Int J Cancer Manag

Image Credit:Int J Cancer Manag

Conditioned Media Derived from WJ-MSCs Enhanced the Inhibition Effect of EGCG on LNCaP Cells by Targeting Androgen Receptor and Apoptosis Pathway

Author(s):
Reihane MohammadiReihane Mohammadi1, Zahra FazeliZahra FazeliZahra Fazeli ORCID1,*, Azam DaraeiAzam Daraei2, Katayoon AsgariKatayoon Asgari2
1Department of Medical Genetics, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Clinical Biochemistry, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran

International Journal of Cancer Management:Vol. 18, issue 1; e160152
Published online:Mar 02, 2025
Article type:Research Article
Received:Feb 01, 2025
Accepted:Feb 19, 2025
How to Cite:Mohammadi R, Fazeli Z, Daraei A, Asgari K. Conditioned Media Derived from WJ-MSCs Enhanced the Inhibition Effect of EGCG on LNCaP Cells by Targeting Androgen Receptor and Apoptosis Pathway. Int J Cancer Manag. 2025;18(1):e160152. doi: https://doi.org/10.5812/ijcm-160152

Abstract

Background:

Although there are several approaches to treat prostate cancer (PCa), the cost and side effects of some treatments pose challenges for patients. Therefore, the design of new therapeutic methods could be useful in the management of this disease.

Objectives:

This study aimed to investigate the synergistic effect of epigallocatechin gallate (EGCG) and conditioned medium derived from Wharton's jelly mesenchymal stem cells (WJ-MSCs) on LNCaP cells.

Methods:

The LNCaP cells were treated with different concentrations of EGCG and conditioned medium derived from WJ-MSCs (WJCM). The viability of treated cells was determined using the MTT assay. The expression of androgen receptor (AR and PSA) and apoptotic pathway genes (BAX, CASP3, and CASP7) were evaluated in the treated cells.

Results:

The analysis indicated that treatment with 400 µM EGCG in combination with 50% WJCM (0% FBS) for 72 hours decreased the expression of AR and PSA genes and enhanced the expression of BAX, CASP3, and CASP7 genes in the LNCaP cells (P < 0.05).

Conclusions:

The results suggest that the combination therapy of EGCG and WJCM has an anticancer effect on LNCaP cells through the activation of the apoptotic pathway and suppression of the AR pathway.

1. Background

Prostate cancer (PCa) is known as the second most common cancer among men. The mortality rate of this cancer increases with age, and its incidence rate is reported to be almost 60% in men older than 65 years (1, 2). Although various methods have been suggested to treat PCa, recurrence and progression of the disease are eventually observed in most patients (3). Additionally, the cost and side effects of some therapeutic approaches present challenges for patients (4). Several studies indicate that more than 80% of prostate cancers are androgen-dependent at early stages (5). The androgen signaling pathway plays an important role in the development and function of the prostate (6). Although endocrine therapy is designed to suppress the function of the androgen receptor (AR) by eliminating serum androgens, recurrence of PCa is observed in most patients after androgen deprivation therapy, leading to hormone-refractory PCa (7). The AR is a crucial factor in the development of both androgen-independent and androgen-dependent prostate cancers (8).
Active compounds from herbs have been shown to be effective in treating cancers without toxic effects (9). Among them, epigallocatechin gallate (EGCG) has high antioxidant potential (10). Various studies have evaluated the effect of EGCG on apoptosis induction in several cancer cell lines (11, 12). The results indicate that this polyphenol compound can increase apoptosis in cancer cells through different signaling pathways (13, 14).
Currently, new and effective approaches have been designed to use mesenchymal stem cells (MSCs) and active compounds from herbs in the treatment of different cancers (15, 16). Evidence shows that MSCs affect different signaling pathways in cancer cells and inhibit tumor cell growth (17, 18). However, reports exist about the pleiotropic effects of MSCs on cancer progression. Several studies show that these cells can influence cancer progression and suppression through pro-tumor and anti-tumor effects, respectively (19). These contradictory results may depend on the origin, dose, and duration of MSC treatment (20). Among different types of MSCs, human Wharton's jelly mesenchymal stem cells (WJ-MSCs) have several advantages for use in treating various disorders. These cells exhibit an immune-privileged status, and there are no ethical concerns in obtaining them (21-24).

2. Objectives

The present study was performed to investigate the potential of a combination of EGCG and conditioned medium derived from WJ-MSCs (WJCM) on the LNCaP cell line.

3. Methods

3.1. Cell Culture

In the present study, LNCaP cells and WJ-MSCs were obtained from the Pasteur Institute and the Cell Bank of Royan Institute, respectively. These cells were cultured in a medium containing DMEM-F12 and 10% fetal bovine serum (FBS).

3.2. Preparation of Conditional Medium Derived from Wharton's Jelly Mesenchymal Stem Cells

The WJ-MSCs were cultured until they reached approximately 80% confluence. Then, DMEM-F12 medium containing 0% FBS and 10% FBS was used to incubate these cells at 5% CO₂ and 37°C. After 24 hours, the medium was centrifuged at 4200 g for 20 minutes. The obtained supernatant was frozen at -20°C.

3.3. Preparation of Epigallocatechin Gallate

The stock solution of EGCG (Sigma-Aldrich, St. Louis, MO, USA) was prepared at a concentration of 0.1 M by dissolving it in dimethyl sulfoxide (DMSO).

3.4. MTT Assay

After seeding on 96-well plates, LNCaP cells were incubated with different concentrations of EGCG and conditioned medium derived from WJ-MSCs (WJCM) for 48 hours and 72 hours. Then, 20 µL of MTT (5 mg/mL) was added to each well. After incubation for 3 hours, the supernatant of the wells was removed, and 150 µL of DMSO was added. The optical density (OD) was measured at 570 nm using a microplate reader. Each concentration was tested in at least three replicates. The percentage of cell viability was calculated as control group OD/experimental group OD × 100.

3.5. Real-time PCR Analysis

The expression of apoptotic and AR pathway genes was evaluated in LNCaP cells treated with EGCG and WJCM, with at least a 30% reduction in cell viability observed in the MTT assay. For this purpose, LNCaP cells were cultured in 12-well plates. After 24 hours, these cells were treated with the determined concentrations of EGCG and WJCM. RNA was then extracted from the cultured cells using the RiboEx Total RNA extraction kit (GeneAll Biotechnology, Korea) and treated with DNase I (Thermo Fisher Scientific, Vilnius, Lithuania). cDNA synthesis was performed according to the instructions of the cDNA synthesis kit (Yekta Tajhiz Azma, Iran). The quantification of gene expression was determined by SYBR Green real-time PCR. The reaction was prepared from diluted cDNA, RealQ Plus Master Mix Green (Ampliqon, Denmark), and 0.1 pM of forward and reverse primers (Table 1) in a total volume of 25 µL. HSP90AB1 was used as the reference gene. Duplicate reactions were performed on a Rotor-Gene 6000 with preheating at 95°C for 10 minutes, followed by 45 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. The specificity of the products was confirmed by melting curve analysis.
Table 1.Primer Sequences Used for Expression Analysis in the Present Study
PrimerSequence (5´-3´)Gen Bank Accession Number (Position)Product Size (bp)
HSP90AB1NM_001271971.2; (exon 2/exon 3)157
RGCGAATCTTGTCCAAGGCATCAG
FGGAAGTGCACCATGGAGAGGA
BAXNM_001291430.2; (exon 2/exon 3)195
RTCACCCAACCACCCTGGTCTT
FTGGCAGCTGACATGTTTTCTGAC
CASP3NM_001354783.2; (exon 8)100
RATTCTGTTGCCACCTTTCGG
FTGGTTCATCCAGTCGCTTTG
CASP7NM_001227.5; (exon 7)108
RTCCCCTTGGCTGTGTTTTG
FGGAGAAAGCTCATGGCTGTGT
ARNM_001424175.1; (exon 4/exon 6)168
RGGACTTGTGCATGCGGTACTCA
FCCTGGCTTCCGCAACTTACAC
PSANM_001648.2; (exon 3/exon 5)161
RCCCCAGAATCACCCGAGCAG
FACCAGAGGAGTTCTTGACCCCAAA

3.6. Statistical Analysis

The pffafl method was used to determine the relative expression of the studied genes. Data analysis was done using t-test. The P value < 0.05 was considered to be significant. The mean value was calculated from three independent experiments.

4. Results

4.1. Cell Viability Assessment

The results indicated that EGCG concentrations less than 200 µM had no noticeable effect on the viability of LNCaP cells. Cell viability decreased by approximately 30% in cells treated with 200 - 500 µM concentrations of EGCG for 72 hours (Figure 1A). The evaluation of cell proliferation assay results revealed no difference in the viability of LNCaP cells treated with WJCM compared with control cells (Figure 1B). Surprisingly, a decrease in viability of more than 30% was observed after treatment with different combinations of EGCG and WJCM for 48 hours and 72 hours (Figure 1C and D).
The results of cell proliferation assay following treatment of LNCaP cells with A, epigallocatechin gallate (EGCG); B, WJCM; C, EGCG+WJCM (0% FBS); and D, EGCG+WJCM (10% FBS) for 48 h and 72 h. Data were presented as mean of cell viability (%) ± SD (standard deviation) in the plus direction. * P &lt; 0.05, WJCM; conditioned medium derived from Wharton's jelly mesenchymal stem cells (WJ-MSCs)
Figure 1.

The results of cell proliferation assay following treatment of LNCaP cells with A, epigallocatechin gallate (EGCG); B, WJCM; C, EGCG+WJCM (0% FBS); and D, EGCG+WJCM (10% FBS) for 48 h and 72 h. Data were presented as mean of cell viability (%) ± SD (standard deviation) in the plus direction. * P < 0.05, WJCM; conditioned medium derived from Wharton's jelly mesenchymal stem cells (WJ-MSCs)

4.2. Real Time PCR Analysis

The expression of BAX, CASP3, and CASP7 genes significantly increased in LNCaP cells after treatment with 500 µM EGCG + 50% WJCM (0% FBS) for 48 hours, as well as 400 µM EGCG + 50% WJCM (0% FBS) and 500 µM EGCG + 20% WJCM (0% FBS) for 72 hours. Among these treatments, a significant decrease in the expression of AR and PSA genes was observed in LNCaP cells treated with 400 µM EGCG + 50% WJCM (0% FBS) for 72 hours (P < 0.05) (Figure 2).
The expression analysis of BAX, CASP3, CASP7, AR and PSA genes in the LNCaP cells treated by epigallocatechin gallate (EGCG) alone and its combination with WJCM for A, 48 h; and B, 72 h. Data was shown as mean of fold change ± SD (standard deviation). The mean fold of gene expression was defined to be 1 in the control cells (LNCaP cells treated by DMSO, data not shown). * P &lt; 0.05; WJCM, conditioned medium derived from Wharton's jelly mesenchymal stem cells (WJ-MSCs)
Figure 2.

The expression analysis of BAX, CASP3, CASP7, AR and PSA genes in the LNCaP cells treated by epigallocatechin gallate (EGCG) alone and its combination with WJCM for A, 48 h; and B, 72 h. Data was shown as mean of fold change ± SD (standard deviation). The mean fold of gene expression was defined to be 1 in the control cells (LNCaP cells treated by DMSO, data not shown). * P < 0.05; WJCM, conditioned medium derived from Wharton's jelly mesenchymal stem cells (WJ-MSCs)

5. Discussion

Various studies have been conducted to identify novel approaches for the treatment of PCa (25). In the present study, the effects of EGCG and WJCM were evaluated on the LNCaP cell line. The results from the proliferation assay indicated that treatment with high concentrations of EGCG (> 200 µM) for 72 hours significantly decreased the viability of LNCaP cells. The EGCG has been shown to reduce membrane fluidity through interaction with the LNCaP cell membrane (26). The EGCG exhibits anti-tumor activity by inhibiting proliferation, migration, and angiogenesis (27). Schroder et al. found that the viability of MCF-7 and MDA-MB-231 breast cancer cell lines decreased after treatment with EGCG concentrations greater than 45 µg/mL (28). However, the observed difference in minimum effective concentration may be explained by the different etiologies of breast and prostate cancers. Furthermore, the decreased viability of treated LNCaP cells was observed to be time-dependent at high EGCG concentrations (> 300 µM) (Figure 1A). These data are consistent with a previous study (26).
There are controversial reports about the role of MSCs in cancer treatment. Some researchers observed that treatment with MSCs was effective in cancer progression, while other studies indicated that these cells have the ability to suppress tumor growth (19). In the present study, the conditioned medium was prepared from WJ-MSCs. The conditioned medium has been demonstrated to contain various secreted growth factors (29). The results from the proliferation assay showed that WJCM had no effect on the viability of LNCaP cells. Previous evaluations of the effect of WJCM on tumor growth indicated that this medium has the potential to suppress growth in MDA-MB-231, TOV-112D, MG-63, HSC3, HepG2, PC3, SKOV3, and HeLa cancer cell lines (30). The inconsistency of the results obtained on LNCaP cells with others may be due to the distinct biological characteristics of different types of cancers (31).
Several studies have revealed that combination therapy is more effective than each agent alone. Adhami et al. evaluated the effect of EGCG and NS398 on cell lines and found that the combination of these two agents had a greater ability to decrease the viability of cancer cells compared with the effect of each agent alone (32). Lev-Ari et al. found similar results regarding the combination of curcumin and celecoxib on colorectal cancer cell lines (33). Consistent with previous studies, we found that the combination of EGCG and WJCM had a better effect on tumor suppression. In the present study, results from the proliferation assay showed that EGCG (300 - 500 µM) alone decreased the viability of LNCaP cells, but there was no significant increase in the expression of apoptosis genes in cells treated with these concentrations of EGCG. In contrast, the combination of EGCG and WJCM synergistically increased apoptosis in LNCaP cells compared with cells treated with EGCG alone.
The AR signaling pathway plays an important role in the progression and lethality of PCa (34). There is crosstalk between apoptotic and AR signaling pathways, and AR expression plays a dual role in the apoptosis of PCa cells. In some environmental conditions, AR positively induces apoptosis in PCa cells, while other studies indicate that downregulation of AR expression sensitizes PCa cells to apoptosis (35). Although treatment with EGCG (200 - 500 µM) for 72 hours was associated with decreased viability in LNCaP cells, expression analysis showed no upregulation of BAX, CASP3, and CASP7 genes and no downregulation of AR and PSA genes in the treated cells. However, 400 µM EGCG in combination with 50% WJCM (0% FBS) significantly increased the expression of apoptosis genes and decreased the expression of androgen signaling pathway genes in LNCaP cells, confirming the synergistic effect of combination therapy with EGCG and WJCM.

5.1. Conclusions

In the present study, our data suggest that the combination therapy of 400 µM EGCG and 50% WJCM (0% FBS) can suppress the growth of LNCaP cells. This combination strongly enhanced the expression of BAX, CASP3, and CASP7 genes and downregulated the expression of AR and PSA genes in LNCaP cells.

Footnotes

References

  • 1.
    Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49. [PubMed ID: 33538338]. https://doi.org/10.3322/caac.21660.
  • 2.
    Rawla P. Epidemiology of Prostate Cancer. World J Oncol. 2019;10(2):63-89. [PubMed ID: 31068988]. [PubMed Central ID: PMC6497009]. https://doi.org/10.14740/wjon1191.
  • 3.
    Sumanasuriya S, De Bono J. Treatment of Advanced Prostate Cancer-A Review of Current Therapies and Future Promise. Cold Spring Harb Perspect Med. 2018;8(6). [PubMed ID: 29101113]. [PubMed Central ID: PMC5983161]. https://doi.org/10.1101/cshperspect.a030635.
  • 4.
    Kaler J, Hussain A, Haque A, Naveed H, Patel S. A Comprehensive Review of Pharmaceutical and Surgical Interventions of Prostate Cancer. Cureus. 2020;12(11). e11617. https://doi.org/10.7759/cureus.11617.
  • 5.
    Heinlein CA, Chang C. Androgen receptor in prostate cancer. Endocr Rev. 2004;25(2):276-308. [PubMed ID: 15082523]. https://doi.org/10.1210/er.2002-0032.
  • 6.
    Vickman RE, Franco OE, Moline DC, Vander Griend DJ, Thumbikat P, Hayward SW. The role of the androgen receptor in prostate development and benign prostatic hyperplasia: A review. Asian J Urol. 2020;7(3):191-202. [PubMed ID: 32742923]. [PubMed Central ID: PMC7385520]. https://doi.org/10.1016/j.ajur.2019.10.003.
  • 7.
    Tammela T. Endocrine treatment of prostate cancer. J Steroid Biochem Mol Biol. 2004;92(4):287-95. [PubMed ID: 15663992]. https://doi.org/10.1016/j.jsbmb.2004.10.005.
  • 8.
    Roy-Burman P, Tindall DJ, Robins DM, Greenberg NM, Hendrix MJ, Mohla S, et al. Androgens and prostate cancer: are the descriptors valid? Cancer Biol Ther. 2005;4(1):4-5. [PubMed ID: 16052746]. https://doi.org/10.4161/cbt.4.1.1563.
  • 9.
    Lin SR, Fu YS, Tsai MJ, Cheng H, Weng CF. Natural Compounds from Herbs that can Potentially Execute as Autophagy Inducers for Cancer Therapy. Int J Mol Sci. 2017;18(7). [PubMed ID: 28671583]. [PubMed Central ID: PMC5535904]. https://doi.org/10.3390/ijms18071412.
  • 10.
    Singh BN, Shankar S, Srivastava RK. Green tea catechin, epigallocatechin-3-gallate (EGCG): mechanisms, perspectives and clinical applications. Biochem Pharmacol. 2011;82(12):1807-21. [PubMed ID: 21827739]. [PubMed Central ID: PMC4082721]. https://doi.org/10.1016/j.bcp.2011.07.093.
  • 11.
    Cromie MM, Gao W. Epigallocatechin-3-gallate enhances the therapeutic effects of leptomycin B on human lung cancer a549 cells. Oxid Med Cell Longev. 2015;2015:217304. [PubMed ID: 25922640]. [PubMed Central ID: PMC4397486]. https://doi.org/10.1155/2015/217304.
  • 12.
    Li S, Wu L, Feng J, Li J, Liu T, Zhang R, et al. In vitro and in vivo study of epigallocatechin-3-gallate-induced apoptosis in aerobic glycolytic hepatocellular carcinoma cells involving inhibition of phosphofructokinase activity. Sci Rep. 2016;6:28479. [PubMed ID: 27349173]. [PubMed Central ID: PMC4923908]. https://doi.org/10.1038/srep28479.
  • 13.
    Thakur VS, Gupta K, Gupta S. Green tea polyphenols increase p53 transcriptional activity and acetylation by suppressing class I histone deacetylases. Int J Oncol. 2012;41(1):353-61. [PubMed ID: 22552582]. [PubMed Central ID: PMC3580388]. https://doi.org/10.3892/ijo.2012.1449.
  • 14.
    Shimizu M, Shirakami Y, Sakai H, Tatebe H, Nakagawa T, Hara Y, et al. EGCG inhibits activation of the insulin-like growth factor (IGF)/IGF-1 receptor axis in human hepatocellular carcinoma cells. Cancer Lett. 2008;262(1):10-8. [PubMed ID: 18164805]. https://doi.org/10.1016/j.canlet.2007.11.026.
  • 15.
    Khakoo AY, Pati S, Anderson SA, Reid W, Elshal MF, Rovira ,I, et al. Human mesenchymal stem cells exert potent antitumorigenic effects in a model of Kaposi's sarcoma. J Exp Med. 2006;203(5):1235-47. [PubMed ID: 16636132]. [PubMed Central ID: PMC2121206]. https://doi.org/10.1084/jem.20051921.
  • 16.
    Ma S, Liang S, Jiao H, Chi L, Shi X, Tian Y, et al. Human umbilical cord mesenchymal stem cells inhibit C6 glioma growth via secretion of dickkopf-1 (DKK1). Mol Cell Biochem. 2014;385(1-2):277-86. [PubMed ID: 24104453]. https://doi.org/10.1007/s11010-013-1836-y.
  • 17.
    Lu L, Chen G, Yang J, Ma Z, Yang Y, Hu Y, et al. Bone marrow mesenchymal stem cells suppress growth and promote the apoptosis of glioma U251 cells through downregulation of the PI3K/AKT signaling pathway. Biomed Pharmacother. 2019;112:108625. [PubMed ID: 30784920]. https://doi.org/10.1016/j.biopha.2019.108625.
  • 18.
    He N, Kong Y, Lei X, Liu Y, Wang J, Xu C, et al. MSCs inhibit tumor progression and enhance radiosensitivity of breast cancer cells by down-regulating Stat3 signaling pathway. Cell Death Dis. 2018;9(10):1026. [PubMed ID: 30297887]. [PubMed Central ID: PMC6175943]. https://doi.org/10.1038/s41419-018-0949-3.
  • 19.
    Akimoto K, Kimura K, Nagano M, Takano S, To'a Salazar G, Yamashita T, et al. Umbilical cord blood-derived mesenchymal stem cells inhibit, but adipose tissue-derived mesenchymal stem cells promote, glioblastoma multiforme proliferation. Stem Cells Dev. 2013;22(9):1370-86. [PubMed ID: 23231075]. [PubMed Central ID: PMC3696928]. https://doi.org/10.1089/scd.2012.0486.
  • 20.
    Bortolotti F, Ukovich L, Razban V, Martinelli V, Ruozi G, Pelos B, et al. In vivo therapeutic potential of mesenchymal stromal cells depends on the source and the isolation procedure. Stem Cell Reports. 2015;4(3):332-9. [PubMed ID: 25660405]. [PubMed Central ID: PMC4375942]. https://doi.org/10.1016/j.stemcr.2015.01.001.
  • 21.
    Kalaszczynska I, Ferdyn K. Wharton's jelly derived mesenchymal stem cells: future of regenerative medicine? Recent findings and clinical significance. Biomed Res Int. 2015;2015:430847. [PubMed ID: 25861624]. [PubMed Central ID: PMC4377382]. https://doi.org/10.1155/2015/430847.
  • 22.
    Dzobo K, Vogelsang M, Thomford NE, Dandara C, Kallmeyer K, Pepper MS, et al. Wharton's Jelly-Derived Mesenchymal Stromal Cells and Fibroblast-Derived Extracellular Matrix Synergistically Activate Apoptosis in a p21-Dependent Mechanism in WHCO1 and MDA MB 231 Cancer Cells In Vitro. Stem Cells Int. 2016;2016:4842134. [PubMed ID: 26880967]. [PubMed Central ID: PMC4737007]. https://doi.org/10.1155/2016/4842134.
  • 23.
    Mirabdollahi M, Sadeghi-Aliabadi H, Haghjooy Javanmard S. Human Wharton's jelly mesenchymal stem cells-derived secretome could inhibit breast cancer growth in vitro and in vivo. Iran J Basic Med Sci. 2020;23(7):945-53. [PubMed ID: 32774818]. [PubMed Central ID: PMC7395193]. https://doi.org/10.22038/ijbms.2020.42477.10020.
  • 24.
    Hendijani F, Javanmard Sh H, Rafiee L, Sadeghi-Aliabadi H. Effect of human Wharton's jelly mesenchymal stem cell secretome on proliferation, apoptosis and drug resistance of lung cancer cells. Res Pharm Sci. 2015;10(2):134-42. [PubMed ID: 26487890]. [PubMed Central ID: PMC4584452].
  • 25.
    Sekhoacha M, Riet K, Motloung P, Gumenku L, Adegoke A, Mashele S. Prostate Cancer Review: Genetics, Diagnosis, Treatment Options, and Alternative Approaches. Molecules. 2022;27(17). [PubMed ID: 36080493]. [PubMed Central ID: PMC9457814]. https://doi.org/10.3390/molecules27175730.
  • 26.
    Yang JG, Yu HN, Sun SL, Zhang LC, He GQ, Das UN, et al. Epigallocatechin-3-gallate affects the growth of LNCaP cells via membrane fluidity and distribution of cellular zinc. J Zhejiang Univ Sci B. 2009;10(6):411-21. [PubMed ID: 19489106]. [PubMed Central ID: PMC2689553]. https://doi.org/10.1631/jzus.B0820400.
  • 27.
    Rahmani AH, Al Shabrmi FM, Allemailem KS, Aly SM, Khan MA. Implications of Green Tea and Its Constituents in the Prevention of Cancer via the Modulation of Cell Signalling Pathway. Biomed Res Int. 2015;2015:925640. [PubMed ID: 25977926]. [PubMed Central ID: PMC4419223]. https://doi.org/10.1155/2015/925640.
  • 28.
    Schroder L, Marahrens P, Koch JG, Heidegger H, Vilsmaier T, Phan-Brehm T, et al. [Corrigendum] Effects of green tea, matcha tea and their components epigallocatechin gallate and quercetin on MCF‑7 and MDA‑MB‑231 breast carcinoma cells. Oncol Rep. 2020;43(2):747. [PubMed ID: 31894277]. https://doi.org/10.3892/or.2019.7430.
  • 29.
    Farahmand L, Esmaeili R, Eini L, Majidzadeh AK. The effect of mesenchymal stem cell-conditioned medium on proliferation and apoptosis of breast cancer cell line. J Cancer Res Ther. 2018;14(2):341-4. [PubMed ID: 29516916]. https://doi.org/10.4103/0973-1482.177213.
  • 30.
    Widowati W, Wijaya L, Murti H, Widyastuti H, Agustina D, Laksmitawati DR, et al. Conditioned medium from normoxia (WJMSCs-norCM) and hypoxia-treated WJMSCs (WJMSCs-hypoCM) in inhibiting cancer cell proliferation. Biomarkers Genom Med. 2015;7(1):8-17. https://doi.org/10.1016/j.bgm.2014.08.008.
  • 31.
    Tai S, Sun Y, Squires JM, Zhang H, Oh WK, Liang CZ, et al. PC3 is a cell line characteristic of prostatic small cell carcinoma. Prostate. 2011;71(15):1668-79. [PubMed ID: 21432867]. [PubMed Central ID: PMC3426349]. https://doi.org/10.1002/pros.21383.
  • 32.
    Adhami VM, Malik A, Zaman N, Sarfaraz S, Siddiqui IA, Syed DN, et al. Combined inhibitory effects of green tea polyphenols and selective cyclooxygenase-2 inhibitors on the growth of human prostate cancer cells both in vitro and in vivo. Clin Cancer Res. 2007;13(5):1611-9. [PubMed ID: 17332308]. https://doi.org/10.1158/1078-0432.CCR-06-2269.
  • 33.
    Lev-Ari S, Strier L, Kazanov D, Madar-Shapiro L, Dvory-Sobol H, Pinchuk I, et al. Celecoxib and curcumin synergistically inhibit the growth of colorectal cancer cells. Clin Cancer Res. 2005;11(18):6738-44. [PubMed ID: 16166455]. https://doi.org/10.1158/1078-0432.CCR-05-0171.
  • 34.
    Aurilio G, Cimadamore A, Mazzucchelli R, Lopez-Beltran A, Verri E, Scarpelli M, et al. Androgen Receptor Signaling Pathway in Prostate Cancer: From Genetics to Clinical Applications. Cells. 2020;9(12). [PubMed ID: 33321757]. [PubMed Central ID: PMC7763510]. https://doi.org/10.3390/cells9122653.
  • 35.
    Wen S, Niu Y, Lee SO, Chang C. Androgen receptor (AR) positive vs negative roles in prostate cancer cell deaths including apoptosis, anoikis, entosis, necrosis and autophagic cell death. Cancer Treat Rev. 2014;40(1):31-40. [PubMed ID: 23993415]. [PubMed Central ID: PMC3833078]. https://doi.org/10.1016/j.ctrv.2013.07.008.

Similar Articles

8
Jan
2023

Adipose-Derived Mesenchymal Stem Cells Secretome Induces Apoptosis in Colon Carcinoma HT-29 Cells

Mohammad Javad Khodayar,
Fatemeh Rezaei Tazangi,
Azin Samimi,
Hadis Alidadi
20
Jul
2022

TGFβ1-Pretreated Exosomes of Wharton Jelly Mesenchymal Stem Cell as a Therapeutic Strategy for Improving Liver Fibrosis

Samaneh Salehipour Bavarsad,
Mohammad Taha Jalali,
Darioush Bijan Nejad,
Behnam Alypoor,
Hossein Babaahmadi Rezaei,
Narges Mohammadtaghvaei

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles