Aspergillus Species and Human Papillomavirus Infections in Epithelial Tumors of Nasal and Paranasal Cavities

Author(s):
Ali Dehghani NazhvaniAli Dehghani NazhvaniAli Dehghani Nazhvani ORCID1, Ali FarhadiAli FarhadiAli Farhadi ORCID2, Parisa BadieeParisa Badiee3, Haleh KeshvariHaleh Keshvari4, Mohammad Javad AshrafMohammad Javad Ashraf5, Fatemeh PakdelFatemeh Pakdel6, Golnoush FarzinniaGolnoush Farzinnia7,*
1Department of Oral and Maxillofacial Pathology, Biomaterials Research Center, School of Dentistry, Shiraz University of Medical Sciences, Shiraz, Iran
2Division of Medical Biotechnology, Department of Medical Laboratory Sciences, School of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran
3Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
4Rajaee Hospital, Shiraz University of Medical Sciences, Shiraz, Iran
5Department of Pathology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
6Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
7Oral and Dental Disease Research Center, School of Dentistry, Shiraz University of Medical Sciences, Shiraz, Iran

International Journal of Cancer Management:Vol. 16, issue 1; e133155
Published online:Mar 26, 2023
Article type:Research Article
Received:Nov 14, 2022
Accepted:Jan 22, 2023
How to Cite:Dehghani Nazhvani A, Farhadi A, Badiee P, Keshvari H, Ashraf MJ, et al. Aspergillus Species and Human Papillomavirus Infections in Epithelial Tumors of Nasal and Paranasal Cavities. Int J Cancer Manag. 2023;16(1):e133155. doi: https://doi.org/10.5812/ijcm-133155

Abstract

Background:

There are diverse lesions originating from the paranasal sinuses and nasal cavity. Tobacco use, alcohol consumption, and malnutrition have been identified to play a role in the development of head and neck carcinomas. Recently, fungi and viruses have been recognized as potential causes of nasal cavity and paranasal tumors.

Objectives:

This study aimed at specifying the prevalence of Aspergillus and human papillomavirus (HPV) infections in the epithelial tumors of nasal cavity and paranasal sinuses.

Methods:

In this cross-sectional study, 57 paraffin-embedded tissue samples of malignant and benign lesions of the paranasal sinuses and nasal cavity were evaluated for the presence of Aspergillus and HPV DNA by nested polymerase chain reaction (nPCR) technique with specific primers.

Results:

Despite the absence of angular hyphae (acute angle) of the fungus on histopathological slides, overall, 10 (17.54%) out of 57 paraffin-embedded samples were found to be positive for Aspergillus species. However, HPV-DNA was not found in any of the samples.

Conclusions:

Our data suggest that fungal infections (especially aspergillosis) as an etiological factor can be contributed to the development of sinonasal cancer and, therefore, they should be considered in the management of patients with sinonasal cancer. In addition, PCR can provide an alternative to culture-dependent identification methods.

1. Background

Lesions in the paranasal sinuses (sphenoid, frontal, ethmoid, and maxillary sinuses) and nasal cavity are mucosal protrusions, which can be classified as malignant and benign tumors. Malignancies of the sinonasal tract account for 3% of all cancers arising from the upper respiratory tract and 1% of all human tumors (1). Occupational exposures, particularly wood dust, have been listed as the major risk factors for sinonasal cancers (2, 3). However, tobacco smoking, a primary risk factor for carcinoma in most areas of the head and neck, has only shown a minor connection with sinonasal carcinoma (4).
Human papillomavirus (HPV) and Candida infection have been identified as the major etiological factors of head and neck carcinomas (5). In large cohort research, HPV infection was detected in 25% of head and neck squamous cell carcinoma (SCC) (6). Moreover, numerous reports have also discovered HPV in sinonasal tract malignancies. However, highly variable detection rates have cast doubt on HPV as a carcinogen at this location (ranging from 0 to 100%) (7-9). Similarly, the coexistence of fungal infections such as aspergillosis and malignancies has been observed in the thoracic cavity, maxillary sinus, and brain in several reports (10-12). A study by Hongal et al. (13) revealed a significant association between the higher grade of epithelial dysplasia and the presence of fungal hyphae in patients with oral potentially malignant disorders (OPMDs), including leukoplakia, lichen planus, and submucosal fibrosis.
Up to now, the clinical significance of Aspergillus and HPV infections in sinonasal carcinomas has not been established and insufficient data are available regarding these sinonasal carcinomas in Iran.

2. Objectives

Regarding the ability of some fungi to cause dysplastic changes, the presence of some fungi in a series of sinonasal neoplasms, and the role of HPV in the development of head and neck carcinoma, the present study aims at assessing the prevalence of Aspergillus and HPV infections in epithelial tumors of the paranasal sinuses and nasal cavity in an Iranian population by molecular methods.

3. Methods

This cross-sectional study was conducted on all formalin-fixed, paraffin-embedded (FFPE) tissue samples extracted from the epithelial tumors of the paranasal sinuses and nasal cavity. The samples were in the archives of Khalili Hospital and Oral and Maxillofacial Pathology Department, School of Dentistry, Shiraz University of Medical Sciences, Shiraz, Iran. The study was concordant with all relevant principles of the Helsinki Declaration and was approved by the Ethics Committee of Shiraz University of Medical Sciences, Shiraz, Iran (IR.SUMS.REC.1395.S877). Written informed consent was obtained from each participant.

3.1. Sample Preparation and DNA Extraction

Four sections of 5 μm thick were cut and collected in microcentrifuge tubes for each case. The QIAamp DNA FFPE tissue kit (Qiagen, Hilden, Germany) was used to extract genomic DNA from the FFPE tissue sections. The extracted DNA was, then, eluted with 50 ml ATE buffer and stored at -70°C. A NanoDrop (ND - 1000) spectrophotometer was used to measure the total amount of DNA (peQLab Biotechnologie, Erlangen, Germany). As indicated by Saiki et al. (14), the quality of the extracted DNA for each sample was assessed by polymerase chain reaction (PCR) amplification, using PC03, PC04, b-globin gene-specific primers, generating a 110 bp PCR product (Table 1). For further analyses, only b-globin-positive samples were included.
Table 1.The Sequence of Primers a
Primer NamesSequences (5’ to 3’)Product Size (bp)
PC03ACACAACTGTGTTCACTAGC110
PC04CAACTTCATCCACGTTCACC
AFU7S CGG CCC TTA AAT AGC CCG405
AFU7ASGA CCG GGT TTG ACC AAC TTT
AFU5S AGG GCC AGC GAG TAC ATC ACC TTG236
AFU5ASGG RGT CGT TGC CAA YYCC TGA
MY09GCMCAGGGWCATAAYAAYTGG452
MY11CGTCCMARRGGAWACTGATC
GP5+ TTTGTTACTGTGGTAGATACTAC140 – 150
GP6+GAAAAATAAACTGTAAATCATATTC
16E6F1CTGCGACGTGAGGTATATGACTTT405
16E6R1TTGTCTCTGGTTGCAAATCTAACA
16E6F2GGTCGGTGGACCGGTCGATG129
16E6R1TTGTCTCTGGTTGCAAATCTAACA
18E6F1CACTTCACTGCAAGACATAGA322
18E6R1GTTGTGAAATCGTCGTTTTTCA
18E6F2ATGCTGCATGCCATAAATGT139
18E6R2CACCGCAGGCACCTTATTA

a Degenerate base code: H = A, T, or C; M = A or C; R = A or G; V = G, A, or C; W = A or T; Y = T or C.

3.2. Detection of Aspergillus

Aspergillus DNA was evaluated by nested PCR (nPCR) with 2 sets of primers. It is worth mentioning that this type of PCR can identify all Aspergillus species. The first primers of Aspergillus species were AFU7S and AFU7AS (405 bp), and the second primers were AFU5S and AFU5AS (236 bp) (Table 1) (15). PCR was performed under the following conditions: 5 min at 94°C for the denaturation step, followed by 35 cycles of the 30s at 63°C, and 8 min at 72°C for the final extension step (16). The PCR products were visualized by electrophoresis on 2.5% agarose gel, and staining with ethidium bromide and UV light.

3.3. Detection of HPV

An nPCR assay using MY09/MY11 degenerated primer set followed by GP5+/GP6+ consensus primers was performed for the detection of 23 mucosotropic HPV genotypes, as previously described (Table 1) (17, 18). All the primers were custom synthesized by the Bioneer Company (Daejeon, Korea). Briefly, for the first round of PCR, 0.5 - 0.8 μg of purified DNA was added to Taq DNA Polymerase 2x Master Mix RED (Amplicon, Denmark) in a total volume of 20 μL containing 0.4 μM of each primer. Amplifications were performed in an MJ mini thermal cycler (Bio-Rad. Laboratories, USA) with the following conditions: 95ºC for 3 min, 40 cycles of 95ºC for 1 min, 55ºC for 1 min, and 72ºC for 1 min followed by a 10-min final extension at 72ºC. The secondary round of the assay was performed according to the touchdown PCR protocol described by Evans et al. (19). Briefly, 1 μL of the primary PCR product was added to the reaction mixture with the same primer and reagent concentrations. DNA was amplified through a touchdown PCR program consisting of initial denaturation for 3 min at 94ºC followed by 1 min at 94ºC, 1.5 min at 55ºC to 40ºC with 1.0ºC decrements, 1.5 min at 72ºC (16 cycles) continued for 1 min at 94ºC, 1.5 min at 40ºC, and 1.5 min at 72ºC for 25 additional cycles, and 5 min at 72ºC as the final extension step.
To reduce the possibility of missing an infection caused by the 2 most frequent oncogenic HPV types 16/18, a type-specific nPCR technique was performed for detecting each type. The primer sets used for detecting HPV-16 and -18 were, respectively, 16E6F1/16E6R1 and 18E6F1/18E6R1, as the outer primers for the primary round of nPCR, followed by 16E6F2/16E6R1 and 18E6F2/18E6R2 primers, as the inner primers for the secondary PCR (Table 1). PCR for both HPV-16 and -18 was carried out under the same reaction mixture concentrations and cycling conditions. Briefly, PCR was carried out, using 0.5 - 0.8 μg of the extracted DNA as the template, 0.5 μM of each primer, and Taq DNA Polymerase 2x Master Mix RED (Ampliqon, Denmark) in a total volume of 20 μL. The first cycle of PCR was preceded by a 3 min denaturation step followed by 40 cycles at 94ºC for 1 min, at 55ºC, and 72ºC for 1 min. The last cycle ended with a 7 min extension step at 72ºC. For the second round of the assay, the 20 μL PCR solution contained 1 μL of the first round PCR product as the template, 0.4 μM of each primer, and the reagents used for the first step. The parameters applied for programming the thermal cycler for 40 cycles included 3 min at 94ºC, 45 sec at 94ºC, 45 sec at 60ºC, 45 sec at 72ºC, and 5 min at 72ºC. The primers used in this study for the identification of HPV have been described by Farhadi et al. (20).

4. Results

A total of 57 available samples were analyzed in this research. The mean age of the patients was 52.14 ± 16.93 years (range: 19 - 87 years). The frequency of nasal cavity and paranasal sinuses specimens were 26 (45.61%) and 31 (54.39%), respectively. Among the cases, 29 (50.88%) were male and 28 (49.12%) were female. The frequency of various lesions of the sinonasal tract has been summarized in Table 2 based on the location of lesions and patients’ demographics.
Table 2.The Frequency of Various Lesions Based on Location and Patients’ Gender and Age
LesionsFrequency of LesionsAge (Mean ± SD)Gender (%)Location (%)
FemaleMaleNasal CavityParanasal Sinuses
Dysplasia1346 ± 16.306 (46.15)7 (53.85)7 (53.85)6 (46.15)
Melanoma1064.7 ± 11.116 (60)4 (40)5 (50)5 (50)
Undifferentiated carcinoma957.22 ± 18.475 (55.56)4 (44.44)4 (44.44)5 (55.56)
SCC559.80 ± 16.962 (40)3 (60)1 (20)4 (80)
Nasopharyngeal carcinoma535.40 ± 12.532 (40)3 (60)3 (60)2 (40)
Adenoid cystic carcinoma447.25 ± 1.782 (50)2 (50)2 (50)2 (50)
Papillary adenocarcinoma344.66 ± 2.3503 (100)3 (100)0
Mucoepidermoid carcinoma261 ± 21 (50)1 (50)02 (100)
Small cell neuroendocrine carcinoma254 ± 181 (50)1 (50)02 (100)
PLGA1741 (100)01 (100)0
Ameloblastoma1331 (100)001 (100)
CCOT14001 (100)01 (100)
Basal cell adenocarcinoma1361 (100)001 (100)
Total5752.14 ± 16.9328 (49.12)29 (50.88)26 (45.61)31 (54.39)

Abbreviations: SCC, squamous cell carcinoma; PLGA, polymorphous low-grade adenocarcinoma; CCOT, calcifying cystic odontogenic tumor.

According to the findings, HPV was not detected in any of the available samples. On the other hand, 10 cases (17.54%) were positive for Aspergillus, while the presence of any angular hyphae (acute angle) of the fungus was not confirmed on their histopathological slides. These samples included nasopharyngeal carcinoma (n = 4), undifferentiated carcinoma (n = 2), SCC (n = 1), calcifying cystic odontogenic tumor (CCOT) (n = 1), small cell neuroendocrine carcinoma (n = 1), and melanoma (n = 1). The demographic characteristics of the infected patients with Aspergillus and the location of lesions have been presented in Table 3.
Table 3.Location, Gender, and Age of Patients with Aspergillus-Positive Samples
LesionAgeSexLocation
Nasopharyngeal carcinoma44MSphenoidal sinus
Nasopharyngeal carcinoma37FNasal cavity
Nasopharyngeal carcinoma24MEthmoid sinus
Undifferentiated carcinoma30FNasal cavity
Small cell neuroendocrine carcinoma72MSphenoid sinus
SCC66MNasal cavity
CCOT40MMaxillary sinus
Nasopharyngeal carcinoma53MNasal cavity
Undifferentiated carcinoma78FParanasal sinusa
Melanoma61FNasal cavity

Abbreviations: SCC, squamous cell carcinoma; CCOT, calcifying cystic odontogenic tumor.

a The name of paranasal sinus has not been provided.

5. Discussion

The failure to identify the key etiologic factors has hampered efforts to understand, prevent, and cure sinonasal tract tumors. Evidence has indicated that cigarette smoking is not highly linked to carcinomas that originate from the sinonasal tract, despite other parts of the head and neck area, where carcinogenesis is predominantly related to tobacco use. Wood dust exposure has also contributed to a subgroup of sinonasal adenocarcinomas and is not responsible for the majority of carcinomas found in the area (2, 3). Thus, awareness of the etiological factors contributing to the development and spread of the disease can be helpful for the early diagnosis of the disease.
The possible role of HPV infection in sinonasal carcinomas has been extensively investigated and its prevalence has been reported to range from 0% to 100% (21-24). In a review study by Syrjänen (25), the involvement of HPV in sinonasal carcinomas was observed in a large number of investigations. Similarly, a review study of the related articles including 220 cases in 2005 - 2013 indicated that 39.7% of non-keratinizing SCCs, 3.4% of keratinizing SCCs, 41.7% of basaloid SCCs, 66.6% of adenosquamous carcinomas, and 6.5% of sinonasal undifferentiated carcinomas were the carriers of the high- risk HPV DNA (26). In the same line, in a meta-analysis conducted by Chang Sing Pang et al. (27), 60 eligible studies were reviewed and HPV prevalence rates ranged from 5.0% to 94.4%, with an overall HPV prevalence rate being estimated as 25.5%. This meta-analysis confirmed the causative role of HPV in a subset of sinonasal SCCs. In the current study, however, the nPCR with the GP5+/GP6+ and MY09/MY11 primer systems demonstrated that none of the samples were positive for HPV. These inconsistent results might be attributed to the differences in ethnicity, geographical region, HPV detection method, and sample size. Moreover, the current study included 57 biopsies of benign and malignant epithelial tumors of the sinonasal region, while most of the previous studies were conducted only on malignant lesions of this site.
Several molecular studies have found that the carcinogenic activities of the HPV oncogenes, E6 and E7, are primarily responsible for HPV-mediated carcinogenesis. E6 and E7 oncoproteins can induce the inactivation and degradation of the tumor suppressor p53 and the retinoblastoma family of proteins (pRb, p107, and p130), respectively (28). Cellular tumor suppressors, p53 and pRb are also involved in DNA repair, differentiation, apoptosis, senescence, and cell cycle progression (29, 30). Additionally, multiple reports have demonstrated that HPV can bind to specific receptors on the cell surface, including the a6 integrin and heparin sulfate proteoglycans (31, 32).
In the present study, an nPCR test was used to identify the Aspergillus fungus. Despite the absence of the angular hyphae (with acute angle) of Aspergillus fungi on the histopathological slides, 10 samples (17.54%) were positive for Aspergillus fungi. Thus, our findings indicated a relatively high prevalence of Aspergillus infection in sinonasal tumors and also suggested that males were mostly infected. Consistently, Shobana et al. (33) found 40 cases of fungal infections out of 2800 sinonasal tract specimens (1.43%). Among the cases, 77.5% were male and the most common type of fungal infection was aspergillosis (35%). The presence of Aspergillus fungi in nasal cavities and paranasal sinuses in multiple studies confirms the tendency of this opportunistic pathogen towards epithelial structures (12, 34, 35). Moreover, the coexistence of Aspergillus and SCCs in the maxillary sinus has been observed in 2 studies (12, 36). Besides, studies have reported that Aspergillus fumigatus can release proteases, which have a key role in cell desquamation, morphologic changes, and the production of cytokines such as IL-6 and IL-8 (37, 38). IL-6 and IL-8 levels are correlated to a higher tumor stage and lymph node metastasis (39). Aspergillus fumigatus also can produce a class of mycotoxins known as gliotoxins, which interact with numerous immune system cells involved in fungal infection resistance and inhibit critical neutrophil functions such as degranulation of myeloperoxidase activity, phagocytic activity, and production of reactive oxygen species (ROS) (40-42). Gliotoxin also promotes the apoptosis of dendritic cells and monocytes, thereby reducing antigen presentation, ROS production, cytokine production, and phagocytosis (43, 44). Overall, further studies are required to determine whether HPV and aspergillosis are contributed to the development of sinonasal carcinomas.

5.1. Conclusions

According to the findings of the current study, the possible role of fungal infections, especially aspergillosis, should be considered in the pathogenesis of malignant and benign tumors of the paranasal sinuses and nasal cavity. For better management of patients, the application of molecular methods to diagnose possible infections is recommended.

Acknowledgments

Footnotes

References

  • 1.
    Cardesa A, Alos L, Nadal A, Franchi A. Nasal cavity and paranasal sinuses. Pathol Head Neck. 2016. p. 49-127. https://doi.org/10.1007/978-3-662-49672-5_2.
  • 2.
    d'Errico A, Pasian S, Baratti A, Zanelli R, Alfonzo S, Gilardi L, et al. A case-control study on occupational risk factors for sino-nasal cancer. Occup Environ Med. 2009;66(7):448-55. [PubMed ID: 19153109]. [PubMed Central ID: PMC2693673]. https://doi.org/10.1136/oem.2008.041277.
  • 3.
    Luce D, Leclerc A, Begin D, Demers PA, Gerin M, Orlowski E, et al. Sinonasal cancer and occupational exposures: a pooled analysis of 12 case-control studies. Cancer Causes Control. 2002;13(2):147-57. [PubMed ID: 11936821]. https://doi.org/10.1023/a:1014350004255.
  • 4.
    Mannetje A', Kogevinas M, Luce D, Demers PA, Bgin D, Bolm-Audorff U, et al. Sinonasal cancer, occupation, and tobacco smoking in European women and men. American J Industrial Med. 1999;36(1):101-7. https://doi.org/10.1002/(sici)1097-0274(199907)36:1<101::Aid-ajim14>3.0.Co;2-a.
  • 5.
    Neville BW, Damm DD, Allen C, Chi AC. Oral and maxillofacial pathology. Amsterdam: Elsevier Health Sciences; 2015.
  • 6.
    Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, Wu L, et al. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst. 2000;92(9):709-20. [PubMed ID: 10793107]. https://doi.org/10.1093/jnci/92.9.709.
  • 7.
    Syrjanen S, Syrjanen K. HPV-associated benign squamous cell papillomas in the upper aero-digestive tract and their malignant potential. Viruses. 2021;13(8). [PubMed ID: 34452488]. [PubMed Central ID: PMC8402864]. https://doi.org/10.3390/v13081624.
  • 8.
    Cheung FM, Lau TW, Cheung LK, Li AS, Chow SK, Lo AW. Schneiderian papillomas and carcinomas: a retrospective study with special reference to p53 and p16 tumor suppressor gene expression and association with HPV. Ear Nose Throat J. 2010;89(10):E5-E12. [PubMed ID: 20981655]. https://doi.org/10.1177/014556131008901002.
  • 9.
    Jo VY, Mills SE, Stoler MH, Stelow EB. Papillary squamous cell carcinoma of the head and neck: frequent association with human papillomavirus infection and invasive carcinoma. Am J Surg Pathol. 2009;33(11):1720-4. [PubMed ID: 19745700]. https://doi.org/10.1097/PAS.0b013e3181b6d8e6.
  • 10.
    McGregor DH, Papasian CJ, Pierce PD. Aspergilloma within cavitating pulmonary adenocarcinoma. Am J Clin Pathol. 1989;91(1):100-3. [PubMed ID: 2642636]. https://doi.org/10.1093/ajcp/91.1.100.
  • 11.
    Ueda H, Motohiro A, Iwanaga T. Bronchogenic carcinoma following pulmonary aspergilloma. Thorac Cardiovasc Surg. 1997;45(5):261-2. [PubMed ID: 9402673]. https://doi.org/10.1055/s-2007-1013743.
  • 12.
    Byun J, Lee J, Rho G, Park B. Squamous cell carcinoma occurring with aspergillosis in the maxillary sinus: a case report and histological study. J Korean Assoc Oral Maxillofac Surg. 2010;36(2). https://doi.org/10.5125/jkaoms.2010.36.2.125.
  • 13.
    Hongal BP, Kulkarni VV, Deshmukh RS, Joshi PS, Karande PP, Shroff AS. Prevalence of fungal hyphae in potentially malignant lesions and conditions-does its occurrence play a role in epithelial dysplasia? J Oral Maxillofac Pathol. 2015;19(1):10-7. [PubMed ID: 26097300]. [PubMed Central ID: PMC4451646]. https://doi.org/10.4103/0973-029X.157193.
  • 14.
    Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239(4839):487-91. [PubMed ID: 2448875]. https://doi.org/10.1126/science.2448875.
  • 15.
    Skladny H, Buchheidt D, Baust C, Krieg-Schneider F, Seifarth W, Leib-Mosch C, et al. Specific detection of Aspergillus species in blood and bronchoalveolar lavage samples of immunocompromised patients by two-step PCR. J Clin Microbiol. 1999;37(12):3865-71. [PubMed ID: 10565898]. [PubMed Central ID: PMC85831]. https://doi.org/10.1128/JCM.37.12.3865-3871.1999.
  • 16.
    Badiee P, Gandomi B, Sabz G, Khodami B, Choopanizadeh M, Jafarian H. Evaluation of nested PCR in diagnosis of fungal rhinosinusitis. Iran J Microbiol. 2015;7(1):62-6. [PubMed ID: 26644876]. [PubMed Central ID: PMC4670470].
  • 17.
    de Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol. 1995;76 ( Pt 4):1057-62. [PubMed ID: 9049358]. https://doi.org/10.1099/0022-1317-76-4-1057.
  • 18.
    Manos MM, Ting Y, Wright DK, Lewis J, Broker TR, Wolinsky SM. The use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells. 1989;7:209-14.
  • 19.
    Evans MF, Adamson CS, Simmons-Arnold L, Cooper K. Touchdown General Primer (GP5+/GP6+) PCR and optimized sample DNA concentration support the sensitive detection of human papillomavirus. BMC Clin Pathol. 2005;5:10. [PubMed ID: 16288661]. [PubMed Central ID: PMC1314887]. https://doi.org/10.1186/1472-6890-5-10.
  • 20.
    Farhadi A, Behzad-Behbahani A, Geramizadeh B, Sekawi Z, Rahsaz M, Sharifzadeh S. High-risk human papillomavirus infection in different histological subtypes of renal cell carcinoma. J Med Virol. 2014;86(7):1134-44. [PubMed ID: 24700118]. https://doi.org/10.1002/jmv.23945.
  • 21.
    Chowdhury N, Alvi S, Kimura K, Tawfik O, Manna P, Beahm D, et al. Outcomes of HPV-related nasal squamous cell carcinoma. Laryngoscope. 2017;127(7):1600-3. [PubMed ID: 28271500]. https://doi.org/10.1002/lary.26477.
  • 22.
    Jiromaru R, Yamamoto H, Yasumatsu R, Hongo T, Nozaki Y, Hashimoto K, et al. HPV-related Sinonasal Carcinoma: Clinicopathologic Features, Diagnostic Utility of p16 and Rb Immunohistochemistry, and EGFR Copy Number Alteration. Am J Surg Pathol. 2020;44(3):305-15. [PubMed ID: 31743130]. https://doi.org/10.1097/PAS.0000000000001410.
  • 23.
    Quan H, Yan L, Wang S, Wang S. Clinical relevance and significance of programmed death-ligand 1 expression, tumor-infiltrating lymphocytes, and p16 status in sinonasal squamous cell carcinoma. Cancer Manag Res. 2019;11:4335-45. [PubMed ID: 31190998]. [PubMed Central ID: PMC6514258]. https://doi.org/10.2147/CMAR.S201568.
  • 24.
    Udager AM, McHugh JB, Goudsmit CM, Weigelin HC, Lim MS, Elenitoba-Johnson KSJ, et al. Human papillomavirus (HPV) and somatic EGFR mutations are essential, mutually exclusive oncogenic mechanisms for inverted sinonasal papillomas and associated sinonasal squamous cell carcinomas. Ann Oncol. 2018;29(2):466-71. [PubMed ID: 29145573]. [PubMed Central ID: PMC6248771]. https://doi.org/10.1093/annonc/mdx736.
  • 25.
    Syrjanen KJ. HPV infections in benign and malignant sinonasal lesions. J Clin Pathol. 2003;56(3):174-81. [PubMed ID: 12610092]. [PubMed Central ID: PMC1769909]. https://doi.org/10.1136/jcp.56.3.174.
  • 26.
    Lewis JJ, Westra WH, Thompson LD, Barnes L, Cardesa A, Hunt JL, et al. The sinonasal tract: another potential "hot spot" for carcinomas with transcriptionally-active human papillomavirus. Head Neck Pathol. 2014;8(3):241-9. [PubMed ID: 24338611]. [PubMed Central ID: PMC4126925]. https://doi.org/10.1007/s12105-013-0514-4.
  • 27.
    Chang Sing Pang KJW, Mur T, Collins L, Rao SR, Faden DL. Human Papillomavirus in Sinonasal Squamous Cell Carcinoma: A Systematic Review and Meta-Analysis. Cancers (Basel). 2020;13(1). [PubMed ID: 33561073]. [PubMed Central ID: PMC7796014]. https://doi.org/10.3390/cancers13010045.
  • 28.
    Gonzalez SL, Stremlau M, He X, Basile JR, Munger K. Degradation of the retinoblastoma tumor suppressor by the human papillomavirus type 16 E7 oncoprotein is important for functional inactivation and is separable from proteasomal degradation of E7. J Virol. 2001;75(16):7583-91. [PubMed ID: 11462030]. [PubMed Central ID: PMC114993]. https://doi.org/10.1128/JVI.75.16.7583-7591.2001.
  • 29.
    Burkhart DL, Sage J. Cellular mechanisms of tumour suppression by the retinoblastoma gene. Nat Rev Cancer. 2008;8(9):671-82. [PubMed ID: 18650841]. [PubMed Central ID: PMC6996492]. https://doi.org/10.1038/nrc2399.
  • 30.
    Fischer M. Census and evaluation of p53 target genes. Oncogene. 2017;36(28):3943-56. [PubMed ID: 28288132]. [PubMed Central ID: PMC5511239]. https://doi.org/10.1038/onc.2016.502.
  • 31.
    Giroglou T, Florin L, Schafer F, Streeck RE, Sapp M. Human papillomavirus infection requires cell surface heparan sulfate. J Virol. 2001;75(3):1565-70. [PubMed ID: 11152531]. [PubMed Central ID: PMC114064]. https://doi.org/10.1128/JVI.75.3.1565-1570.2001.
  • 32.
    Yoon CS, Kim KD, Park SN, Cheong SW. alpha(6) Integrin is the main receptor of human papillomavirus type 16 VLP. Biochem Biophys Res Commun. 2001;283(3):668-73. [PubMed ID: 11341777]. https://doi.org/10.1006/bbrc.2001.4838.
  • 33.
    Shobana B, Srismitha S, Karthik S, Manjani S. Histomorphological spectrum of fungal lesions in the sinonasal tract in a tertiary care hospital. Saudi J Pathol Microbiol. 2019;4(3):201-9.
  • 34.
    De Foer C, Fossion E, Vaillant JM. Sinus aspergillosis. J Craniomaxillofac Surg. 1990;18(1):33-40. [PubMed ID: 2406288]. https://doi.org/10.1016/s1010-5182(05)80601-8.
  • 35.
    Wu CW, Tai CF, Wang LF, Tsai KB, Kuo WR. Aspergillosis: a nidus of maxillary antrolith. Am J Otolaryngol. 2005;26(6):426-9. [PubMed ID: 16275418]. https://doi.org/10.1016/j.amjoto.2005.05.009.
  • 36.
    Tanaka T, Nishioka K, Naito M, Masuda Y, Ogura Y. Coexistence of aspergillosis and squamous-cell carcinoma in the maxillary sinus proven by preoperative cytology. Acta Cytol. 1985;29(1):73-8. [PubMed ID: 3855590].
  • 37.
    Borger P, Koeter GH, Timmerman JA, Vellenga E, Tomee JF, Kauffman HF. Proteases from Aspergillus fumigatus induce interleukin (IL)-6 and IL-8 production in airway epithelial cell lines by transcriptional mechanisms. J Infect Dis. 1999;180(4):1267-74. [PubMed ID: 10479157]. https://doi.org/10.1086/315027.
  • 38.
    Kauffman HF, Tomee JF, van de Riet MA, Timmerman AJ, Borger P. Protease-dependent activation of epithelial cells by fungal allergens leads to morphologic changes and cytokine production. J Allergy Clin Immunol. 2000;105(6 Pt 1):1185-93. [PubMed ID: 10856154]. https://doi.org/10.1067/mai.2000.106210.
  • 39.
    Ma Y, Ren Y, Dai ZJ, Wu CJ, Ji YH, Xu J. IL-6, IL-8 and TNF-alpha levels correlate with disease stage in breast cancer patients. Adv Clin Exp Med. 2017;26(3):421-6. [PubMed ID: 28791816]. https://doi.org/10.17219/acem/62120.
  • 40.
    Comera C, Andre K, Laffitte J, Collet X, Galtier P, Maridonneau-Parini I. Gliotoxin from Aspergillus fumigatus affects phagocytosis and the organization of the actin cytoskeleton by distinct signalling pathways in human neutrophils. Microbes Infect. 2007;9(1):47-54. [PubMed ID: 17196420]. https://doi.org/10.1016/j.micinf.2006.10.009.
  • 41.
    Orciuolo E, Stanzani M, Canestraro M, Galimberti S, Carulli G, Lewis R, et al. Effects of Aspergillus fumigatus gliotoxin and methylprednisolone on human neutrophils: implications for the pathogenesis of invasive aspergillosis. J Leukoc Biol. 2007;82(4):839-48. [PubMed ID: 17626149]. https://doi.org/10.1189/jlb.0207090.
  • 42.
    Slot DE, Wiggelinkhuizen L, Rosema NA, Van der Weijden GA. The efficacy of manual toothbrushes following a brushing exercise: a systematic review. Int J Dent Hyg. 2012;10(3):187-97. [PubMed ID: 22672101]. https://doi.org/10.1111/j.1601-5037.2012.00557.x.
  • 43.
    Kupfahl C, Geginat G, Hof H. Gliotoxin-mediated suppression of innate and adaptive immune functions directed against Listeria monocytogenes. Med Mycol. 2006;44(7):591-9. [PubMed ID: 17071552]. https://doi.org/10.1080/13693780600815411.
  • 44.
    Stanzani M, Orciuolo E, Lewis R, Kontoyiannis DP, Martins SL, St John LS, et al. Aspergillus fumigatus suppresses the human cellular immune response via gliotoxin-mediated apoptosis of monocytes. Blood. 2005;105(6):2258-65. [PubMed ID: 15546954]. https://doi.org/10.1182/blood-2004-09-3421.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles