The Effect of Polymorphisms on the Ala 119 Ser Gene Cytochrome P450 1B1*2 on the Susceptibility of Iranian Women to Develop Breast Cancer

Authors

Fereshteh Moheb Afzali1, Zahra Tahmasebi Fard2, 3,*, Mohammad Esmaeil Akbari2
1Department of Molecular and Cellular Sciences, Faculty of Advanced Sciences and Technology, Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, IR Iran (IAUPS)
2Cancer Research Center, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
3Department of Biology, Roudehen Branch, Islamic Azad University, Roudehen, IR Iran
*Corresponding Author: Corresponding author: Zahra Tahmasebi Fard, PhD, Department of Biology, Roudehen Branch, Islamic Azad University, Roudehen, IR Iran. Tel: +98-9122266686, Fax: +98-2176501812, E-mail: Email: [email protected]

International Journal of Cancer Management:Vol. 10, issue 3; e4042
Published online:Feb 25, 2017
Article type:Research Article
Received:Oct 03, 2015
Accepted:Feb 14, 2017
How to Cite:Moheb Afzali F, Tahmasebi Fard Z, Akbari ME. The Effect of Polymorphisms on the Ala 119 Ser Gene Cytochrome P450 1B1*2 on the Susceptibility of Iranian Women to Develop Breast Cancer. Int J Cancer Manag. 2017;10(3):e4042. doi: https://doi.org/10.5812/ijcp.4042

Abstract

Background:

Cytochrome P450 IBI (CYP1B1) is involved in the metabolism of a wide range of internal and external substrates and also plays a key role in the metabolism of oestrogen. This enzyme is a factor that could potentially affect the likelihood of a person developing breast cancer. The aim of this study was to evaluate the correlation between polymorphism (RS1056827) and the occurrence of breast cancer in Iranian women.

Methods:

We used a case-control study design. After an initial evaluation, 79 women with breast cancer (the patient group) and 79 women without breast cancer (the control group) were selected to participate in the study. Their blood samples were then obtained, and a sample of their DNA was extracted. PCR-RELP was used to determine the genotypes of the participants. The data were subjected to statistical tests using the SPSS software package.

Results:

The results demonstrated that the frequency of the G allele in the patient and the control group were 34% and 69%, respectively. In addition, the frequency of the T allele in the patient and control group were 66% and 31%, respectively. The genotype frequency of TT, GG and TG in patients with breast cancer were 26.59%, 20.25% and 53.16%, respectively, and 22.79%, 60.76% and 16.45%, respectively, in the control group. There was a statistically meaningful correlation between the results of the genotypes in the patient and control groups.

Conclusions:

The results demonstrated that patients with the TT genotype are 3.85 times more likely to develop breast cancer. Therefore, the presence of this polymorphism could be one of the factors that lead to the development of breast cancer.

1. Introduction

Breast cancer is the most common cancer in women and, after lung cancer, is the second leading cause of death in people with cancer. Breast cancer constitutes 32% of the total cancers in women (1). Its prevalence in Iran has been reported as 17.44 per 100,000 people (2-4). Cytochrome P450s are of a specific family of heme-thiol containing proteins. They are classified into 4 groups, 13 families and 9 subfamilies (5). Their most important characteristics are their protective role (6). Cytochrome P450s are involved in the metabolism of medications, exogenous and endogenous compounds, biosynthesis of steroidal hormones and oxidation of fatty acids (6-8). CYP1B1, one of the main enzymes in this family, is situated on chromosome 2p21-22. This gene consists of three exons and two introns, but only its two exons are encoded (8). The CYP1B1 gene may have an important role in tumourigenesis. This gene is highly polymorphic and interpersonal differences resulting from this genetic variation and its various levels of expression may affect the susceptibility of an individual to developing breast cancer (9, 10). In addition, it has been reported that the over-expression of this gene in breast tumours (11) and other tissues such as lung, skin, ovarian and testis (11-13) as well as some intact extra hepatic tissue include breast, uterus, prostate and lung (9, 14).
The role of this enzyme is important not only in the activation of several environmental carcinogens such as PAHs and AAs but also in the production of active metabolites that can harm DNA. Activated carcinogens result in the breakage of single-strand DNA and thus increase the number of genetic mutations. The development of the tumour is also enhanced by the reduced effectiveness of anti-carcinogen medications, which are metabolized specifically by CYP1B1 (6, 7, 15, 16). The other role of CYP1B is hydroxylation of estradiol to 4-hydroxystradiol (a genotoxic compound), which is a trigger factor for tumour formation in mammalian cells as it produces active metabolites (17) (Figure 1).
It Shows the CYP1B1 catalysed aromatic Hydroxylation of estradiol to 4-hydroxyestradiol (<a href="#A4042REF8">8</a>).
Figure 1.
It Shows the CYP1B1 catalysed aromatic Hydroxylation of estradiol to 4-hydroxyestradiol (8).
Polymorphism at the site of the Ala 119 Ser (CYP1B1*2) codon results in a 2- to 4-fold increase in the activity of the CYP1B1 enzyme compared to the natural enzyme (18). This results in a 2- to 4-fold increase in the hydroxylation of the procarcinogen to carcinogenic compounds (18-20). In light of the role of CYP1B1 in converting potential procarcinogen compounds to carcinogenic ones, and the over-expression of this gene in tumour cells, we decided to investigate its prevalence in Iranian women with breast cancer.

2. Methods

We employed a case-control study design in this work. 79 women with breast cancer and 79 healthy women who did not have any history of medical conditions such as diabetes, hypertension or cardiovascular diseases were selected. The healthy women also did not have any incidence of cancer in their first-degree family.

2.1. DNA Extraction and PCR Reaction Conditions

3 - 5 cc blood samples were obtained from the patients, were mixed with EDTA and then stored at a temperature of -20°C. The extraction of DNA from the blood samples was performed by the method of salt saturation (21). The purity and concentration of the DNA were evaluated using a spectrophotometer. PCR-RELP was used to examine the polymorphism. A fragment with 250 base-pairs (bp) in length was proliferated to either analyse the nucleotide polymorphism of G119T in the exon 2 gene CYP1B1 or to identify the genotype of the participant.
The following primers were used in the PCR reaction (made by Macrogen company) include: Forward primer: 5’-CTCGTTCGCTCGCCTGGCGC 3’ and reverse primer: 5’- GAAGTTGCGCATCATGCTGT 3’.
To proliferate the relevant region of the DNA, a reactive mixture was prepared by adding 1 μL in volume from each primer (10 Pmol), 1 μL of genomic DNA (about 10 ng), 10 μL of commercial master mix (2 ×) (Amplicon company of Denmark) and 10 μL of distilled water to the reaction. The stages of the proliferation cycle were as follows: 5 minutes hold at 95°C, 35 cycles of temperature including 1 minute at 95°C, 30 seconds at 64°C, 40 seconds at 72°C and finally 7 minutes at 72°C. The proliferated fragments were then separated by electrophoresis on a 2% agarose gel and observed under UV light.

2.2. Genotype Determination

After confirming that the desired fragment had been proliferated, 5 U (0.1 mL) of Pdil enzyme (Thermo company) was added to 5 μL of the PCR products and then incubated at 37°C for 16 - 18 hours. The fragments were then separated by electrophoresis on a 3% agarose gel and observed under UV light. The presence of fragments with 250 bp indicated that the participant had a TT homozygote genotype (without enzymatic digestion); the fragments with 112 and 138 bps indicated that the participant had a GG homozygote genotype and the fragments with 112, 138 and 250 bps indicated that the participant had a GT/TG heterozygote genotype.

2.3. Statistical Analyses

Statistical tests were conducted using the SPSS 19 software package. The x2 test was used to evaluate the difference between genotype distributions in the patient and control groups. The Pearson statistical test was used to examine the correlation between this polymorphism and the risk of developing breast cancer. The odds ratio with a CI: 95% was calculated for estimating the correlation between the polymorphism and the risk of developing breast cancer. In all calculations, probability levels of P < 0.05 were considered to be statistically meaningful.

3. Results

In the patient group, age range was 32 - 70 years with average 49.68 years and in the control group was 30 - 65 years with average 47.34 years. In the patient group the mean weight of the participants was 68 ± 8 kg and 61 ± 2 in the control group. According to the medical records of the patient group, estrogen receptor expression was observed in 58% and progesterone receptor expression in 42% of them.
Of the patient group, 26 (32.91%) had invasive lobular carcinoma, 45 (56.97%) had invasive ductal carcinoma, 5 (6.33%) had ductal carcinoma in situ and 3 (3.79%) had lobular carcinoma in situ. 38 patients had metastatic breast cancer, 16 patients had Grade III breast cancer, 13 patients had Grade II/III breast cancer and 12 patients had Grade II breast cancer.
The frequencies of alleles and homozygote and heterozygote genotypes in this study comply with the rule of Hardy-Weinberg. In the cancer group, it was calculated that there were 42 cases (53.16%) of the TT genotype, 16 cases (20.25%) of the GG genotype and 21 cases (26.59%) of the TG genotype, whereas in the control group, there were 18 (22.79%), 48 (60.76%) and 13 (16.45%) cases of TT, GG and TG genotypes, respectively. The results of some of the PCR experiments are shown in the Figure 2.
Well number 1: genotype TG\GT; Well number 2: genotype TT. well number 3: Genotype GG; well number 4: PCR product Controls (250bp); wells number 5: markers of DNA Ladder Ready To Load Manufacturing Co. SMBIO Taiwan (ROC).
Figure 2.
Well number 1: genotype TG\GT; Well number 2: genotype TT. well number 3: Genotype GG; well number 4: PCR product Controls (250bp); wells number 5: markers of DNA Ladder Ready To Load Manufacturing Co. SMBIO Taiwan (ROC).
The frequency of the G allele in the patient group was 0.34, while in the control group it was 0.69. The frequency of the T allele in the patient and control groups were 0.66 and 0.31 respectively. There was a statistically meaningful correlation between the results of the genotypes between the control and patient groups. The results are summarized in the Table 1.
Table 1.
The Frequency of Genotypes and Statistically, the Odds Ratio and CIa
GenotypsCancerControlP ValueOdds RatioCI
TT42 (53.16)18 (22.79)03.8595% (1.94 - 7.65)
TG21 (26.59)13 (16.45)0.2231.8495% (0.85 - 4)
GG16 (20.25)48 (60.76)00.1695% ( 0.08 - 0.33)
aValues are expressed as No. (%).

4. Discussion

The malignant phenotype appears due to the aggregation of genetic injuries in the normal epithelial cells of the breast tissue. The groups of people who are susceptible to developing breast cancer have various polymorphisms in their genes that are involved in the metabolism of carcinogens and also in repairing the genes in DNA (22, 23). The proteins of cytochrome P460, which have important roles in many metabolic reactions of medications and the synthesis of cholesterol, steroids and lipids, are associated (24) with the risk of developing cancers related to hormones. The hormone oestrogen causes an increase in the probability of mutations in the various divisions of DNA, either by affecting cellular division of genes or by promoting the phase of G1. Generally, steroidal hormones result in cell proliferation by binding to the oestrogenic receptors in the cytoplasm. They therefore affect different genes including growth factors, genes of the growth factor receptor and progesterone receptor, and they can also be considered as a carcinogenic factor (25, 26). Various studies conducted on the CYP1B1 enzyme have indicated that the polymorphisms of this gene can change the enzymatic activity and the catalytic features of the enzymes (27, 28). Considering four polymorphisms in the codon of Arg48Gly (CYP1B1*1), Ala119Ser (CYP1B1*2), Leu432Val (CYP1B1*3) and Asn453Ser (CYP1B1*4), it becomes clear that they have more hydroxylation activity than normal types, and all of them are related to the susceptibility of developing a cancer (27, 29-32).
In this study, we have evaluated the correlation between polymorphisms in CYP1B1 related to changing the Ala119Ser and the risk of developing breast cancer in Iranian women. A relationship between this polymorphism and the progression of several important cancers, including colorectal cancer (7), uterine leiomyoma (33), prostate cancer (34, 35) and breast cancer (27, 32, 36, 37), has been identified. We found that the frequency of the G allele in a group of cancer patients was 0.34, while in a control group of healthy women the frequency of the G allele was 0.69. Statistical analysis showed a meaningful correlation between the patient and control groups in terms of a comparison of their genotypes. There was no statistically meaningful correlation in the results of the frequency of the TT genotype between the two groups. Furthermore, the calculated odds ratio (OR: 3.85 CI 95% (1.94 - 7.65)) indicated that the presence of this genotype in a person would cause them to have a higher risk of developing breast cancer. The calculated odds ratio of the GG genotype (OR: 0.16 CI 95% (0.08 - 0.33)) showed that the presence of this genotype is not indicative of a higher risk of developing cancer. However, there was a statistically meaningful correlation between this genotype and the risk of developing cancer. No meaningful correlations for the TG genotype were observed. Nevertheless, the odds ratio (OR: 1.84 CI 95% (0.85 - 4)) showed that those with this type of genotype do have a heightened risk of developing breast cancer. Our results demonstrated the correlation between polymorphism of CYP1B1 with the risk of developing breast cancer.
Moreover, there was a meaningful correlation observed between polymorphisms of CYP1B1 (such as rs 1056827) and breast cancer in other studies on Chinese, Japanese and Turkish women (38-40). Our results were confirmed when compared with other studies. In studies by Jiao et al (2010) (41), a meta-analysis study by Economopoulos et al. (2010) (42), a study by Reding et al. (2009) (43) and a study by Rylander-Rudqvist et al. on people with breast cancer indicated a significantly meaningful correlation between polymorphisms of the P450 1B1 gene (Ala119Ser) and a risk of developing breast cancer (44). In addition, Hanna et al. (2000) evaluated the effectiveness of the pharmacokinetics of polymorphisms on cytochrome P4501B1 on the activity of hydroxylation of oestrogen, and their results demonstrated that changing the activity of oestrogen hydroxylation by CYP1B1 can increase the risk of developing breast cancer (45). Furthermore, this polymorphism has been related to the risk of developing prostate cancer (35), uterine leiomyoma (46) and primary open-angle glaucoma (47). It appears that the polymorphism is a trigger substance for cancer that affects the efficacy of the CYP1B1 enzyme and plays a key role in the bio-variation of oestrogens and reactive pro-carcinogens with DNA (41).
Some genetic variants in estrogen metabolism pathway may be increased susceptible women. Such as our finding that suggested Ala 119 Ser polymorphism in the hormone metabolism pathways associated with breast cancer.

Acknowledgments

Footnotes

  • Authors Contribution:Non declared.

  • Fundding/Support:The authors received financial support form cancer research center of Shahid Beheshti University.

  • Conflicts of Interest:The authors have no conflicts of interest to declare.

References

  • 1.
    Kumar V, Abbas AK, Fausto N. Cellular adaptations, cell injury, and cell death. In: Kumar V, Abbas AK, Fausto N, editors. Robbins and Cotran Pathologic Basis of Disease. Philadelphia: Elsevier; 2005. p. 3-46.
  • 2.
    Mousavi SM, Montazeri A, Mohagheghi MA, Jarrahi AM, Harirchi I, Najafi M, et al. Breast cancer in Iran: an epidemiological review. Breast J. 2007;13(4):383-91. [PubMed ID: 17593043]. https://doi.org/10.1111/j.1524-4741.2007.00446.x.
  • 3.
    Martin M. Molecular biology of breast cancer. Clin Transl Oncol. 2006;8(1):7-14. [PubMed ID: 16632434].
  • 4.
    Brunicardi F, Brandt M, Andersen D, Billiar T, Dunn D, Hunter JG, et al. Schwartz's Principles of surgery ABSITE and Board Review. McGraw Hill Professional; 2010.
  • 5.
    Baldwin WS, Marko PB, Nelson DR. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex. BMC Genomics. 2009;10:169. [PubMed ID: 19383150]. https://doi.org/10.1186/1471-2164-10-169.
  • 6.
    Pastina I, Giovannetti E, Chioni A, Sissung TM, Crea F, Orlandini C, et al. Cytochrome 450 1B1 (CYP1B1) polymorphisms associated with response to docetaxel in Castration-Resistant Prostate Cancer (CRPC) patients. BMC Cancer. 2010;10:511. [PubMed ID: 20875115]. https://doi.org/10.1186/1471-2407-10-511.
  • 7.
    Trubicka J, Grabowska-Klujszo E, Suchy J, Masojc B, Serrano-Fernandez P, Kurzawski G, et al. Variant alleles of the CYP1B1 gene are associated with colorectal cancer susceptibility. BMC Cancer. 2010;10:420. [PubMed ID: 20701755]. https://doi.org/10.1186/1471-2407-10-420.
  • 8.
    Xu W, Zhou Y, Hang X, Shen D. Current evidence on the relationship between CYP1B1 polymorphisms and lung cancer risk: a meta-analysis. Mol Biol Rep. 2012;39(3):2821-9. [PubMed ID: 21674184]. https://doi.org/10.1007/s11033-011-1041-6.
  • 9.
    Shimada T, Hayes CL, Yamazaki H, Amin S, Hecht SS, Guengerich FP, et al. Activation of chemically diverse procarcinogens by human cytochrome P-450 1B1. Cancer Res. 1996;56(13):2979-84. [PubMed ID: 8674051].
  • 10.
    Shimada T, Watanabe J, Kawajiri K, Sutter TR, Guengerich FP, Gillam EM, et al. Catalytic properties of polymorphic human cytochrome P450 1B1 variants. Carcinogenesis. 1999;20(8):1607-13. [PubMed ID: 10426814].
  • 11.
    McFadyen MC, Cruickshank ME, Miller ID, McLeod HL, Melvin WT, Haites NE, et al. Cytochrome P450 CYP1B1 over-expression in primary and metastatic ovarian cancer. Br J Cancer. 2001;85(2):242-6. [PubMed ID: 11461084]. https://doi.org/10.1054/bjoc.2001.1907.
  • 12.
    Murray GI, Taylor MC, McFadyen MC, McKay JA, Greenlee WF, Burke MD, et al. Tumor-specific expression of cytochrome P450 CYP1B1. Cancer Res. 1997;57(14):3026-31. [PubMed ID: 9230218].
  • 13.
    Murray GI, Melvin WT, Greenlee WF, Burke MD. Regulation, function, and tissue-specific expression of cytochrome P450 CYP1B1. Annu Rev Pharmacol Toxicol. 2001;41:297-316. [PubMed ID: 11264459]. https://doi.org/10.1146/annurev.pharmtox.41.1.297.
  • 14.
    Spivack SD, Hurteau GJ, Reilly AA, Aldous KM, Ding X, Kaminsky LS. CYP1B1 expression in human lung. Drug Metab Dispos. 2001;29(6):916-22. [PubMed ID: 11353763].
  • 15.
    Okobia MN, Bunker CH, Garte SJ, Zmuda JM, Ezeome ER, Anyanwu SN, et al. Cytochrome P450 1B1 Val432Leu polymorphism and breast cancer risk in Nigerian women: a case control study. Infect Agent Cancer. 2009;4 Suppl 1. S12. [PubMed ID: 19208203]. https://doi.org/10.1186/1750-9378-4-S1-S12.
  • 16.
    Matyjasik J, Cybulski C, Masojc B, Jakubowska A, Serrano-Fernandez P, Gorski B, et al. CYP1B1 and predisposition to breast cancer in Poland. Breast Cancer Res Treat. 2007;106(3):383-8. [PubMed ID: 17458695]. https://doi.org/10.1007/s10549-007-9500-4.
  • 17.
    Purnapatre K, Khattar SK, Saini KS. Cytochrome P450s in the development of target-based anticancer drugs. Cancer Lett. 2008;259(1):1-15. [PubMed ID: 18053638]. https://doi.org/10.1016/j.canlet.2007.10.024.
  • 18.
    Sasaki M, Tanaka Y, Kaneuchi M, Sakuragi N, Dahiya R. CYP1B1 gene polymorphisms have higher risk for endometrial cancer, and positive correlations with estrogen receptor alpha and estrogen receptor beta expressions. Cancer Res. 2003;63(14):3913-8. [PubMed ID: 12873984].
  • 19.
    Bailey LR, Roodi N, Dupont WD, Parl FF. Association of cytochrome P450 1B1 (CYP1B1) polymorphism with steroid receptor status in breast cancer. Cancer Res. 1998;58(22):5038-41. [PubMed ID: 9823305].
  • 20.
    Faas BH, Simsek S, Bleeker PM, Overbeeke MA, Cuijpers HT, von dem Borne AE, et al. Rh E/e genotyping by allele-specific primer amplification. Blood. 1995;85(3):829-32. [PubMed ID: 7833484].
  • 21.
    Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. New York: Cold spring harbor laboratory press; 1989.
  • 22.
    Kumar V, Singh S, Ahmed RS, Banerjee BD, Ahmed T, Pasha ST. Frequency of common CYP1B1 polymorphic variations in Delhi population of Northern India. Environ Toxicol Pharmacol. 2009;28(3):392-6. [PubMed ID: 21784032]. https://doi.org/10.1016/j.etap.2009.06.006.
  • 23.
    Caporaso N, Goldstein A. Cancer genes: single and susceptibility: exposing the difference. Pharmacogenetics. 1995;5(2):59-63. [PubMed ID: 7663529].
  • 24.
    Cancer. 2014. Available from: http://www.imm.ki.se/CYPalleles/cyp1b1.htm.
  • 25.
    Horwitz KB, McGuire WL. Estrogen control of progesterone receptor in human breast cancer. Correlation with nuclear processing of estrogen receptor. J Biol Chem. 1978;253(7):2223-8. [PubMed ID: 632265].
  • 26.
    Klijn JG, Berns EM, Foekens JA. Prognostic factors and response to therapy in breast cancer. Cancer Surv. 1993;18:165-98. [PubMed ID: 8012996].
  • 27.
    Bernstein L, Ross RK. Endogenous hormones and breast cancer risk. Epidemiol Rev. 1993;15(1):48-65. [PubMed ID: 8405212].
  • 28.
    Brown TA. Gene cloning and DNA analysis: an introduction. John Wiley & Sons; 2016.
  • 29.
    Laroche-Clary A, Le Morvan V, Yamori T, Robert J. Cytochrome P450 1B1 gene polymorphisms as predictors of anticancer drug activity: studies with in vitro models. Mol Cancer Ther. 2010;9(12):3315-21. [PubMed ID: 20889730]. https://doi.org/10.1158/1535-7163.MCT-10-0673.
  • 30.
    Giordano SH, Buzdar AU, Hortobagyi GN. Breast cancer in men. Ann Intern Med. 2002;137(8):678-87. [PubMed ID: 12379069].
  • 31.
    Colditz GA. Epidemiology and prevention of breast cancer. Cancer Epidemiol Biomarkers Prev. 2005;14(4):768-72. [PubMed ID: 15824141]. https://doi.org/10.1158/1055-9965.EPI-04-0157.
  • 32.
    Russo J, Russo IH. Genotoxicity of steroidal estrogens. Trends Endocrinol Metab. 2004;15(5):211-4. [PubMed ID: 15223050]. https://doi.org/10.1016/j.tem.2004.05.007.
  • 33.
    Cho YJ, Hur SE, Lee JY, Song IO, Moon HS, Koong MK, et al. Single nucleotide polymorphisms and haplotypes of the genes encoding the CYP1B1 in Korean women: no association with advanced endometriosis. J Assist Reprod Genet. 2007;24(7):271-7. [PubMed ID: 17562158]. https://doi.org/10.1007/s10815-007-9122-0.
  • 34.
    Johnson-Thompson MC, Guthrie J. Ongoing research to identify environmental risk factors in breast carcinoma. Cancer. 2000;88(5 Suppl):1224-9. [PubMed ID: 10705359].
  • 35.
    Zhang H, Li L, Xu Y. CYP1B1 polymorphisms and susceptibility to prostate cancer: a meta-analysis. PLoS One. 2013;8(7). e68634. [PubMed ID: 23861929]. https://doi.org/10.1371/journal.pone.0068634.
  • 36.
    Feigelson HS, Henderson BE. Estrogens and breast cancer. Carcinogenesis. 1996;17(11):2279-84. [PubMed ID: 8968038].
  • 37.
    Hunter DJ, Spiegelman D, Adami HO, van den Brandt PA, Folsom AR, Goldbohm RA, et al. Non-dietary factors as risk factors for breast cancer, and as effect modifiers of the association of fat intake and risk of breast cancer. Cancer Causes Control. 1997;8(1):49-56. [PubMed ID: 9051322].
  • 38.
    Zanger UM, Schwab M. Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol Ther. 2013;138(1):103-41. [PubMed ID: 23333322]. https://doi.org/10.1016/j.pharmthera.2012.12.007.
  • 39.
    Kocabas NA, Sardas S, Cholerton S, Daly AK, Karakaya AE. Cytochrome P450 CYP1B1 and catechol O-methyltransferase (COMT) genetic polymorphisms and breast cancer susceptibility in a Turkish population. Arch Toxicol. 2002;76(11):643-9. [PubMed ID: 12415427]. https://doi.org/10.1007/s00204-002-0387-x.
  • 40.
    Watanabe J, Shimada T, Gillam EM, Ikuta T, Suemasu K, Higashi Y, et al. Association of CYP1B1 genetic polymorphism with incidence to breast and lung cancer. Pharmacogenetics. 2000;10(1):25-33. [PubMed ID: 10739169].
  • 41.
    Jiao H, Liu C, Guo W, Peng L, Chen Y, Martin FL. Association of CYP1B1 Polymorphisms with Breast Cancer: A Case-Control Study in the Han Population in Ningxia Hui Autonomous Region, P. R. China. Biomark Insights. 2010;5:21-7. [PubMed ID: 20212917].
  • 42.
    Economopoulos KP, Sergentanis TN. Three polymorphisms in cytochrome P450 1B1 (CYP1B1) gene and breast cancer risk: a meta-analysis. Breast Cancer Res Treat. 2010;122(2):545-51. [PubMed ID: 20054638]. https://doi.org/10.1007/s10549-009-0728-z.
  • 43.
    Reding KW, Weiss NS, Chen C, Li CI, Carlson CS, Wilkerson HW, et al. Genetic polymorphisms in the catechol estrogen metabolism pathway and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 2009;18(5):1461-7. [PubMed ID: 19383894]. https://doi.org/10.1158/1055-9965.EPI-08-0917.
  • 44.
    Rylander-Rudqvist T, Wedren S, Granath F, Humphreys K, Ahlberg S, Weiderpass E, et al. Cytochrome P450 1B1 gene polymorphisms and postmenopausal breast cancer risk. Carcinogenesis. 2003;24(9):1533-9. [PubMed ID: 12844487]. https://doi.org/10.1093/carcin/bgg114.
  • 45.
    Hanna IH, Dawling S, Roodi N, Guengerich FP, Parl FF. Cytochrome P450 1B1 (CYP1B1) pharmacogenetics: association of polymorphisms with functional differences in estrogen hydroxylation activity. Cancer Res. 2000;60(13):3440-4. [PubMed ID: 10910054].
  • 46.
    Ye Y, Cheng X, Luo HB, Liu L, Li YB, Hou YP. CYP1A1 and CYP1B1 genetic polymorphisms and uterine leiomyoma risk in Chinese women. J Assist Reprod Genet. 2008;25(8):389-94. [PubMed ID: 18763031]. https://doi.org/10.1007/s10815-008-9246-x.
  • 47.
    Bhattacharjee A, Banerjee D, Mookherjee S, Acharya M, Banerjee A, Ray A, et al. Leu432Val polymorphism in CYP1B1 as a susceptible factor towards predisposition to primary open-angle glaucoma. Mol Vis. 2008;14:841-50. [PubMed ID: 18483560].

Copyright

Copyright © 2017, International Journal of Cancer Management. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

24
Jan
2017

Association Between Cytochrome 1B1*3 Polymorphism and the Breast Cancer in a Group of Iranian Women

Faezeh Kholousi Adab,
Zahra Tahmasebi Fard,
Mohammad Esmaeil Akbari

Kholousi Adab F, Tahmasebi Fard Z, Esmaeil Akbari M. Association Between Cytochrome 1B1*3 Polymorphism and the Breast Cancer in a Group of Iranian Women. Int J Cancer Manag. 2017;10(1):e6428. doi: https://doi.org/10.17795/ijcp-6428

8
Dec
2023
Association of CYP1A2 Gene rs17861162 Polymorphism and Breast Cancer Risk in Iranian Women: A Case-control Study

Association of CYP1A2 Gene rs17861162 Polymorphism and Breast Cancer Risk in Iranian Women: A Case-control Study

Mohammad Valizadeh Osalu,
Hossein Soltanzadeh,
Zahra Hojjati Bonab

Valizadeh Osalu M, Soltanzadeh H, Hojjati Bonab Z. Association of CYP1A2 Gene rs17861162 Polymorphism and Breast Cancer Risk in Iranian Women: A Case-control Study. Gene Cell Tissue. 2024;11(1):e141634. doi: https://doi.org/10.5812/gct-141634

30
Jun
2017
CYP1A1 Gene Polymorphism and Breast Cancer

CYP1A1 Gene Polymorphism and Breast Cancer

Sahar Balkhi,
Farhad Mashayekhi

Balkhi S, Mashayekhi F. CYP1A1 Gene Polymorphism and Breast Cancer. Ann Mil Health Sci Res. 2017;15(2):e63399. doi: https://doi.org/10.5812/amh.63399

15
Aug
2021
An Interdependence between Estrogen Receptor 1 Gene Polymorphisms and Susceptibility to Breast Cancer

An Interdependence between Estrogen Receptor 1 Gene Polymorphisms and Susceptibility to Breast Cancer

Maryam Saneipour,
Abdolkarim Sheikhi,
Abbas Moridnia

Saneipour M, Sheikhi A, Moridnia A. An Interdependence between Estrogen Receptor 1 Gene Polymorphisms and Susceptibility to Breast Cancer. J Adv Immunopharmacol. 2021;1(3):e117221. doi: https://doi.org/10.5812/tms.117221

12
Mar
2019
MTHFR C677T Polymorphism Is Associated with the Risk of Breast Cancer Among Kurdish Population from Western Iran

MTHFR C677T Polymorphism Is Associated with the Risk of Breast Cancer Among Kurdish Population from Western Iran

Zohreh Rahimi,
Maryam Bozorgi,
Ziba Rahimi,
Ebrahim Shakiba,
Kheirollah Yari,
Nazanin Jalilian
,et al.

Rahimi Z, Bozorgi M, Rahimi Z, Shakiba E, Yari K, et al. MTHFR C677T Polymorphism Is Associated with the Risk of Breast Cancer Among Kurdish Population from Western Iran. Int J Cancer Manag. 2019;12(3):e67895. doi: https://doi.org/10.5812/ijcm.67895

More by these authors

Fereshteh Moheb AfzaliPubMedScholar
Zahra Tahmasebi FardPubMedScholar
Mohammad Esmaeil AkbariPubMedScholar
Share
Cited by
Metrics
Indexed in