Sequential Emergence of Resistance to Multiple Antimicrobial Agents in KPC-Producing-Klebsiella pneumoniae

Authors

Marcela Nastro1,*, Carlos Hernan Rodriguez1, Claudia Barberis1, Carlos Vay1, Angela Famiglietti1
1Department of Clinical Biochemistry, Bacteriology Laboratory, Hospital de Clinicas Jose de San Martin, School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina
*Corresponding Author: Corresponding author: Marcela Nastro, Bacteriology Laboratory, Hospital de Clinicas Jose de San Martin, School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina. Tel: +54-1159508670, Fax: +54-1159508694, E-mail: Email: [email protected]

International Journal of Infection:Vol. 1, issue 2; e18673
Published online:Jul 20, 2014
Article type:Case Report
Received:Mar 02, 2014
Accepted:May 17, 2014
How to Cite:Nastro M, Rodriguez CH, Barberis C, Vay C, Famiglietti A. Sequential Emergence of Resistance to Multiple Antimicrobial Agents in KPC-Producing-Klebsiella pneumoniae. Int J Infect. 2014;1(2):e18673. doi: https://doi.org/10.17795/iji-18673

Abstract

Introduction:

Klebsiella pneumoniae is one of the most important gram-negative bacteria causing hospital-acquired infections.

Case Presentation:

In this report is presented a patient with an abdominal infection caused by carbapenemase producing-Klebsiella pneumonia (K. pneumonia). In spite of administrating the combination therapy, successive resistance to last-resort antimicrobial agents (colistin and tigecycline) was observed. The use of combination therapy, in four successive isolates recovered from this patient, was analyzed by killing curves. The genetic relatedness among the isolates was assessed.

Conclusions:

All four isolates were Klebsiella pneumoniae<b> </b>carbapenemase (KPC) positive and showed resistance to all β-lactams including carbapenems and to other antimicrobial agents like aminoglycosides, fluoroquinolones, minocycline and trimetoprim-sulfametoxazol (TMS). Isolates 1 and 2 showed susceptibility to colistin, whereas isolate 3 was colistin-resistant and isolate 4 became tigecycline-resistant as well. Synergy was only observed with colistin plus rifampicin and with the triple combination of colistin, rifampicin and fosfomycin. The four isolates were indistinguishable genotypically. We described the sequential emergence of resistance to colistin and tigecycline in KPC-producing-K. pneumonia (KPC-Kp) isolates that occurred under treatment with these antimicrobial agents despite the use of combination therapy.

1. Introduction

Klebsiella pneumoniae is one of the most prevalent nosocomial pathogens due to its ability to be recipient of resistance genes. Over the last years it has acquired resistance to multiple antimicrobial agents, mediated by the presence of extended spectrum β-lactamases and carbapenemases, porin loss and acquisition of efflux pumps. KPC-producing K. pneumoniae (KPC-Kp) isolates are widely disseminated in our country, especially in Buenos Aires city. In our hospital, KPC-Kp strains have a widespread presence since 2010 (1).

2. Case Presentation

We reported a patient with an abdominal infection caused by KPC-Kp that developed successive resistance to last-resort antimicrobial agents (colistin and tigecycline), during the treatment in spite of receiving a combination therapy. A 66-year-old-man with diabetes mellitus and gout disease was admitted. He underwent a urinary surgery in July 2012. Forty-eight hours later, he had a gastric ulcer perforation and was consequently operated. Vancomycin plus imipenem were administered as prophylaxis. A rectal swab was obtained and analyzed to confirm colonization by multidrug resistant gram-negative bacteria a week after his admission. KPC-Kp was recovered from this culture (isolate 1). His evolution was not favorable. Abdominal samples were taken to the laboratory, after each course of drainage. KPC-Kp was recovered (isolate 2) and the patient received the combination tigecycline (TGC) plus colistin (CT) for seven days, until isolate 3 (CT-resistant) was recovered, when rifampicin (RIF) was added. The triple combination therapy was maintained for 10 days. Isolate 4 (TGC-resistant) was recovered from the third abdominal sample and consequently TGC was replaced by fosfomycin (FOS). The patient died on September 27th, after nearly two months of hospitalization. The objective of this study was to analyze the use of combination therapy in the four successive isolates from this patient.
All isolates were identified using conventional methodology and minimal inhibitory concentrations (MICs) of imipenem (IMI), meropenem (MEM), rifampicin (RIF), CT, TGC and FOS were determined by agar dilution method and interpreted according to the Clinical and Laboratory Standards Institute (2), the European Committee on Antimicrobial Susceptibility Testing (3) for CT and FOS and Societe Française de Microbiologie (4) for RIF. Tigecycline susceptibility testing was based on the Food and Drug Administration breakpoints for Enterobacteriaceae (5). The double disc synergy test with phenylboronic acid (PBA) and carbapenems was performed for the phenotypic identification of KPC-Kp. The presence of blaKPC was confirmed by PCR amplification, performed using heat-extracted DNA as template and using specific primers: KPC-F: 5´ATGTCACTGTATCGCCGTCT 3' and KPC-R: 5' TTTTCAGAGCCTTACTGCCC 3'and conditions previously described (initial denaturation at 95°C for five minutes, annealing at 95° for one minute, at 55° for one minute, at 72° for one minute (30 cycles) and a final extension period at 72° for five minutes) (6). The amplified products were sequenced and nucleotide sequences were compared using BLAST (the National Center for Biotechnology Information, Bethesda, MD, USA, www.ncbi.nlm.nih.gov/Tools/). The genetic relatedness among the isolates was studied by DO-PCR, using primer AP/OD 19: GGTCGACYTTNGYNGGRTC and the following conditions: initial denaturation at 95° for five minutes, annealing at 93° for one minute, at 36° for 1.5 minutes, at 72° for two minutes (40 cycles) and an extension period at 72° for ten minutes (7). The activity of the different associations CT/RIF, CT/TIG, CT/MEM, CT/FOS, FOS/RIF, FOS/TGC and CT/FOS/RIF was determined by killing curves. The time-kill studies were performed twice and therefore, results were analyzed for each isolate, using the mean colony count values from the duplicate plates. The Mueller Hinton broth was inoculated with 5x105 CFU/mL of each isolate in a log phase/mL and killing was assessed at 0, four and 24 hours following incubation at 37°C. The following concentrations were used for the time-kill experiments: 2 mg/L CT, 100 mg/L FOS, 4 mg/L TGC, 10 mg/L MEM and 4 mg/L RIF. Synergism was defined as ≥ 2-log10 CFU/ mL decrease in the viable count, with the combination compared to the most active single agent at different time points. Bactericidal activity was defined as ≥ 3-log10 CFU/mL decrease from the original inoculum at 24 hours and synergy was defined as ≥ 2-log10 CFU/mL decrease between the combination and the most active compound (8). The presence of resistant subpopulations (able to grow in the presence of > 2 mg/L of colistin and tigecycline) in the COL and TIG-susceptible isolates was evaluated by population analysis profile (PAP), using a previously reported method (9).

3. Discussion

The phenotypic double-disc test with PBA showed positive results in all the four K. pneumoniae isolates and the presence of the blaKPC-2 gene was lately confirmed by PCR, followed by sequencing. The isolates were resistant to all β-lactams, including carbapenems, and to other antimicrobial agents like aminoglycosides, fluoroquinolones, minocycline and TMS (data not showed in tables). The IMI, MEM, CT, TGC, RIF and FOS MIC values are demonstrated in Table 1. In time-kill studies colistin showed bactericidal activity at four hours, but regrowth was observed at 24 hours. Regarding the combination studies, the combinations of CT with RIF, MEM and TGC exhibited indifferent effects against isolate 2, whereas the combination of CT with RIF exhibited synergy against isolate 3 in spite of its CT MIC of 64 mg/L. Tigecycline did not have a synergistic effect with any of the antimicrobial agents tested. Although FOS alone and in combination with RIF and CT showed bactericidal activity at four hours, the bactericidal effect was only observed at 24 hours, when FOS was combined with CT and RIF simultaneously. Antagonism was not observed in any of the isolates studied (Table 1).
Table 1.
In Vitro Activities of Different Antimicrobial Agents and Their Combinations Against the Four Klebsiella. pneumoniae Isolates and Therapy Installeda
DateIsolateMIC, mg/LCombination StudiesTreatment
IMIMEMCTTGCRIFFOSCT/TGCCT/RIFCT/MEMCT/FOSTGC/RIFFOS/RIFFOS/TGCCT/FOS/RIF
7/81323210.06> 648NDNDNDNDNDNDNDNDCT, TGC
29/82323210.06> 648IIINDINDNDNDCT, TGC,RIF
6/933232640.25> 648ISINDNDNDNDNDCT, FOS, RIF
16/9432326416> 648NDNDNDIIIIS
aAbbreviations: S, synergy; I, indifference; ND, not determined; CT, colistin; MEM, meropenem; IMI, imipenem; RIF, rifampicin; FOS, fosfomycin; TGC, tigecycline; MIC, minimal inhibitory concentration.
Colistin-resistant subpopulations (MIC > 2 mg/L) were observed in isolates 1 and 2, whereas TGC-resistant subpopulations were not observed in isolates 1, 2 or 3. All four isolates showed similar band patterns in DO-PCR results, indicating clonal relatedness. Intra-abdominal infections often require both antibiotic therapy and surgical management, therefore, drainage of the source is considered critical in these infections. Combination therapy is strongly recommended to deal with severe infections, caused by multidrug resistant (MDR) strains. Several studies have supported the use of more than one antimicrobial agent and mortality rates were lower in most patients who received combination regimens (10). However, MDR strains are mostly resistant to at least one of the antimicrobial agents used in the clinical practice, the possibility of selection of resistance, influenced by infection and host factors, is undoubtedly high. Very few in vivo studies have been developed to assess the efficacy of triple drug combinations to treat infections by MDR strains and most of these in vitro studies were conducted on Acinetobacter spp. or Pseudomonas aeruginosa strains (11). Urban et al. (12) assessed K. pneumoniae and Escherichia coli isolates and obtained bactericidal activity in 90% of the isolates studied, using the polymyxin, B-doripenem-RIF combination. In the present study the patient received double combination of TGC plus CT approximately for a week. Nevertheless, the selection of CT-resistance could not be prevented. Colistin heteroresistance is very frequent in KPC-Kp isolates (9, 13). We observed the presence of COL-resistant subpopulations in a previous study in almost 90% of the KPC-Kp isolates in our hospital. These resistant subpopulations may have a role in therapeutic failure, due to the absence of synergy between CT and TGC. In killing curves, CT plus TGC did not prevent the regrowth of these CT-resistant subpopulations at 24 hours of incubation. Isolate 4 became TGC-resistant, probably due to the selective pressure induced by the treatment with this drug (17 days) and by the poor microbiological clearance of the infection. Resistance to TGC has been described in Enterobacteriaceae (14, 15) and the mechanism proposed is an increased expression of some activators of the AcrAB efflux pump and porin OmpF (16).
In accordance with poor clinical results, we did not observe in vitro synergy with the TGC associations in any of the three isolates, contrary to what was shown by Pournaras et al. (17), who observed bactericidal activity with TGC plus CT combination, although a regrowth at 16-24 hours was detected in some of the studied strains. The CT and RIF combination had synergistic effects on CT-resistant isolates, as it was previously described (8). Nevertheless, this treatment scheme was not installed. The CT and MEM combination did not exhibit synergy, probably due to the high MEM MIC value (32 mg/L); previous studies stated that the combination of carbapenems with other antimicrobial agents would be effective in the treatment of carbapenemase-producing gram-negative bacteria, if the carbapenem MIC is ≤ 4 mg/L (18). FOS should always be used in association with other active agents due to its ability to select resistant mutants (19). Nevertheless, there are few reports of emergence of resistance to FOS, when used in double/ triple regimens against KPC-Kp (20), therefore additional in vitro studies should be performed to assess its role in the treatment of severe infections caused by these strains. In this case, we observed a rapid decrease in the CFU/mL at 4 hours, by time-killing studies, when tested in isolation, but at 24 hours an important regrowth was observed in all isolates. This regrowth was not prevented by adding other antimicrobial agents, like RIF, TGC or CT. Bactericidal activity was only obtained when a triple combination of agents was tested: FOS/CT/RIF, by means of the inhibition of these subpopulations. However, in vivo performance could not be evaluated. To the best of our knowledge, we described the first case of sequential emergence of resistance to colistin and tigecycline in KPC-Kp isolates, occurring under treatment with these antimicrobial agents. Undoubtedly, the impossibility to eradicate the source of infection by surgical measures promotes the selection of multiple mechanisms of antimicrobial resistance. The emergence of KPC-Kp isolates and the remarkable ability of these strains to become MDR, necessitate evaluating new combination studies and double therapy regimens should be progressively replaced by triple ones. We also reinforce the idea that strict control of infection policies should be implemented as a solution to these clinical situations.

Acknowledgments

Footnotes

  • Financial Disclosure:Authors declared no financial interests related to the material in the manuscript.

  • Funding/Support:This work was supported by grants from the Secretaría de Ciencia y Técnica de la Universidad de Buenos Aires (UBACyT 01 W296) to Angela Famiglietti.

References

  • 1.
    Cejas D, Fernandez Canigia L, Nastro M, Rodriguez C, Tanco A, Rodriguez H, et al. Hyperendemic clone of KPC producing Klebsiellapneumoniae ST 258 in Buenos Aires hospitals. Infect Genet Evol. 2012;12(3):499-501. [PubMed ID: 21986471]. https://doi.org/10.1016/j.meegid.2011.09.018.
  • 2.
    Wayne D. 2011.Clinical and Laboratory Standards Institute(CLSI) document M100-S21 Performance Standards for Antimicrobial Susceptibility Testing 21st Informational Supplement.
  • 3.
    Basel Switzerland; 2009.Breakpoint tables for interpretation of MICs and zone diameters Version 1.0.
  • 4.
    Members of the SFMAC. Comite de l'Antibiogramme de la Societe Francaise de Microbiologie report 2003. Int J Antimicrob Agents. 2003;21(4):364-91. [PubMed ID: 12672587].
  • 5.
    Bradford PA. Tigecycline: a first in class glycylcycline. Clin Microbiol Newsl. 2004;26(21):163-8. https://doi.org/10.1016/j.clinmicnews.2004.10.001.
  • 6.
    Bradford PA, Bratu S, Urban C, Visalli M, Mariano N, Landman D, et al. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 beta-lactamases in New York City. Clin Infect Dis. 2004;39(1):55-60. [PubMed ID: 15206053]. https://doi.org/10.1086/421495.
  • 7.
    Limansky AS, Viale AM. Can composition and structural features of oligonucleotides contribute to their wide-scale applicability as random PCR primers in mapping bacterial genome diversity? J Microbiol Methods. 2002;50(3):291-7. [PubMed ID: 12031579].
  • 8.
    Rodriguez CH, De Ambrosio A, Bajuk M, Spinozzi M, Nastro M, Bombicino K, et al. In vitro antimicrobials activity against endemic Acinetobacter baumannii multiresistant clones. J Infect Dev Ctries. 2010;4(3):164-7. [PubMed ID: 20351457].
  • 9.
    Poudyal A, Howden BP, Bell JM, Gao W, Owen RJ, Turnidge JD, et al. In vitro pharmacodynamics of colistin against multidrug-resistant Klebsiella pneumoniae. J Antimicrob Chemother. 2008;62(6):1311-8. [PubMed ID: 18922815]. https://doi.org/10.1093/jac/dkn425.
  • 10.
    Levy Hara G, Gould I, Endimiani A, Pardo PR, Daikos G, Hsueh PR, et al. Detection, treatment, and prevention of carbapenemase-producing Enterobacteriaceae: recommendations from an International Working Group. J Chemother. 2013;25(3):129-40. [PubMed ID: 23783137]. https://doi.org/10.1179/1973947812Y.0000000062.
  • 11.
    Rahal JJ. Novel antibiotic combinations against infections with almost completely resistant Pseudomonas aeruginosa and Acinetobacter species. Clin Infect Dis. 2006;43 Suppl 2:S95-9. [PubMed ID: 16894522]. https://doi.org/10.1086/504486.
  • 12.
    Urban C, Mariano N, Rahal JJ. In vitro double and triple bactericidal activities of doripenem, polymyxin B, and rifampin against multidrug-resistant Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Escherichia coli. Antimicrob Agents Chemother. 2010;54(6):2732-4. [PubMed ID: 20368401]. https://doi.org/10.1128/AAC.01768-09.
  • 13.
    Meletis G, Tzampaz E, Sianou E, Tzavaras I, Sofianou D. Colistin heteroresistance in carbapenemase-producing Klebsiella pneumoniae. J Antimicrob Chemother. 2011;66(4):946-7. [PubMed ID: 21393203]. https://doi.org/10.1093/jac/dkr007.
  • 14.
    Spanu T, De Angelis G, Cipriani M, Pedruzzi B, D'Inzeo T, Cataldo MA, et al. In vivo emergence of tigecycline resistance in multidrug-resistant Klebsiella pneumoniae and Escherichia coli. Antimicrob Agents Chemother. 2012;56(8):4516-8. [PubMed ID: 22644031]. https://doi.org/10.1128/AAC.00234-12.
  • 15.
    Rodriguez-Avial C, Rodriguez-Avial I, Merino P, Picazo JJ. Klebsiella pneumoniae: development of a mixed population of carbapenem and tigecycline resistance during antimicrobial therapy in a kidney transplant patient. Clin Microbiol Infect. 2012;18(1):61-6. [PubMed ID: 21722259]. https://doi.org/10.1111/j.1469-0691.2011.03482.x.
  • 16.
    Ruzin A, Visalli MA, Keeney D, Bradford PA. Influence of transcriptional activator RamA on expression of multidrug efflux pump AcrAB and tigecycline susceptibility in Klebsiella pneumoniae. Antimicrob Agents Chemother. 2005;49(3):1017-22. [PubMed ID: 15728897]. https://doi.org/10.1128/AAC.49.3.1017-1022.2005.
  • 17.
    Pournaras S, Vrioni G, Neou E, Dendrinos J, Dimitroulia E, Poulou A, et al. Activity of tigecycline alone and in combination with colistin and meropenem against Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae strains by time-kill assay. Int J Antimicrob Agents. 2011;37(3):244-7. [PubMed ID: 21236643]. https://doi.org/10.1016/j.ijantimicag.2010.10.031.
  • 18.
    Daikos GL, Markogiannakis A. Carbapenemase-producing Klebsiella pneumoniae: (when) might we still consider treating with carbapenems? Clin Microbiol Infect. 2011;17(8):1135-41. [PubMed ID: 21635663]. https://doi.org/10.1111/j.1469-0691.2011.03553.x.
  • 19.
    Endimiani A, Patel G, Hujer KM, Swaminathan M, Perez F, Rice LB, et al. In vitro activity of fosfomycin against blaKPC-containing Klebsiella pneumoniae isolates, including those nonsusceptible to tigecycline and/or colistin. Antimicrob Agents Chemother. 2010;54(1):526-9. [PubMed ID: 19901089]. https://doi.org/10.1128/AAC.01235-09.
  • 20.
    Karageorgopoulos DE, Miriagou V, Tzouvelekis LS, Spyridopoulou K, Daikos GL. Emergence of resistance to fosfomycin used as adjunct therapy in KPC Klebsiella pneumoniae bacteraemia: report of three cases. J Antimicrob Chemother. 2012;67(11):2777-9. [PubMed ID: 22782489]. https://doi.org/10.1093/jac/dks270.

Copyright

Copyright © 2014, Infectious Diseases and Tropical Medicine Research Center. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

24
Feb
2026
Investigation of  in-vitro Efficacy of Antibiotic Combinations and Presence of Carbapenemases in Multidrug-Resistant Klebsiella pneumoniae Isolates

Investigation of in-vitro Efficacy of Antibiotic Combinations and Presence of Carbapenemases in Multidrug-Resistant Klebsiella pneumoniae Isolates

Pelin Kamuran Duran Aksoy,
Emel Caliskan

Kamuran Duran Aksoy P, Caliskan E. Investigation of in-vitro Efficacy of Antibiotic Combinations and Presence of Carbapenemases in Multidrug-Resistant Klebsiella pneumoniae Isolates. Jundishapur J Microbiol. 2026;19(2):e169256. doi: https://doi.org/10.5812/jjm-169256

16
Jul
2025
Characteristics of Colistin-Resistant and Colistin-Sensitive Isolates of Carbapenem-Resistant Klebsiella pneumoniae Among Hospitalized Patients in Tehran, Iran

Characteristics of Colistin-Resistant and Colistin-Sensitive Isolates of Carbapenem-Resistant Klebsiella pneumoniae Among Hospitalized Patients in Tehran, Iran

Maryam Barkhordari,
Azade Hajihasani,
Masoumeh Rasouli-Nasab,
Fereshteh Shahcheraghi

Barkhordari M, Hajihasani A, Rasouli-Nasab M, Shahcheraghi F. Characteristics of Colistin-Resistant and Colistin-Sensitive Isolates of Carbapenem-Resistant Klebsiella pneumoniae Among Hospitalized Patients in Tehran, Iran. Jundishapur J Microbiol. 2025;18(7):e158620. doi: https://doi.org/10.5812/jjm-158620

10
May
2021
Co-occurrence of Carbapenemase-encoding Genes Among Klebsiella pneumoniae Clinical Isolates: Positive Relationship of bla NDM and bla SIM with Imipenem Resistance

Co-occurrence of Carbapenemase-encoding Genes Among Klebsiella pneumoniae Clinical Isolates: Positive Relationship of bla NDM and bla SIM with Imipenem Resistance

Maryam Galehdar,
Maryam Ghane,
Laleh Babaeekhou

Galehdar M, Ghane M, Babaeekhou L. Co-occurrence of Carbapenemase-encoding Genes Among Klebsiella pneumoniae Clinical Isolates: Positive Relationship of bla NDM and bla SIM with Imipenem Resistance. Jundishapur J Microbiol. 2021;14(2):e112486. doi: https://doi.org/10.5812/jjm.112486

28
Jan
2018
Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem

Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem

Prasanth Manohar,
Thamaraiselvan Shanthini,
Pandey Ekta,
Mahesan J B,
Kodiveri Muthukaliannan Gothandam,
Bulent Bozdogan
,et al.

Manohar P, Shanthini T, Ekta P, J B M, Muthukaliannan Gothandam K, et al. Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem. Arch Clin Infect Dis. 2018;13(1):e55099. doi: https://doi.org/10.5812/archcid.55099

28
Mar
2020
Meropenem Combined with Ertapenem Rescues a Patient with Multi-Drug Resistant Klebsiella pneumoniae V113 Isolate Infection and Acute-on-Chronic Liver Failure: A Case Report

Meropenem Combined with Ertapenem Rescues a Patient with Multi-Drug Resistant Klebsiella pneumoniae V113 Isolate Infection and Acute-on-Chronic Liver Failure: A Case Report

Jianchun Lu,
Tianmin Xu,
Chunhua Chen,
Shuqin Zheng,
Lin Lin,
Yuan Xue

Lu J, Xu T, Chen C, Zheng S, Lin L, et al. Meropenem Combined with Ertapenem Rescues a Patient with Multi-Drug Resistant Klebsiella pneumoniae V113 Isolate Infection and Acute-on-Chronic Liver Failure: A Case Report. Hepat Mon. 2020;20(3):e99709. doi: https://doi.org/10.5812/hepatmon.99709

More by these authors

Marcela NastroPubMedScholar
Carlos Hernan RodriguezPubMedScholar
Claudia BarberisPubMedScholar
Carlos VayPubMedScholar
Angela FamigliettiPubMedScholar
Share
Cited by
Metrics