Logo

Prevalent Genotypes of Staphylococcus aureus Strains Isolated From Healthcare Workers in Duhok City, Kurdistan Region, Iraq

Author(s):
Nawfal R HusseinNawfal R HusseinNawfal R Hussein ORCID1,*
1Department of Internal Medicine, College of Medicine, University of Duhok, Duhok, Kurdistan Region, Iraq


International Journal of Infection:Vol. 3, issue 2; e35375
Published online:Mar 19, 2016
Article type:Brief Report
Received:Dec 09, 2015
Accepted:Dec 21, 2015
How to Cite:Nawfal R HusseinPrevalent Genotypes of Staphylococcus aureus Strains Isolated From Healthcare Workers in Duhok City, Kurdistan Region, Iraq.Int J Infect.2016;3(2):e35375.https://doi.org/10.17795/iji-35375.

Abstract

Background:

Nasal carriage of Staphylococcus aureus and its virulence determinants are major risk factors for subsequent infections and transmission.

Objectives:

The current study aimed to determine the prevalence of panton-valentine leukocidin (PVL) gene, the SCCmec types, and the prevalent methicillin-resistant Staphylococcus aureus (MRSA) genotypes in strains isolated from healthcare workers (HCWs).

Materials and Methods:

DNA was extracted from 114 frozen S. aureus strains amongst them MRSA isolates were identified by conversional methods and PVL; genotyping were determined using PCR and pulsed-field gel electrophoresis (PFGE).

Results:

Fifty-nine out of 114 (51.7%) isolates were MRSA carrying mecA, 18/59 (31%) harboured SCCmec type I, 12/59 (20.1%) harboured SCCmec type II and 12/59 (20.1%) harboured type III. The pvl gene was detected in 10 S. aureus isolates, six MRSA and four MSSA. PFGE clustered the 114 isolates of S. aureus into eight predominant types (designated A – H). The most prevalent PFGE type was type A (n = 44, 37.7%).

Conclusions:

More than a quarter of the strains harboured SCCmec type I. Staphylococcus aureus isolates were clustered into eight predominant PFGE pulsotypes. The current study should be considered preliminary and further use of molecular studies to monitor the epidemiology of MRSA and its evolution is highly recommended.

1. Background

Staphylococcus aureus is a Gram-positive bacterium, causes both community and hospital-acquired infections. The bacteria colonise skin and nasal passage in human and also cause invasive diseases such as pneumonia and sepsis (1). With the introduction of penicillin, the mortality from S.aureus infections decreased dramatically. However, such a decrease was short-lived due to the emergence of penicillinase producing S. aureus (1). Methicillin was subsequently introduced to treat S.aureus infections, but methicillin-resistant S.aureus (MRSA) strains rapidly emerged and became a major problem in hospitals in the 1960s. The mecA gene, which is responsible for methicillin resistance is carried on a mobile genetic element of a 21 to 67-kb which is known as the staphylococcal cassette chromosome mec (SCCmec) (2). This gene encodes a modified penicillin-binding protein (PBP-2a) with low affinity for beta-lactam antibiotics such as methicillin. SCCmec characterization depends upon the variations of the mec gene complex, cassette chromosome recombinase (ccr) complex, and the junkyard regions. Five SCCmec categories (I to V) were originally identified in S.aureus (3-5). In addition, SCCmec VI and VII types have also been discovered, but they are not as common as the others are. PVL is a two-component S.aureus spore-forming protein encoded by the lukF-PV and lukS-PV genes (6). PVL toxin is responsible for the increased virulence of community acquired MRSA (CA-MRSA), since this gene is responsible for many of the severe clinical syndromes of MRSA such as severe necrotising pneumonia (3-5).

2. Objectives

Studying CA-MRSA and its genotyping was conducted in Iraq (3-5). The current study aimed to determine the prevalence of PVL-containing MRSA isolates, the SCCmec types in methicillin resistant staphylococci and the prevalent MRSA genotypes in S. aureus strains isolated from healthcare workers in Duhok city.

3. Materials and Methods

3.1. Bacterial Identification and Antimicrobial Susceptibility Testing

Author had access to 114 S. aureus strains isolated from healthcare workers (HCWs). The frozen isolates were directly inoculated onto mannitol salt agar plates and incubated aerobically at 35ºC for 48 hours. The isolates were identified as S. aureus based on Gram stain, catalase test, coagulase test, and mannitol salt agar fermentation. Antimicrobial susceptibility testing to oxacillin was carried out adopting the Kirby-Bauer disk diffusion and agar dilution assay methods using Muller-Hinton agar (Oxoid Limited, Hampshire, England), according to the recommendations of the clinical laboratory standards institute (CLSI) (7, 8).

3.2. DNA Extraction and PCR for mecA and pvl Genes

DNA was extracted from S. aureus isolates using the Qiagen DNA purification kit according to the manufacturer’s instructions (DNAEASY, Qiagen). All methicillin-resistant isolates were examined for the presence of the mecA gene. The presence of the mecA gene was confirmed by PCR amplification as described by Murakami et al. (9). Thermal cycling conditions to amplify mecA were 95ºC for 30 seconds, 58ºC for one minute, and 72ºC for two minutes, for a total of 35 cycles. PCR amplification of mecA used previously described primers (MR1: GTG GAA TTG GCC AAT ACA GG and MR2: TAG GTT CTG CAG TAC CGG AT primers), which can amplify a 1399 base pair fragment specific for mecA (10). The PVL was amplified using standard protocols under the following thermal cycling conditions: 35 cycles, each consisting of denaturation at 95°C for 30 seconds, annealing at 55ºC for one minutes, and elongation at 72ºC for two minutes. Primers Luk-PV-1 (ATCATTAGGTAAAATGTCTGGACATGATCCA) and Luk-PV-2 (GCATCAAGTGTATTGGATAGCAAAAGC) were used (11). Amplification for both mecA and pvl genes started with an initial denaturation at 95ºC for 60 seconds and a final elongation step of five minutes at 72ºC. Reactions were performed in 25 µL volumes containing 1 µL of genomic DNA, 1 µL primer, 0.5 µL of Taq DNA polymerase, 0.5 µL dNTPs, and 2.5 10x PCR buffer. Then 5 µL of the PCR products were electrophoresed in 1.5% wt/vol agarose gel for 40 minutes at 80 V in 1x TAE buffer. All PCR products were stained with ethidium bromide (1 mg/L) and visualized under UV light; 100bp DNA ladder (Gibco, Paisley, UK) was used as a size marker (M) in all products.

3.3. SCCmec Typing

SCCmec typing was performed according to the previously described protocol of Zhang et al. (12). The PCR was run under the following conditions: denaturation step at 94ºC for five minutes followed by 10 cycles of 94ºC for 45 seconds, 65ºC for 45 seconds, and 72ºC for 90 seconds and another 25 cycles of 94ºC for 45 seconds, 55ºC for 45 seconds, and 72ºC for 90 seconds, ending with a final extension step at 72ºC for 10 minutes and followed by a hold at 4ºC. The PCR amplicons were visualized via UV light after electrophoresis on a 2% wt/vol agarose gel containing 0.5 µg/mL ethidium bromide.

3.4. Pulsed-Field Gel Electrophoresis

PFGE was carried out as previously described (13). DNA was digested by SmaI restriction enzyme (New England) and loaded into 1% agarose gel and ran at 14ºC in TBE using a CHEF-DR III system (Bio-Rad). The PFGE was performed at 200 V with an initial switch time of five seconds and final switch time of 40 seconds, the included angle was 120ºC and the total run time was 21 hours. The generated DNA fingerprints were analysed according to the criteria proposed by Tenover et al. (14). BioNumerics software was used to determine similarities of banding patterns (version 4.5; Applied Maths). The cluster analysis was conducted via the unweighted pair group method analysis (UPGMA). Isolates with a coefficient of similarity ≥ 75% were considered one pulsotype and labelled alphabetically. In addition, isolates with a coefficient of similarity ≥ 50% were grouped in a separate pulsotype. Isolates with a similarity between 50% and 75% were regarded as PFGE subtypes.

3.5. Statistics

Data were transferred to the statistical package for social science (SPSS) software version 19 for analysing.

4. Results

4.1. MRSA and MSSA

Amongst the 114 strains, 59 isolates were resistant to oxacillin.

4.2. mecA, SCCmec and PVL

The presence of mecA, the genes encoding SCCmec type and PVL toxin were investigated. All MRSA strains were positive for mecA. Additionally, the SCCmec types I, II and III were screened among the MRSA isolates, SCCmec types I, II and III were 31% (18 isolates), 20.1% (12 isolates) and 20.1% (12 isolates), respectively. Additionally, 19.2% of the strains were type IV (10 strains). Among the 114 isolated S.aureus, 10 strains carried the genes encoding PVL: six for MRSA and four for MSSA.

4.3. PFGE

All 114 S.aureus isolates were clustered into eight predominant PFGE pulsotypes (designated types A – H) (Table 1). The most prevalent PFGE type was type A (n = 43, 37.7%). Isolates with type A had 7 subtypes named A1 – A7, and among them the most predominant subtype was A1 (10/44). Isolates with type B had three subtypes B1 - B3. Other pulsotypes, C, D, E, F, G and H were less common with fewer subtypes, C1 and C2 and D1 and D2. Pulsotypes E - H had no subtypes (Table 2).

Table 1. The Number of Strain Pulsotype in Staphylococcus aureus Strains Isolated From Healthcare Workers in Iraq
PulsotypeMRSAMSSAStrains, No. (%)
A212243 (37.7)
B131225 (21.9)
C5510 (8.77)
D6410 (8.77)
E8210 (8.77)
F336 (5.26)
G145 (4.38)
H235 (4.38)
Total5955114

The Number of Strain Pulsotype in Staphylococcus aureus Strains Isolated From Healthcare Workers in Iraq

Table 2. The Distribution of SCCmec in Methicillin-Resistant Staphylococcus aureus Strains According to the Pulsotype
PulsotypeNumber of SCCmec
IIIIIIIVaIVbIVdIVcVTotalUntypable
A95221100201
B33420000121
C1012000041
D4001100060
E1410000062
F0020000021
G0000000001
H0020000020
Total18121272100527

The Distribution of SCCmec in Methicillin-Resistant Staphylococcus aureus Strains According to the Pulsotype

5. Discussion

This project showed that all MRSA strains were positive for mecA and the rate of strains harbouring SCCmec types I, II and III were 31%, 20.1% and 20.1%, respectively. SCCmec type IV was less common than other genotypes since 19.2% of the strains were SCCmec type IV. Such a diversity was also found in Iran (15), where 3.4% of MRSA strains were found to be SCCmec type I, 13.8% SCCmec type II, 9.2% SCCmec type IVb, 4.6% SCCmec type IVd and 3.4% SCCmec type V. In the same study, there was also a high frequency of non-typeable strains as 58.6% of MRSA strains were non-typeable. However, such diversity was not found in in Turkey since the study showed that 22 MRSA isolates which were tested for SCCmec types were SCCmec type III (16). The analysis of MRSA isolates in Holland showed that 8% of nosocomial isolates carry the locus for PVL. In Iran, the prevalence of MRSA, the pvl gene and MRSA-PVL isolates were 32%, 19%, and 10%, respectively (17). In Germany, the prevalence of MRSA isolates among HCWs was 11.3%, among which 9.1% of the isolates were positive for PVL (18). Worldwide, there is an increase in the spread of PVL-positive MRSA clones (19). The current study found that the prevalence of pvl gene, MSSA-PVL and MRSA-PVL isolates were 16.9%, 6.8% and 10.1 % respectively. This study should be considered preliminary and further use of molecular studies to monitor the epidemiology of MRSA and its evolution in these hospitals in the country is highly recommended. Pulsed Field Gel Electrophoresis (PFGE) is considered the gold standard typing method for epidemiological tracing of a variety of bacterial species including S. aureus since it is highly discriminatory, stable and reproducible (20). Newer techniques such as multilocus sequence typing (MLST), spa-typing and DNA sequencing allow typing equally well as the PFGE. However, the need for trained staff and highly expensive equipment made the use and the availability of these techniques difficult in Iraq. In the current study, more than 50% of S. aureus isolates were pulsotype A or B indicating that they might have spread from the same sources. In addition, the obtained data should be considered as baseline information and to understand the changes in the prevalence of molecular subtypes and the transmissibility pattern of such strains, further studies are needed to investigate isolates from clinical samples and compare them to strains obtained from healthcare workers. To conclude, more than a quarter of the current studied strains harboured SCCmec type I. Staphylococcus aureus isolates were clustered into eight predominant PFGE pulsotypes and the most prevalent PFGE type was type A. Further use of molecular studies to monitor the epidemiology of MRSA and its transmission patterns in these hospitals in the country is highly recommended.

Footnotes

References

  • 1.
    Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol. 2008;8(6):747-63. [PubMed ID: 18718557]. https://doi.org/10.1016/j.meegid.2008.07.007.
  • 2.
    Kim J. Understanding the Evolution of Methicillin-Resistant Staphylococcus aureus. J. Clin Microbiol. 2009;31(3):17-23. https://doi.org/10.1016/j.clinmicnews.2009.01.002.
  • 3.
    Assafi MS, Mohammed RQ, Hussein NR. Nasal carriage rates of staphylococcus aureus and ca-methicillin resistant staphylococcus aureus among university students. Int J Microbiol Res. 2015;5(4):123-7.
  • 4.
    Hussein NR, Alyas A, Majeed M, Assafi MS. Prevalence rate and prevalent genotypes of ca-mrsa in kurdistan region: First report from iraq. Int. J. Pure Appl. Sci. Technol. 2015;27(1):44-9.
  • 5.
    Hussein NR, Basharat Z, Muhammed AH, Al-Dabbagh SA. Comparative evaluation of MRSA nasal colonization epidemiology in the urban and rural secondary school community of Kurdistan, Iraq. PLoS One. 2015;10(5):e0124920. [PubMed ID: 25932644]. https://doi.org/10.1371/journal.pone.0124920.
  • 6.
    David MZ, Daum RS. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev. 2010;23(3):616-87. [PubMed ID: 20610826]. https://doi.org/10.1128/CMR.00081-09.
  • 7.
    2004.Performance standards for antimicrobial susceptibility testing, 14th informational supplement.
  • 8.
    Tenover FC, Moellering RC. The rationale for revising the Clinical and Laboratory Standards Institute vancomycin minimal inhibitory concentration interpretive criteria for Staphylococcus aureus. Clin Infect Dis. 2007;44(9):1208-15. [PubMed ID: 17407040]. https://doi.org/10.1086/513203.
  • 9.
    Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29(10):2240-4. [PubMed ID: 1939577].
  • 10.
    Moussa I, Shibl AM. Molecular characterization of methicillin-resistant Staphylococcus aureus recovered from outpatient clinics in Riyadh, Saudi Arabia. SAUDI MED J. 2009;30(5):611-7. [PubMed ID: 19417957].
  • 11.
    McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci. J Clin Microbiol. 2006;44(3):1141-4. [PubMed ID: 16517915]. https://doi.org/10.1128/JCM.44.3.1141-1144.2006.
  • 12.
    Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43(10):5026-33. [PubMed ID: 16207957]. https://doi.org/10.1128/JCM.43.10.5026-5033.2005.
  • 13.
    McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK, Tenover FC. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol. 2003;41(11):5113-20. [PubMed ID: 14605147].
  • 14.
    Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33(9):2233-9. [PubMed ID: 7494007].
  • 15.
    Zeinali E, Moniri R, Musavi GH. Antibiotic resistance and molecular subtypes of clinical methicillin-resistant Staphylococcus aureus in a teaching hospital. Indian J Med Microbiol. 2011;29(3):318-9. [PubMed ID: 21860123]. https://doi.org/10.4103/0255-0857.83926.
  • 16.
    Mert G, Kiliç A, Bedir O, Başustaoğlu AC. Clinical significance and staphylococcal cassette chromosome mec (SCCmec) characterization of coagulase-negative staphylococci isolated from blood cultures. Turk J Med Sci. 2011;41(5):859-65.
  • 17.
    Lari AR, Pourmand MR, Ohadian Moghadam S, Abdossamadi Z, Namvar AE, Asghari B. Prevalence of pvl-containing mrsa isolates among hospital staff nasal carriers. Laboratory Medicine. 2011;42(5):283-6. https://doi.org/10.1309/lman7hr6vjea3nmr.
  • 18.
    Maltezou HC, Vourli S, Katerelos P, Maragos A, Kotsalidou S, Remoudaki E, et al. Panton-Valentine leukocidin-positive methicillin-resistant Staphylococcus aureus outbreak among healthcare workers in a long-term care facility. Int J Infect Dis. 2009;13(6):e401-6. [PubMed ID: 19395300]. https://doi.org/10.1016/j.ijid.2009.02.004.
  • 19.
    Tristan A, Bes M, Meugnier H, Lina G, Bozdogan B, Courvalin P, et al. Global distribution of Panton-Valentine leukocidin--positive methicillin-resistant Staphylococcus aureus, 2006. Emerg Infect Dis. 2007;13(4):594-600. [PubMed ID: 17553275]. https://doi.org/10.3201/eid1304.061316.
  • 20.
    Faria NA, Carrico JA, Oliveira DC, Ramirez M, de Lencastre H. Analysis of typing methods for epidemiological surveillance of both methicillin-resistant and methicillin-susceptible Staphylococcus aureus strains. J Clin Microbiol. 2008;46(1):136-44. [PubMed ID: 17989188]. https://doi.org/10.1128/JCM.01684-07.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.