortality. One of the most common remedies for cancer is chemotherapy, which has many side effects. Therefore, it seems necessary to find a way to reduce the side effects of these drugs while maintaining their anticancer effects. Quercetin (que) is a natural substance that has been reported to have anticancer activities.

Objectives:

This study aims at evaluating the effect of que in combination with doxorubicin (dox) on the migration of the MDA-MB-231 breast cancer cell line.

Methods:

The effects of que and dox on cell viability in 24h and 48 h was assessed by MTT assay. Also, the effects of the same drugs on the cancer cells migration were evaluated, using the wound healing assay. Lastly, the effects of que and dox were assessed on the expression of MMP-2 and MMP-9 genes.

Results:

The combination of 50 µM of que with 32 nM of dox was selected by CI comparison. The viability and migration of cancer cells and the gelatinases genes expression were decreased after treatment with individual drugs. The migration and the expression of MMP-2 and MMP-9 genes after treatment with the combination of que and dox was significantly reduced compared to the treatment with que and dox alone.

Conclusions:

Que inhibits the viability and migration of MDA-MB-231 cancer cells and synergistically enhances the effects of dox on the survival and migration of these cells. Hence, we propose this drug combination as a path for further research on breast cancer therapy.

1. Background

Triple-negative breast cancer (TNBC) is the most lethal subtype of breast cancer and the hardest type to cure (1). Metastasis vastly increases the fatality of cancer (2, 3). Tumor cells need to degrade the extracellular matrix (ECM) protein to successfully metastasize (4). It has been shown that the MMP-2 and -9 enzymes play a major role in cancer cell metastasis through ECM degradation (5, 6).
As the most common way to confront cancer, chemotherapy has various adverse effects on normal organs (7). Therefore, researchers consider using natural compounds with anticancer effects as an alternative or additional therapies for cancer (8, 9).
Doxorubicin (dox) is a glycoside antibiotic that is widely used for breast cancer treatment (10). It acts through various mechanisms that lead to the impairment of DNA replication (11, 12). However, the exact molecular mechanisms of dox that affect the expression of different genes are not clear yet. It has been observed that dox shows synergistic effects with natural compounds in various cancers (13, 14).
Quercetin (que) is a flavonol that is found in various plants. The anticancer effects of que are mostly related to its anti-inflammatory capabilities. The results of previous studies show that que inhibits the activity of significant signaling pathways such as PI3K-AKT and ERK pathways, which have regulating role in the expression of MMP enzymes. This leads to downregulation of several genes, including MMP-2 and -9 through inhibition of the NF-kB pathway as a downstream of PI3K-AKT and ERK pathways (15, 16). It has been observed that que synergizes with some chemotherapeutic agents in different types of cancer (17, 18). Nevertheless, the effects of que in combination with dox on metastatic breast cancer cells’ migration are not yet clear.

2. Objectives

This study investigates the effects of que alone and combined with dox on the migration of the MDA-MB-231 breast cancer cell line and the expression of MMP-2 and MMP-9 genes in vitro.

3. Methods

3.1. Cell Culture and Reagents

TNBC cell line MDA-MB-231 and normal human lung fibroblast cell line MRC5, which grow properly in low glucose (4.5 g/L) DMEM, 10% FBS, and 1% penicillin/streptomycin antibiotics (purchased from Bio-Idea Tehran, Iran) and in an incubator with 5% CO2 and 37°C, were purchased from the Pasteur Institute (Tehran, Iran).

3.2. Treatments

Dox (Ebewe pharma, Unteracht, Austria) with 2 mg/mL concentration was directly diluted in medium to obtain the desired concentrations. Que (Sigma-Aldrich, St. Louis, Missouri, United States) was prepared before treatment through dilution in DMSO (Bio-Idea) and was, then, diluted in the culture medium. The concentration of DMSO was constantly maintained at < 0.1% so as not to affect the viability of the cells (19).

3.3. Cell Viability Assay (MTT)

Cell viability was assessed by MTT assay. MDA-MB-231 (4 × 103 cells per well) and MRC5 (104 cells per well) cells in 96-well plates were treated with que (25, 50, 200, 350, 500, and 650 μM) and dox (2, 8, 32, 128, 512, and 2000 nM) for either 24 or 48 hours. Optical density at 570 nM was read for each well using a microplate reader (BioTek ELx800 Winooski, Vermont, United States). The IC50 value was obtained, using Curve Expert 1.3. SI was calculated for drugs, using the following formula: SI = IC50 of normal cells/IC50 of cancer cells. The SI values > 1 show the drug has more effects on cancer cells compared to normal ones (20, 21).

3.4. CI and DRI Calculation

Drug synergism was evaluated, using the Combination Index (CI) value. CI > 1, CI < 1, and CI = 1 represent antagonism, synergy, and additive effects, respectively. Dose reduction index (DRI) value was calculated, using CompuSyn 1.0 software (Chou and Martin, 2005, CompuSyn Inc, USA) to determine the magnitude of drug dose reductions (22).

3.5. Wound Healing Assay

Cancer cells (106) with about 80% confluency in 6-well plates were wounded, using a sterile 200 μL pipette tip and, then, washed with PBS to remove detached cells. The cells were supplemented with the medium containing drugs and 4% FBS and, then, incubated for 48 h. The wounds were photographed at 0, 24, and 48 h. The gap areas were measured, using Image J software (National Institutes of Health, Bethesda, USA). Migration rate was calculated, using the following formula:
Migration rate = [(T0 – Th)/T0] × 100 (23)

3.6. Total RNA Extraction and cDNA Synthesis

A total of 106 cells were used for RNA extraction, using a Hybrid-R RNA extraction kit (GeneAll, Songpa-gu, Seoul, South Korea). RNA purity and integrity were evaluated, using A260/A280 ratio and agarose gel electrophoresis, respectively. The cDNA synthesis kit (Yekta Tajhiz Azma, Tehran, Iran) with a 20 μL mixture solution was used for cDNA synthesis.

3.7. Real-time qPCR

MMP-2 and -9 genes expression were evaluated by Real-time qPCR, using SYBR green kit (Yekta Tajhiz Azma, Tehran, Iran) with the following primers:
(1) MMP-2
F: 5’-CCCAGCCAGAAGCGGAAA-3’
R: 5’- CGAACAGATGCCACAATAAAGC-3’
(2) MMP-9
F: 5’-CCTTTGGACACGCACGAC-3’
R: 5’-CCACCTGGTTCAACTCACTC-3’
(3) HPRT
F: 5’ GACCAGTCAACAGGGGACAT 3’
R: 5’ CCTGACCAAGGAAAGCAAAG 3’
The HPRT was selected as the internal reference gene. The amplified fragments length of MMP-2, MMP-9, and HPRT genes were 198, 103, and 132 base pairs, respectively. The reaction conditions were as follows: 95˚C for 3 min; 95˚C for 10 sec, 59˚C for 10 sec, 72˚C for 20 sec for 40 cycles; 72˚C for 5 min (23).

3.8. Statistical Analysis

All data were reported as mean ± SEM of 3 separate tests. SPSS 26.0 software (IBM, SPSS Inc.) was used for statistical analysis. The results of different experimental groups were compared to each other, using One-way ANOVA and LSD post-hoc tests with P-values less than 0.05 considered significant.

4. Results

4.1. Quercetin Enhances the Effect of Dox on Cancer Cell Viability

Cells were treated with various concentrations of que and dox for either 24 or 48 hours. Figures 1A and B show that que and dox inhibited the cancer cell viability significantly. Figures 1C and D show the effects of que and dox on normal cells, respectively. SI values represented in Table 1 show high inhibitory effects of que on cancer cells and higher adverse effects of dox on normal cells. According to Figure 2, all combination states significantly reduced the viability of cancer cells compared to each drug alone. As shown in Table 2, the CI values for all combination states were below 1, which indicates that que and dox synergize in all concentrations. We chose the combination state with the lowest CI (0.36) (50 μM of que and 32 nM of dox) for the rest of the study. The DRI value for this combination state was 5.7, which showed a 5-time reduction in dox dose (results not shown). Eventually, Figure 3 shows that the selected combination state had no significant effects on the normal cells.
The effects of quercetin and doxorubicin on the viability of MDA-MB-231 and MRC5 cell line through MTT assay. (A) The effects of different concentrations of quercetin on MDA-MB-231 cell viability in 24 and 48 h. (B) The effects of different concentrations of doxorubicin on MDA-MB-231 cell viability in 24 and 48 h. (C) The effects of different concentrations of quercetin on MRC5 cell viability in 24 and 48 h. (D) The effects of different concentrations of doxorubicin on MRC5 cell viability in 24 and 48 h. The results are presented as mean ± SEM of at least 3 independent experiments *P &lt; 0.05; **P &lt; 0.01; ***P &lt; 0.001 significant from control untreated cells.
Figure 1.

The effects of quercetin and doxorubicin on the viability of MDA-MB-231 and MRC5 cell line through MTT assay. (A) The effects of different concentrations of quercetin on MDA-MB-231 cell viability in 24 and 48 h. (B) The effects of different concentrations of doxorubicin on MDA-MB-231 cell viability in 24 and 48 h. (C) The effects of different concentrations of quercetin on MRC5 cell viability in 24 and 48 h. (D) The effects of different concentrations of doxorubicin on MRC5 cell viability in 24 and 48 h. The results are presented as mean ± SEM of at least 3 independent experiments *P < 0.05; **P < 0.01; ***P < 0.001 significant from control untreated cells.

Table 1.Selectivity Index (SI) of Quercetin and Doxorubicin for MDA-MB-231 and MRC5 Cell Lines
Cell LineIC50
Dox (nM)Que (µM)
MDA-MB-231640295
MRC5540 > 1000
SI0.84 > 3.39
The effects of combinations of quercetin and doxorubicin on the viability of MDA-MB-231 cells through MTT assay. (A) Viability of MDA-MB-231 cells after treatment with quercetin (50 and 200 μM) combined with doxorubicin (2, 8, and 32 nM) for 24h. (B) Viability of MDA-MB-231 cells after treatment with quercetin (50 and 200 μM) combined with doxorubicin (2, 8, and 32 nM) for 48 h. The results are presented as mean ± SEM of at least 3 independent experiments *P &lt; 0.05; **P &lt; 0.01; ***P &lt; 0.001 significant from control untreated cells, and #P &lt; 0.05; ## P &lt; 0.01 significant from doxorubicin -alone treated cells.
Figure 2.

The effects of combinations of quercetin and doxorubicin on the viability of MDA-MB-231 cells through MTT assay. (A) Viability of MDA-MB-231 cells after treatment with quercetin (50 and 200 μM) combined with doxorubicin (2, 8, and 32 nM) for 24h. (B) Viability of MDA-MB-231 cells after treatment with quercetin (50 and 200 μM) combined with doxorubicin (2, 8, and 32 nM) for 48 h. The results are presented as mean ± SEM of at least 3 independent experiments *P < 0.05; **P < 0.01; ***P < 0.001 significant from control untreated cells, and #P < 0.05; ## P < 0.01 significant from doxorubicin -alone treated cells.

Table 2.Combination Index (CI) Values Were Determined for Various Combinations of Quercetin and Doxorubicin. CI > 1 Antagonism; CI = 1 Additive; CI < 1 Synergistic Effect Between Drugs
Dox (nM)Que (µM)CI
2500.4
8500.38
32500.36
22000.88
82000.82
322000.65
Effects of quercetin and doxorubicin alone and in combination on the viability of MRC5 cell line through MTT assay. MRC5 cells were treated with the combination of quercetin (50 μM) and doxorubicin (32 nM). The results are presented as mean ± SEM of at least 3 independent experiments.
Figure 3.

Effects of quercetin and doxorubicin alone and in combination on the viability of MRC5 cell line through MTT assay. MRC5 cells were treated with the combination of quercetin (50 μM) and doxorubicin (32 nM). The results are presented as mean ± SEM of at least 3 independent experiments.

4.2. Que Synergizes with Dox on Inhibition of Cancer Cell Migration

Cancer cells were treated with 50 µM of que and 32 nM of dox alone and in combination for 48 h. Figure 4 shows that both que and dox significantly reduced the migration of cancer cells to 92.5% and 76%, respectively. Besides, after treatment with the selected combination state, cancer cell migration was reduced to 50%, which shows a significant reduction compared to individual drugs.
Wound healing assay of MDA-MB-231 breast cancer cell line treated with doxorubicin and quercetin. (A) Image of MDA-MB-231 cells migration following treatment with quercetin (50 μM), doxorubicin (32 nM), and their combination for 48 h. (B) Quantitative analysis of the anti-migratory effect of quercetin (50 μM), doxorubicin (32 nM), and their combination for 48 h. The results are presented as mean ± SEM of at least 3 independent experiments **P &lt; 0.01; ***P &lt; 0.001 significant from control untreated cells, and ### P &lt; 0.001 significant from doxorubicin -alone treated cells.
Figure 4.

Wound healing assay of MDA-MB-231 breast cancer cell line treated with doxorubicin and quercetin. (A) Image of MDA-MB-231 cells migration following treatment with quercetin (50 μM), doxorubicin (32 nM), and their combination for 48 h. (B) Quantitative analysis of the anti-migratory effect of quercetin (50 μM), doxorubicin (32 nM), and their combination for 48 h. The results are presented as mean ± SEM of at least 3 independent experiments **P < 0.01; ***P < 0.001 significant from control untreated cells, and ### P < 0.001 significant from doxorubicin -alone treated cells.

4.3. Que Enhanced the Effects of Dox on the Expression of MMP-2 and MMP-9 Genes

MDA-MB231 cells were treated with 50 µM of que and 32 nM of dox alone and in combination (50 µM que + 32 nM dox) for 48 h. Figure 5A shows that que and dox reduced the expression of the MMP-2 gene to 0.8 and 0.88 fold, respectively. Also, after treatment with the selected combination state, the expression of the MMP-2 gene was reduced to 0.57 fold. According to Figure 5B, the expression of the MMP-9 gene was decreased by que and dox to 0.77 and 0.82 fold, respectively, while when treated with the selected combination state, it was decreased to 0.52 fold, which suggests a synergistic effect between que and dox on the expression of MMP-2 and MMP-9 genes.
Quercetin enhanced the effect of doxorubicin on the matrix metalloproteinase-2 and matrix metalloproteinase-9 genes expression in the MDA-MB-231 breast cancer cell line. (A) The expression of the <i>MMP-2</i> gene was evaluated in MDA-MB-231 untreated control, treated with quercetin (50 μM), doxorubicin (32 nM), and the combination of quercetin plus doxorubicin using real-time qPCR. (B) Expression of <i>MMP-9</i> gene was evaluated in MDA-MB-231 untreated control, treated with quercetin (50 μM), doxorubicin (32 nM), and the combination of quercetin plus doxorubicin using quantitative real-time PCR. The results are presented as mean ± SEM of at least 3 independent experiments ***P &lt; 0.001 significant from control untreated cells, and ###P &lt; 0.001 significant from doxorubicin -alone treated cells.
Figure 5.

Quercetin enhanced the effect of doxorubicin on the matrix metalloproteinase-2 and matrix metalloproteinase-9 genes expression in the MDA-MB-231 breast cancer cell line. (A) The expression of the MMP-2 gene was evaluated in MDA-MB-231 untreated control, treated with quercetin (50 μM), doxorubicin (32 nM), and the combination of quercetin plus doxorubicin using real-time qPCR. (B) Expression of MMP-9 gene was evaluated in MDA-MB-231 untreated control, treated with quercetin (50 μM), doxorubicin (32 nM), and the combination of quercetin plus doxorubicin using quantitative real-time PCR. The results are presented as mean ± SEM of at least 3 independent experiments ***P < 0.001 significant from control untreated cells, and ###P < 0.001 significant from doxorubicin -alone treated cells.

5. Discussion

We investigated the effects of que as a natural substance in combination with the chemotherapeutic drug dox on the viability and migration of MDA-MB-231 breast cancer cells. Our results showed a synergistic suppressive effect between que and dox on the viability and migration of cancer cells.
The MTT assay results showed that que and dox individually decrease the viability of cancer cells. The cancer cell viability was significantly decreased when treated with the combination of que and dox compared to each drug alone, showing a synergistic effect between que and dox on cancer cell viability. The combination of 50 µM of que with 32 nM of dox with the lowest CI (0.36) and the highest synergy level was selected for the rest of the study, which had no significant effects on normal cells. According to our SI results, que had a more prominent impact on the viability of cancer cells rather than the normal cells. However, the same doses of dox have inhibited the normal cell rather than cancer cell viability. The difference could be due to the chemoresistance formed in cancer cells, which prevents dox from performing its inhibitory effects (24). On the other hand, the cytotoxic anticancer substances have a greater influence on more proliferative cells, which could be why que inhibits the proliferation of cancer cells more than normal cells (25). All DRI values were > 1, which indicates a reduced dose of dox in every combination state. According to our results, que enhances dox effects and simultaneously reduces its cytotoxicity on normal cells. It can be due to the antioxidant effects of que, which protects the cells against free radicals generated through dox activity (26). Also, the enhanced effects of dox in combination with que could be a result of the chemosensitizing ability of que, which impairs the cancer cell resistance to dox (18). Our results are in line with previous work on the synergistic effects of que in combination with chemotherapeutic agents and other natural compounds on the viability of cancer cells (27, 28).
The results of the wound healing assay showed that the migration of cancer cells treated with que and dox was reduced by 8% and 25% compared to the untreated control group. Also, the selected combination state reduced the cell migration to 50% compared to the control group and 42% and 25% compared to que and dox alone treated groups, respectively. These effects could be due to the dual role of que, which reduces the migration of cancer cells itself and increases the sensitivity of these cells to dox, thus enhancing the anti-migratory effects of dox (29, 30). These results are in agreement with previous studies about the effects of que alone and combined with other anticancer agents on cancer cell migration (31, 32).
The ability of que to alter the expression of different genes in normal and cancer cells has been studied. It is known that que has definitive impacts on important signaling pathways such as PI3K and ERK pathways, which finally lead to certain transcription factors (15, 16). The results of real-time PCR showed that que and dox reduced the expression of the MMP-2 gene to 0.8 and 0.88 fold, respectively, while the combination of que and dox decreased the MMP-2 gene expression to 0.57 fold, indicating a 23% and 31% reduction compared to the treatment with que and dox. After treatment with que and dox, the MMP-9 gene expression was reduced to 0.77 and 0.82 fold, respectively. However, the combination of que and dox reduced the expression of this gene to 0.51 fold, suggesting a reduction of 26% and 31% compared to the treatment with que and dox, respectively. Our results show that both que and dox can affect the migration of MDA-MB-231 cells by reducing metastasis-related genes expression and that que significantly enhances the inhibitory effects of dox on the expression of these genes. Our results agree with previous research on the inhibition of gelatinases gene expression by que and dox and the combination of these agents with different natural and chemotherapeutic agents (33, 34).

5.1. Conclusions

Our results suggest that que co-delivered with dox leads to a reduced dose of the chemotherapeutic drug, reducing its cytotoxicity on normal cells. Also, this combination can serve as a novel therapeutic agent in the inhibition of breast cancer metastasis. Nevertheless, this path needs further research to be more illuminated.

Footnotes

References

  • 1.
    Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394-424. [PubMed ID: 30207593]. https://doi.org/10.3322/caac.21492.
  • 2.
    Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59(4):225-49. [PubMed ID: 19474385]. https://doi.org/10.3322/caac.20006.
  • 3.
    Lord SJ, Kiely BE, Pearson SA, Daniels B, O'Connell DL, Beith J, et al. Metastatic breast cancer incidence, site and survival in Australia, 2001-2016: a population-based health record linkage study protocol. BMJ Open. 2019;9(2). e026414. [PubMed ID: 30709862]. [PubMed Central ID: PMC6367965]. https://doi.org/10.1136/bmjopen-2018-026414.
  • 4.
    Tryggvason K, Höyhtyä M, Salo T. Proteolytic degradation of extracellular matrix in tumor invasion. Biochim Biophys Acta Rev Cancer. 1987;907(3):191-217. https://doi.org/10.1016/0304-419x(87)90006-0.
  • 5.
    Mook OR, Frederiks WM, Van Noorden CJ. The role of gelatinases in colorectal cancer progression and metastasis. Biochim Biophys Acta. 2004;1705(2):69-89. [PubMed ID: 15588763]. https://doi.org/10.1016/j.bbcan.2004.09.006.
  • 6.
    Zucker S, Vacirca J. Role of matrix metalloproteinases (MMPs) in colorectal cancer. Cancer Metastasis Rev. 2004;23(1-2):101-17. [PubMed ID: 15000152]. https://doi.org/10.1023/a:1025867130437.
  • 7.
    Gustafson DL, Page RL. Withrow and MacEwen's small animal clinical oncology. Cancer chemotherapy. Elsevier; 2013. p. 157-79.
  • 8.
    Lin SR, Fu YS, Tsai MJ, Cheng H, Weng CF. Natural Compounds from Herbs that can Potentially Execute as Autophagy Inducers for Cancer Therapy. Int J Mol Sci. 2017;18(7):1412. [PubMed ID: 28671583]. [PubMed Central ID: PMC5535904]. https://doi.org/10.3390/ijms18071412.
  • 9.
    Wattanathamsan O, Hayakawa Y, Pongrakhananon V. Molecular mechanisms of natural compounds in cell death induction and sensitization to chemotherapeutic drugs in lung cancer. Phytother Res. 2019;33(10):2531-47. [PubMed ID: 31293008]. https://doi.org/10.1002/ptr.6422.
  • 10.
    Gabizon AA, Patil Y, La-Beck NM. New insights and evolving role of pegylated liposomal doxorubicin in cancer therapy. Drug Resist Updat. 2016;29:90-106. [PubMed ID: 27912846]. https://doi.org/10.1016/j.drup.2016.10.003.
  • 11.
    Cutts SM, Nudelman A, Rephaeli A, Phillips DR. The power and potential of doxorubicin-DNA adducts. IUBMB Life. 2005;57(2):73-81. [PubMed ID: 16036566]. https://doi.org/10.1080/15216540500079093.
  • 12.
    Bristow MR, Mason JW, Billingham ME, Daniels JR. Dose-effect and structure-function relationships in doxorubicin cardiomyopathy. Am Heart J. 1981;102(4):709-18. https://doi.org/10.1016/0002-8703(81)90096-x.
  • 13.
    Chen L, Ye HL, Zhang G, Yao WM, Chen XZ, Zhang FC, et al. Autophagy inhibition contributes to the synergistic interaction between EGCG and doxorubicin to kill the hepatoma Hep3B cells. PLoS One. 2014;9(1). e85771. [PubMed ID: 24465696]. [PubMed Central ID: PMC3897495]. https://doi.org/10.1371/journal.pone.0085771.
  • 14.
    Rezk YA, Balulad SS, Keller RS, Bennett JA. Use of resveratrol to improve the effectiveness of cisplatin and doxorubicin: study in human gynecologic cancer cell lines and in rodent heart. Am J Obstet Gynecol. 2006;194(5):e23-6. [PubMed ID: 16647892]. https://doi.org/10.1016/j.ajog.2005.11.030.
  • 15.
    Lee M, Yun S, Lee H, Yang J. Quercetin Mitigates Inflammatory Responses Induced by Vascular Endothelial Growth Factor in Mouse Retinal Photoreceptor Cells through Suppression of Nuclear Factor Kappa B. Int J Mol Sci. 2017;18(11):2497. [PubMed ID: 29165402]. [PubMed Central ID: PMC5713462]. https://doi.org/10.3390/ijms18112497.
  • 16.
    Vijayababu MR, Arunkumar A, Kanagaraj P, Venkataraman P, Krishnamoorthy G, Arunakaran J. Quercetin downregulates matrix metalloproteinases 2 and 9 proteins expression in prostate cancer cells (PC-3). Mol Cell Biochem. 2006;287(1-2):109-16. [PubMed ID: 16645725]. https://doi.org/10.1007/s11010-005-9085-3.
  • 17.
    Dai W, Gao Q, Qiu J, Yuan J, Wu G, Shen G. Quercetin induces apoptosis and enhances 5-FU therapeutic efficacy in hepatocellular carcinoma. Tumour Biol. 2016;37(5):6307-13. [PubMed ID: 26628295]. https://doi.org/10.1007/s13277-015-4501-0.
  • 18.
    Sharma H, Sen S, Singh N. Molecular pathways in the chemosensitization of cisplatin by quercetin in human head and neck cancer. Cancer Biol Ther. 2005;4(9):949-55. [PubMed ID: 16082193]. https://doi.org/10.4161/cbt.4.9.1908.
  • 19.
    Nguyen TT, Tran E, Nguyen TH, Do PT, Huynh TH, Huynh H. The role of activated MEK-ERK pathway in quercetin-induced growth inhibition and apoptosis in A549 lung cancer cells. Carcinogenesis. 2004;25(5):647-59. [PubMed ID: 14688022]. https://doi.org/10.1093/carcin/bgh052.
  • 20.
    Da'i M, Meilinasary KA, Suhendi A, Haryanti S. Selectivity Index of Alpinia galanga Extract and 1’-Acetoxychavicol Acetate on Cancer Cell Lines. Indones J Cancer Chemoprevention. 2019;10(2):95-100. https://doi.org/10.14499/indonesianjcanchemoprev10iss2pp95-100.
  • 21.
    van Meerloo J, Kaspers GJ. Cancer cell culture. Cell Sensitivity Assays: The MTT Assay. Springer; 2011. p. 237-45.
  • 22.
    Banerjee V, Sharda N, Huse J, Singh D, Sokolov D, Czinn SJ, et al. Synergistic potential of dual andrographolide and melatonin targeting of metastatic colon cancer cells: Using the Chou-Talalay combination index method. Eur J Pharmacol. 2021;897:173919. [PubMed ID: 33577837]. https://doi.org/10.1016/j.ejphar.2021.173919.
  • 23.
    Ahmadiankia N, Moghaddam HK, Mishan MA, Bahrami AR, Naderi-Meshkin H, Bidkhori HR, et al. Berberine suppresses migration of MCF-7 breast cancer cells through down-regulation of chemokine receptors. Iran J Basic Med Sci. 2016;19(2):125.
  • 24.
    Lyons JM, Abergel J, Thomson JL, Anthony CT, Wang YZ, Anthony LB, et al. In vitro chemoresistance testing in well-differentiated carcinoid tumors. Ann Surg Oncol. 2009;16(3):649-55. [PubMed ID: 19130141]. https://doi.org/10.1245/s10434-008-0261-z.
  • 25.
    Mitchison TJ. The proliferation rate paradox in antimitotic chemotherapy. Mol Biol Cell. 2012;23(1):1-6. [PubMed ID: 22210845]. [PubMed Central ID: PMC3248889]. https://doi.org/10.1091/mbc.E10-04-0335.
  • 26.
    Chen JY, Hu RY, Chou HC. Quercetin-induced cardioprotection against doxorubicin cytotoxicity. J Biomed Sci. 2013;20(1):1-11. [PubMed ID: 24359494]. [PubMed Central ID: PMC3898810]. https://doi.org/10.1186/1423-0127-20-95.
  • 27.
    Del Follo-Martinez A, Banerjee N, Li X, Safe S, Mertens-Talcott S. Resveratrol and quercetin in combination have anticancer activity in colon cancer cells and repress oncogenic microRNA-27a. Nutr Cancer. 2013;65(3):494-504. [PubMed ID: 23530649]. https://doi.org/10.1080/01635581.2012.725194.
  • 28.
    Lei CS, Hou YC, Pai MH, Lin MT, Yeh SL. Effects of quercetin combined with anticancer drugs on metastasis-associated factors of gastric cancer cells: in vitro and in vivo studies. J Nutr Biochem. 2018;51:105-13. [PubMed ID: 29125991]. https://doi.org/10.1016/j.jnutbio.2017.09.011.
  • 29.
    Liu Y, Tang ZG, Lin Y, Qu XG, Lv W, Wang GB, et al. Effects of quercetin on proliferation and migration of human glioblastoma U251 cells. Biomed Pharmacother. 2017;92:33-8. [PubMed ID: 28528183]. https://doi.org/10.1016/j.biopha.2017.05.044.
  • 30.
    Sun S, Gong F, Liu P, Miao Q. Metformin combined with quercetin synergistically repressed prostate cancer cells via inhibition of VEGF/PI3K/Akt signaling pathway. Gene. 2018;664:50-7. [PubMed ID: 29678660]. https://doi.org/10.1016/j.gene.2018.04.045.
  • 31.
    Erdogan S, Turkekul K, Dibirdik I, Doganlar O, Doganlar ZB, Bilir A, et al. Midkine downregulation increases the efficacy of quercetin on prostate cancer stem cell survival and migration through PI3K/AKT and MAPK/ERK pathway. Biomed Pharmacother. 2018;107:793-805. [PubMed ID: 30142541]. https://doi.org/10.1016/j.biopha.2018.08.061.
  • 32.
    Xu W, Xie S, Chen X, Pan S, Qian H, Zhu X. Effects of Quercetin on the Efficacy of Various Chemotherapeutic Drugs in Cervical Cancer Cells. Drug Des Devel Ther. 2021;15:577. [PubMed ID: 33623367]. [PubMed Central ID: PMC7894806]. https://doi.org/10.2147/DDDT.S291865.
  • 33.
    Chuang CH, Yeh CL, Yeh SL, Lin ES, Wang LY, Wang YH. Quercetin metabolites inhibit MMP-2 expression in A549 lung cancer cells by PPAR-gamma associated mechanisms. J Nutr Biochem. 2016;33:45-53. [PubMed ID: 27260467]. https://doi.org/10.1016/j.jnutbio.2016.03.011.
  • 34.
    Pradhan SJ, Mishra R, Sharma P, Kundu GC. Quercetin and sulforaphane in combination suppress the progression of melanoma through the down-regulation of matrix metalloproteinase-9. Exp Ther Med. 2010;1(6):915-20. [PubMed ID: 22993618]. [PubMed Central ID: PMC3446732]. https://doi.org/10.3892/etm.2010.144.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles