Effect of Zebularine on p16INK4a, p14ARF, p15INK4b, and DNA Methyltransferase 1 Gene Expression, Cell Growth Inhibition, and Apoptosis Induction in Human Hepatocellular Carcinoma PLC/PRF5 and Pancreatic Cancer PA-TU-8902 Cell Lines

Author(s):
Masumeh SanaeiMasumeh Sanaeia, Fraidoon KavoosiFraidoon Kavoosia,*, Farzane HosseiniFarzane Hosseinib
aResearch Center for Non-Communicable Diseases, Jahrom University of Medical Sciences, Jahrom, Iran.
bStudent of Research Committee, Jahrom University of Medical Sciences, Jahrom, Iran.
*Corresponding Author: Corresponding author: E-mail: [email protected] Email:

IJ Pharmaceutical Research:Vol. 19, issue 4; 193-202
Published online:Oct 31, 2020
Article type:Original Article
Received:Jun 30, 2019
Accepted:Jun 30, 2020
How to Cite:Sanaei M, Kavoosi F, Hosseini F. Effect of Zebularine on p16INK4a, p14ARF, p15INK4b, and DNA Methyltransferase 1 Gene Expression, Cell Growth Inhibition, and Apoptosis Induction in Human Hepatocellular Carcinoma PLC/PRF5 and Pancreatic Cancer PA-TU-8902 Cell Lines. Iran J Pharm Res. 2020;19(4):e124664. doi: https://doi.org/10.22037/ijpr.2020.112223.13614

Abstract

Tumorigenesis must be understood as a summary of altered genetic and genomic changes resulting in the inactivation of tumor suppressor genes (TSGs). One of the characterizations of epigenetic alterations is DNA methylation. Epigenetic alteration of the p16INK4a, p14ARF, p15INK4b, and DNA methyltransferase 1 gene (DNMT1) expression occurs in hepatocellular carcinoma (HCC) and pancreatic cancer frequently. DNA methyltransferase inhibitors (DNMTIs), such as zebularine, play a significant effect on the demethylation and reactivation of TSGs. This study aimed to investigate the effect of zebularine on p16INK4a, p14ARF, p15INK4b, and DNA methyltransferase 1 gene expression, cell growth inhibition, and apoptosis induction in HCC PLC/PRF5 and pancreatic cancer PA-TU-8902 cell lines. Both cell lines were cultured and treated with zebularine at different times. The MTT assay, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR), and flow cytometry were used to determine cell viability, gene expression, and apoptotic cells, respectively. The result indicated that zebularine inhibited cell growth of both cell lines significantly as time- and dose-dependent manner (P < 0.007). The agent induced significant down-regulation of DNMT1 and up-regulation of p16INK4a, p14ARF, p15INK4b (P < 0.028). Besides, it had a significant apoptosis effect on both cell lines (P < 0.001). This compound had a strong significant effect on PLC/PRF5 in comparison to PA-TU-8902 cells. Concluding, zebularine inhibited PLC/PRF5 and PA-TU-8902 cell growth and induced apoptosis in these cell lines. The most likely mechanism underlying the zebularine played its role involves down-regulation of DNMT1 and up-regulation of p16INK4a, p14ARF, and p15INK4b genes.

Introduction

Hepatocellular carcinoma (HCC) and pancreatic cancers are lethal human cancers with a wide geographical variation (1, 2). As for many other cancers, the development of these cancers must be understood as a summary of altered genetic and genomic changes and also epigenetic alterations in cell cycle regulatory genes resulting in activation of oncogenes and inactivation of tumor suppressor genes (TSGs). In contrast to genetic events, epigenetic alteration is a reversible change characterized by three mechanisms, including DNA hypermethylation, DNA hypomethylation, and histone modifications affecting chromatin conformation without any change in the structure of DNA sequences (3). Epigenetic alterations of the INK4alpha/ARF or CDKN2A-locus could occur in HCC. The INK4a-ARF locus, located on 9p21, codes three important TSGs, p14ARF, p15INK4b, and p16INK4a, involved in cell-cycle regulation. One of the characterizations of genomic cancer is the DNA methylation change that has also been termed epigenetic alterations. Epigenetic alterations of p14ARF, p15INK4b, and p16INK4a have been demonstrated in HCC and pancreatic cancer (4-6). In addition to HCC and pancreatic cancers, hypermethylation of these genes has been reported in other cancers such as pulmonary squamous cell carcinoma (SqCC), cervical cancer, prostate cancer, and esophageal carcinoma (7-10). DNA hypermethylation is reversible by DNA demethylating agents. Several classes of chemical agents, including adenosine analogs, nucleotide analogs, aminobenzoic derivatives, hydrazines, polyphenols, disulfides, phthalides, and antisenses, are evaluated as DNMTIs targeting DNA hypermethylation. These compounds can induce demethylation, which leads to reactivation of hypermethylated TSGs resulting in apoptosis induction in cancer cells. The significant effect of DNA methyltransferase inhibitors (DNMTIs), such as 5-aza-2′-deoxycytidine (5-aza-CdR) and zebularine [1-(beta--ribofuranosyl)-1, 2-dihydropyrimidin-2-one] on HCC (11, 13), and pancreatic cancers (14-16) has been reported by several studies. Consequently, DNA demethylation is the molecular mechanism by which the demethylating agents such as zebularine and 5-aza-CdR affect silenced TSGs. Indeed, zebularine can restore silenced TSGs by inhibition of DNA methyltransferase 1 (DNMT1) activity. An experimental study has demonstrated that this agent incorporates into DNA and exhibits cell growth inhibition by DNMT1 inhibition in human cancer cell lines, including T24 bladder cancer, SW48, HCT15, and HT-29 colon cancer, PC3 prostate cancer, CFPAC-1 pancreatic cancer, and CALU-1 lung cancer (17). A preclinical study has indicated that mRNA expression of p14ARF could be reactivated in methylated neuroblastoma cells (18). Other researches have reported that zebularine is an effective inhibitor of p15INK4B and p16INK4a methylation and reactivates these methylated genes leads to cell growth inhibition in AML and T24 bladder carcinoma cells, respectively (19, 20). In addition to zebularine, it has been shown that DNA demethylating agent 5-aza-CdR can reactivate methylated p16INK4a in HCC HepG2 ‘and HuH6, HuH7, and HLF cell lines (21, 22). Previously, we reported the effect of 5-aza-CdR on DNMT1 gene expression and apoptosis induction in the HCC WCH-17 cell line (23). The results of other researchers and our previous results encouraged us to design the present study. The aim of this study was to investigate the effect of zebularine on p16INK4a, p14ARF, p15INK4b, and DNA methyltransferase 1 gene expression, cell growth inhibition, and apoptosis induction in human hepatocellular carcinoma PLC/PRF5 and pancreatic cancer PA-TU-8902 cell lines.

Experimental

Materials
Hepatocellular carcinoma PLC/PRF5 and pancreatic cancer PA-TU-8902 cell lines were purchased from the National Cell Bank of Iran-Pasteur Institute and cultured and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with fetal bovine serum 10% and antibiotics in a humidified atmosphere of 5% CO2 in air at 37 ◦C. Zebularin was provided from Sigma (St. Louis, MO, USA) and dissolved in distilled water as a stock solution. All other experimental solutions were obtained by diluting the provided stock solution. Other agents including, DMSO, antibiotics, 3-[4, 5-dimethyl-2-thiazolyl]-2, 5-diphenyl-2H-tetrazolium bromide (MTT), trypsin-EDTA, Phosphate-buffered saline (PBS), Annexin-V-(FITC), propidium iodide (PI), DMEM were purchased from Sigma. Total RNA extraction kit (TRIZOL reagent) and real-time polymerase chain reaction (PCR) kits (qPCR MasterMix Plus for SYBR Green I dNTP) were obtained from Applied Biosystems Inc. (Foster, CA, USA). This work was approved by the Ethics Committee of Jahrom University of Medical Science with a code number of IR.JUMS.REC.1398.022.
Cell culture and cell viability
The effect of zebularine on PLC/PRF5 and PA-TU-8902 cell viability was investigated using MTT assay, based on the previously described method (23). Briefly, 5 × 105 cells per well were treated with various concentrations of zebularine (0, 10, 25, 50, 75, 100, 250, and 500 μM). After 24 and 48 h of incubation, MTT (0.5 mg/mL PBS) was added to each well and incubated at 37 °C for 3 h to determine the number of living cells. Then the formed formazan crystals were dissolved in DMSO and shaken for 10 min to dissolve all of the crystals. Finally, the optical density was detected by a microplate reader at a wavelength of 570 nM. Each experiment was repeated three times (triplicates).
Cell apoptosis assay
An apoptosis assay was performed to obtain the apoptotic effect of zebularine on PLC/PRF5 and PA-TU-8902 cells, based on the previously described method (24). Briefly, 5 × 105 in 24-well plates were seeded in triplicate and incubated overnight. Then, the PLC/PRF5 and PA-TU-8902 cells were treated with zebularine in indicated concentration (74.65 and 98.82 μM respectively), according to IC50 values, for 24 and 48 h, the control groups were incubated with medium + distilled water, distilled water equivalent to the drug solvent was used. Following the staining of the samples using annexin V-FITC and PI, they were analyzed by FACScan flow cytometry (Becton Dickinson, Heidelberg, Germany).
Real-time quantitative reverse-transcription polymerase chain reaction
(qRT-PCR) analysis
To determine whether zebularine could affect p16INK4a, p14ARF, p15INK4b, and DNA methyltransferase 1 gene expression, qRT-PCR was performed. After treatment times (24 and 48 h), total RNA was isolated from PLC/PRF5 and PA-TU-8902 cells treated with zebularine (74.65 and 98.82 μM respectively) using Trizol reagent (Invitrogen), and cDNA was synthesized from total RNA with Superscript III reverse transcriptase (Invitrogen). The expression of mRNAs was measured by quantitative real-time PCR using StepOnePlus (Applied Biosystem, USA) instrument and SYBER green PCR kit (TaKaRa Bio). The thermocycling condition and the amplification reactions were performed as mentioned previously (26). The primer sequences of the genes are shown in Table 1. GAPDH was used as an endogenous control. Data were analyzed using the comparative Ct (ΔΔct) method.
Statistical analysis
The database was set up with the SPSS 16.0 software package (SPSS Inc., Chicago, Illinois, USA) for analysis. The data were acquired from three tests and are shown as means ± standard deviations. Statistical comparisons between groups were performed with ANOVA (oneway ANOVA) and Turkey test. A significant difference was considered as P < 0.05.

Results

Cell viability
The viability of Hepatocellular carcinoma PLC/PRF5 and pancreatic cancer PA-TU-8902 cell lines treated with zebularine (10, 25, 50, 75, 100, 250, and 500 μM) was determined by MTT assay as mentioned in the method section. The inhibitory effect of zebularine on both PLC/PRF5 and PA-TU-8902 cell lines was dependent on the dose and incubation time, as shown in Figure 1. This agent demonstrated a significant inhibitory effect with all used doses (P < 0.003). IC50 values were obtained with approximately 74.65 and 98.82 μM, as a mean of 24 and 48 h, for PLC/PRF5 and PA-TU-8902 cell lines, respectively.
Cell apoptosis
To determine whether zebularine could induce apoptosis, the PLC/PRF5 and PA-TU-8902 cells were stained using annexin-V-(FITC), as mentioned in the method section. As depicted in Figure 2, significant differences were observed by comparing the amounts of annexin V-single positive zebularine-treated cells to the untreated control groups in both cell lines. The apoptotic effect of the agent on PLC/PRF5 cells in comparison to PA-TU-8902 cells was more significant. Besides, zebularine induced apoptosis in both cell lines in a time-dependent manner, Table 2 and Figure 3. In the apoptotic graph, the upper right quadrant shows the percentage of cells in late apoptosis, the lower right quadrant shows the percentage of cells in early apoptosis, the upper left quadrant shows the percentage of necrotic cells, and the lower left quadrant shows the percentage of viable cells.
Gene expression
The effect of zebularine on p16INK4a, p14ARF, p15INK4b, and DNA methyltransferase 1 gene expression was evaluated by quantitative real-time RT-PCR analysis. The result indicated that treatment with zebularine (24 and 48 h) upregulated p16INK4a, p14ARF, p15INK4b, and down-regulate DNMT1 gene expression significantly in both cell lines, the PLC/PRF5 and PA-TU-8902, Table 3, Figures 4 and 5. The effect of zebularine on the gene expression in PLC/PRF5 cells in comparison to PA-TU-8902 cells was more significant.

Discussion

Cell cycle progression and regulation is a highly-regulated process that involves multiple mechanisms and checkpoints. The molecular mechanism of various stages of the cell cycle has been evaluated during the past decade. The CDKs are a family of enzymes that form the heart of the regulatory machine during the cell cycle progression. The active form of these enzymes includes a complex of two proteins, a kinase, and a cyclin, which form positive regulators and induce cell cycle progression. Whereas CKIs account for the important negative regulators which stop cell cycle progression in response to multiple regulatory signals. The deregulation of the cell cycle regulatory genes such as CDKs is one of the most frequent alterations during tumorigenesis and cancer development (31). The hypermethylation of CDKIs such as the CIP/KIP family has been shown in several cancers (32, 33). Indeed, the silencing of the CDKIs promoter by hypermethylation plays an important role in cancer induction and tumor development. In-vitro studies have indicated that DNA demethylating agents can reactivate silenced TSGs such as p14ARFp16INK4A, and p53 (34, 35). In the present study, zebularine inhibited cell growth and induced apoptosis in both PLC/PRF5 and PA-TU-8902 cell lines. Subsequently, we evaluated the molecular mechanism of this effect and found that it upregulated p16INK4a, p14ARF, and p15INK4b and down-regulated DNA methyltransferase 1 gene expression significantly. Additionally, our work demonstrated that zebularine had a more significant effect on PLC/PRF5 in comparison to TU-8902 cells. A similar pathway has been reported for zebularine in other cancers. It has been reported that this compound upregulates p16, p21, and p27gene expression by inhibition of DNMT1 activity in bladder transitional carcinoma cells T24, pancreatic carcinoma CFPAC-1 cells, colon carcinoma HCT15, SW48, and HT-29, and lung carcinoma CALU-1 cell lines (17). Another study has been shown that zebularine down-regulates CDK2 and upregulates p21WAF/CIP1 and p53 in HCC HepG2 (12). In acute myeloid leukemia (AML), AML193, zebularine treatment results in a dose-dependent increase in p15INK4B expression and apoptosis induction (19). Increased expression of the silenced cell cycle regulatory genes after inhibition of DNMTs by DNA demethylating agent 5-aza-CdR has been reported by several studies. By this pathway, DNMTs inhibition, zebularine increases p53/p21Waf1/Cip1 expression in A549 cells (wild-type p53) (36). In esophageal cancer cell lines, this compound can increase p27kip1 mRNA expression through DNA demethylation (37). An important molecular mechanism of INK4 family, including p16INK4a, p15INK4b, p18INK4c, and p19INK4d, is the cyclin D-Cdk4-6/INK4/Rb/E2F pathway, which plays a significant role in controlling cell growth by integrating multiple antimitogenic and mitogenic stimuli. This family, INK4 family, blocks the cell cycle progression by binding to either Cdk4 or Cdk6 and inhibiting the action of cyclin D (38). In addition to the INK4 family, DNMTIs can induce apoptosis by reactivation of Cip/Kip family, including p21Cip1, p27Kip1, and p57Kip2 (39). In-vitro study has been shown that DNA methyltransferase inhibitor 5-aza-CdR can induce G2/M cell cycle arrest in leukemia cells by p21WAF1/CIP1 up-regulation (40). Overexpression of p57 has been reported in pancreatic cancer cell lines after treatment with 5-aza-CdR (41). Besides, this compound can restore the P21 gene in HCC, a major mechanism causing cell cycle arrest in this cell line (42).
In summary, DNA methyltransferase inhibitors can inhibit cell growth and induce apoptosis by reactivation of cell cycle regulatory genes, INK4, and the Cip/Kip family. We did not evaluate the effect of 5-aza-CdR on the Cip/Kip family in HCC and pancreatic cancer. Therefore, this evaluation is recommended.
Table 1The primer sequences of p16INK4a, p14ARF, p15INK4b, and DNMT1 genes
PrimerPrimer sequences (5' to 3')Reference
p14ARFForwardReverseGTGGGTTTTAGTTTGTAGTTAAACCTTTCCTACCTAATCT
p15INK4bForwardReverseAAGCTGAGCCCAGGT CTCCTACCACCGTTGGCCGTAAACT
p16INK4aForwardReverseCCCGCTTTCGTAGTTTTCATTTATTTGAGCTTTGGTTCTG
DNMT1ForwardReverseGAG GAA GCT GCT AAG GAC TAG TTCACT CCA CAA TTT GAT CAC TAA ATC
Table 2The percentage of apoptotic cells treated with zebularine at different periods. A significant difference was considered as P < 0.05. P-value: P < 0.001.
Cell lineDrugDose (μM )Duration (h)Apoptosis (%)P-value
PLC/PRF5zebularine74.652448.270.001
PLC/PRF5zebularine74.6548970.001
PA-TU-8902zebularine98.822412.540.001
PA-TU-8902zebularine98.824845.240.001
Table 3The relative expression level of p16INK4a, p14ARF, p15INK4b, and DNMT1 genes in treated cell groups in comparison to untreated control groups. A significant difference was considered as P < 0.05
Cell lineGeneDrugDose (μM)Duration (h)ExpressionP-value
PLC/PRF5p14ARFzebularine74.65 μM242.90.001
PLC/PRF5p14ARFzebularine74.65 μM483.60.001
PLC/PRF5p15INK4bzebularine74.65 μM242.80.001
PLC/PRF5p15INK4bzebularine74.65 μM483.50.001
PLC/PRF5p16INK4azebularine74.65 μM242.70.001
PLC/PRF5p16INK4azebularine74.65 μM483.70.001
PLC/PRF5DNMT1zebularine74.65 μM240.400.001
PLC/PRF5DNMT1zebularine74.65 μM480.180.001
PA-TU-8902p14ARFzebularine98.82 μM242.40.001
PA-TU-8902p14ARFzebularine98.82 μM482.70.001
PA-TU-8902p15INK4bzebularine98.82 μM242.30.001
PA-TU-8902p15INK4bzebularine98.82 μM482.50.001
PA-TU-8902p16INK4azebularine98.82 μM242.10.001
PA-TU-8902p16INK4azebularine98.82 μM482.40.001
PA-TU-8902DNMT1zebularine98.82 μM240.700.028
PA-TU-8902DNMT1zebularine98.82 μM480.450.001
In-vitro effects of zebularine (0, 10, 25, 50, 75, 100, 250, and 500 μM) on PLC/PRF5 and PA-TU-8902 cell viability evaluated by MTT Assay at different times (24 and 48 h). Values are means of three experiments in triplicate. The zebularine had a dose- and time-dependent effect, statistical comparisons between groups were performed with ANOVA (One‑way ANOVA) and Turkey test
Figure 1

In-vitro effects of zebularine (0, 10, 25, 50, 75, 100, 250, and 500 μM) on PLC/PRF5 and PA-TU-8902 cell viability evaluated by MTT Assay at different times (24 and 48 h). Values are means of three experiments in triplicate. The zebularine had a dose- and time-dependent effect, statistical comparisons between groups were performed with ANOVA (One‑way ANOVA) and Turkey test

The apoptotic effect of zebularine on PLC/PRF5 and PA-TU-8902 cells (74.65 and 98.82 μM respectively) versus control groups at 24 and 48 h. The cells were treated with zebularine for 24 and 48 h, and the apoptotic effect was investigated by flow cytometric analysis. Results were obtained from three independent experiments and were expressed as mean ± standard error of the mean. The upper right quadrant of each figure shows the percentage of cells in late apoptosis, the lower right quadrant shows the percentage of cells in early apoptosis, the upper left quadrant shows the percentage of necrotic cells, and the lower left quadrant shows the percentage of viable cells. The zebularine induced apoptosis of both cell lines significantly in a time-dependent manner (<i>P </i>&lt; 0.001)
Figure 2

The apoptotic effect of zebularine on PLC/PRF5 and PA-TU-8902 cells (74.65 and 98.82 μM respectively) versus control groups at 24 and 48 h. The cells were treated with zebularine for 24 and 48 h, and the apoptotic effect was investigated by flow cytometric analysis. Results were obtained from three independent experiments and were expressed as mean ± standard error of the mean. The upper right quadrant of each figure shows the percentage of cells in late apoptosis, the lower right quadrant shows the percentage of cells in early apoptosis, the upper left quadrant shows the percentage of necrotic cells, and the lower left quadrant shows the percentage of viable cells. The zebularine induced apoptosis of both cell lines significantly in a time-dependent manner (P < 0.001)

The comparative effects of zebularine at a concentration of 74.65 μM on PLC/PRF5 cells compared to PA-TU-8902 cells treated with zebularine at a concentration of 98.82 μM. The first column of each group belongs to the control group and the others belong to treated cells with the zebularine with the mentioned concentrations at 24 and 48 h. Asterisks (*) indicate significant differences between the treated and untreated control groups. As shown above, zebularine indicated a more significant apoptotic effect on PLC/PRF5 cells in comparison to PA-TU-8902 cells
Figure 3

The comparative effects of zebularine at a concentration of 74.65 μM on PLC/PRF5 cells compared to PA-TU-8902 cells treated with zebularine at a concentration of 98.82 μM. The first column of each group belongs to the control group and the others belong to treated cells with the zebularine with the mentioned concentrations at 24 and 48 h. Asterisks (*) indicate significant differences between the treated and untreated control groups. As shown above, zebularine indicated a more significant apoptotic effect on PLC/PRF5 cells in comparison to PA-TU-8902 cells

The relative expression level of p16INK4a, p14ARF, p15INK4b, and DNMT1 genes in the PLC/PRF5 cells treated with zebularine (74.65 μM) versus control groups at 24 and 48 h. The first column of each group belongs to the control group and the others belong to the treated cells with zebularine at 24 and 48 h. Asterisks (*) indicate significant differences between the treated and untreated groups
Figure 4

The relative expression level of p16INK4a, p14ARF, p15INK4b, and DNMT1 genes in the PLC/PRF5 cells treated with zebularine (74.65 μM) versus control groups at 24 and 48 h. The first column of each group belongs to the control group and the others belong to the treated cells with zebularine at 24 and 48 h. Asterisks (*) indicate significant differences between the treated and untreated groups

The relative expression level of p16INK4a, p14ARF, p15INK4b, and DNMT1 genes in the PA-TU-8902 cells treated with zebularine (98.82 μM) versus control groups at 24 and 48 h. The first column of each group belongs to the control group and the others belong to treated cells with the zebularine at 24 and 48 h. Asterisks (*) indicate significant differences between the treated and untreated groups
Figure 5

The relative expression level of p16INK4a, p14ARF, p15INK4b, and DNMT1 genes in the PA-TU-8902 cells treated with zebularine (98.82 μM) versus control groups at 24 and 48 h. The first column of each group belongs to the control group and the others belong to treated cells with the zebularine at 24 and 48 h. Asterisks (*) indicate significant differences between the treated and untreated groups

Conclusion

In conclusion, our finding demonstrated that zebularine inhibited PLC/PRF5 and PA-TU-8902 cell growth and induced apoptosis in these cell lines. The most likely mechanism underlying the zebularine inhibited cell growth and induced apoptosis involves down-regulation of DNMT1 and up-regulation of p16INK4a, p14ARF, and p15INK4b genes. This result suggests that zebularine may have wide therapeutic applications in hepatocellular carcinoma and pancreatic cancer.

Author contribution

This study is a research work that reports the Effect of Zebularine on p16INK4a, p14ARF, p15INK4b, and DNA Methyltransferase 1 Gene Expression, Cell Growth Inhibition, and Apoptosis Induction in Human Hepatocellular Carcinoma PLC/PRF5 and Pancreatic Cancer PA-TU-8902 Cell Lines. It has not been previously submitted by any other journal, and all of the authors read and approved the final version of the manuscript. All authors generated the ideas and contributed to the writing of the manuscript, acquisition of data, analysis, and interpretation of data, and revised the article. All authors approved the final revision.

Acknowledgments

References

  • 1.
    Kamisawa T, Wood LD, Itoi T, Takaori K. Pancreatic cancer. Lancet. 2016;388:73-85. [PubMed ID: 26830752].
  • 2.
    Thomas MB, Jaffe D, Choti MM, Belghiti J, Curley S, Fong Y, Gores G, Kerlan R, Merle P, O’Neil B. Hepatocellular carcinoma: consensus recommendations of the national cancer institute clinical trials planning meeting. J. Clin. Oncol. 2010;28:3994-4005. [PubMed ID: 20679622].
  • 3.
    Tischoff I, Tannapfel A. DNA methylation in hepatocellular carcinoma. World J. Gastroenterol. 2008;14:1741-8. [PubMed ID: 18350605].
  • 4.
    Tannapfel A, Busse C, Weinans L, Benicke M, Katalinic A, Geißler F, Hauss J, Wittekind C. INK4a-ARF alterations and p53 mutations in hepatocellular carcinomas. Oncogene. 2001;20:7104-9. [PubMed ID: 11704835].
  • 5.
    Zhang Z, Rosen DG, Yao JL, Huang J, Liu J. Expression of p14 ARF, p15 INK4b, p16 INK4a, and DCR2 increases during prostate cancer progression. Mod. Pathol. 2006;19:1339-43. [PubMed ID: 16799475].
  • 6.
    Li G, Ji Y, Liu C, Li J, Zhou Y. Reduced levels of p15INK4b, p16INK4a, p21cip1 and p27kip1 in pancreatic carcinoma. Mol. Med. Report. 2012;5:1106-10.
  • 7.
    Furonaka O, Takeshima Y, Awaya H, Ishida H, Kohno N, Inai K. Aberrant methylation of p14ARF, p15INK4b and p16INK4a genes and location of the primary site in pulmonary squamous cell carcinoma. Pathol. Int. 2004;54:549-55. [PubMed ID: 15260845].
  • 8.
    Jha AK, Nikbakht M, Jain V, Capalash N, Kaur J. p16INK4a and p15INK4b gene promoter methylation in cervical cancer patients. Oncol. Lett. 2012;3:1331-5. [PubMed ID: 22783444].
  • 9.
    Konishi N, Nakamura M, Kishi M, Nishimine M, Ishida E, Shimada K. DNA hypermethylation status of multiple genes in prostate adenocarcinomas. Jpn. J. Cancer Res. 2002;93:767-73. [PubMed ID: 12149142].
  • 10.
    Bai P, Xiao X, Zou J, Cui L, Bui Nguyen TM, Liu J, Xiao J, Chang B, Wu J, Wang H. Expression of p14ARF, p15INK4b, p16INK4a and skp2 increases during esophageal squamous cell cancer progression. Exp. Ther. Med. 2012;3:1026-32. [PubMed ID: 22970012].
  • 11.
    Hirasawa Y, Arai M, Imazeki F, Tada M, Mikata R, Fukai K, Miyazaki M, Ochiai T, Saisho H, Yokosuka O. Methylation status of genes upregulated by demethylating agent 5-aza-2′-deoxycytidine in hepatocellular carcinoma. Oncology. 2006;71:77-85. [PubMed ID: 17341888].
  • 12.
    Nakamura K, Aizawa K, Nakabayashi K, Kato N, Yamauchi J, Hata K, Tanoue A. DNA methyltransferase inhibitor zebularine inhibits human hepatic carcinoma cells proliferation and induces apoptosis. PLoS One. 2013;8:54036-41.
  • 13.
    Andersen JB, Factor VM, Marquardt JU, Raggi C, Lee YH, Seo D, Conner EA, Thorgeirsson SS. An integrated genomic and epigenomic approach predicts therapeutic response to zebularine in human liver cancer. Sci. Transl. Med. 2010;2:54-77.
  • 14.
    Neureiter D, Zopf S, Leu T, Dietze O, Hauser-Kronberger C, Hahn EG, Herold C, Ocker M. Apoptosis, proliferation and differentiation patterns are influenced by Zebularine and SAHA in pancreatic cancer models. Scand. J. Gastroenterol. 2007;42:103-16. [PubMed ID: 17190770].
  • 15.
    Yoo CB, Valente R, Congiatu C, Gavazza F, Angel A, Siddiqui MA, Jones PA, McGuigan C, Marquez VE. Activation of p16 gene silenced by DNA methylation in cancer cells by phosphoramidate derivatives of 2′-deoxyzebularine. J. Med. Chem. 2008;51:7593-601. [PubMed ID: 19006382].
  • 16.
    Valenzuela MMA, Neidigh JW, Wall NR. Antimetabolite treatment for pancreatic cancer. Chemotherapy. 2014;3:137-43. [PubMed ID: 26161298].
  • 17.
    Cheng JC, Yoo CB, Weisenberger DJ, Chuang J, Wozniak C, Liang G. Preferential response of cancer cells to zebularine. Cancer Cell. 2004;6:151-8. [PubMed ID: 15324698].
  • 18.
    Lassacher A, Heitzer E, Kerl H, Wolf P. p14ARF hypermethylation is common but INK4a-ARF locus or p53 mutations are rare in Merkel cell carcinoma. J. Invest. Dermatol. 2008;128:1788-96. [PubMed ID: 18219279].
  • 19.
    Scott SA, Lakshimikuttysamma A, Sheridan DP, Sanche SE, Geyer CR, DeCoteau JF. Zebularine inhibits human acute myeloid leukemia cell growth in-vitro in association with p15INK4B demethylation and reexpression. Exp. Hematol. 2007;35:263-73. [PubMed ID: 17258075].
  • 20.
    Cheng JC, Matsen CB, Gonzales FA, Ye W, Greer S, Marquez VE, Jones PA, Selker EU. Inhibition of DNA methylation and reactivation of silenced genes by zebularine. J. Natl. Cancer Inst. 2003;95:399-409. [PubMed ID: 12618505].
  • 21.
    Liu LH, Xiao WH, Liu WW. Effect of 5-2Aza-2’-deoxycytidine on the P16 tumor suppressor gene in hepatocellular carcinoma cell line HepG2. World J. Gastroenterol. 2001;7:131-7. [PubMed ID: 11819749].
  • 22.
    Maeta Y, Shiota G, Okano JI, Murawaki Y. Effect of promoter methylation of the p16 gene on phosphorylation of retinoblastoma gene product and growth of hepatocellular carcinoma cells. Tumor Biol. 2005;26:300-5.
  • 23.
    Sanaei M, Kavoosi F. Effects of 5-aza-2’-deoxycytidine and valproic acid on epigenetic-modifying DNMT1 gene expression, apoptosis induction and cell viability in hepatocellular carcinoma WCH-17 cell line. Iran. J. Ped. Hematol. Oncol. 2019;9:83-90.
  • 24.
    Zahir NV, Nakhjavani M, Hajian P, Shirazi FH, Mirzaei H. Evaluation of silibinin effects on the viability of HepG2 (human hepatocellular liver carcinoma) and HUVEC (human umbilical vein endothelial) cell lines. Iran. J. Pharm. Res. 2018;17:261-7. [PubMed ID: 29755557].
  • 25.
    Nakhjavani M, Palethorpe HM, Tomita Y, Smith E, Price TJ, Yool AJ, Pei JV, Townsend AR, Hardingham JE. Stereoselective anti-cancer activities of ginsenoside Rg3 on triple negative breast cancer cell models. Pharmaceuticals. 2019;12:117-24.
  • 26.
    Kavoosi F, Sanaei M. Comparative analysis of the effects of valproic acid and tamoxifen on proliferation, and apoptosis of human hepatocellular carcinoma WCH 17 celllin. Iran. J. Ped. Hematol. Oncol. 2018;8:12-20.
  • 27.
    Sakuma K, Chong JM, Sudo M, Ushiku T, Inoue Y, Shibahara J. High-density methylation of p14ARF and p16INK4A in Epstein-Barr virus–associated gastric carcinoma. Int. J. Cancer. 2004;112:273-8. [PubMed ID: 15352040].
  • 28.
    Li G, Ji Y, Liu C, Li J, Zhou Y. Reduced levels of p15INK4b, p16INK4a, p21cip1 and p27kip1 in pancreatic carcinoma. Mol. Med. Report. 2012;5:1106-10.
  • 29.
    Saegusa M, Machida B D, Okayasu I. Possible associations among expression of p14ARF, p16INK4a, p21WAF1/CIP1, p27KIP1, and p53 accumulation and the balance of apoptosis and cell proliferation in ovarian carcinomas. Cancer. 2001;92:1177-89. [PubMed ID: 11571731].
  • 30.
    Sanaei M, Kavoosi F, Roustazadeh A, Golestan F. Effect of genistein in comparison with trichostatin a on reactivation of DNMTs genes in hepatocellular carcinoma. J. Clin.Transl. Hepatol. 2018;6:141-6. [PubMed ID: 29951358].
  • 31.
    Park MT, Lee SJ. Cell cycle and cancer. J. Biochem. Mol. Biol. 2003;36:60-5. [PubMed ID: 12542976].
  • 32.
    Wong IH, Ng MH, Huang DP, Lee JC. Aberrant p15 promoter methylation in adult and childhood acute leukemias of nearly all morphologic subtypes: potential prognostic implications. Blood. 2000;95:1942-9. [PubMed ID: 10706859].
  • 33.
    Chim C, Liang R, Tam C, Kwong Y. Methylation of p15 and p16 genes in acute promyelocytic leukemia: potential diagnostic and prognostic significance. J. Clin. Oncol. 2001;19:2033-40. [PubMed ID: 11283136].
  • 34.
    Yagi S, Oda-Sato E, Uehara I, Asano Y, Nakajima W, Takeshita T, Tanaka N. 5-Aza-2′-deoxycytidine restores proapoptotic function of p53 in cancer cells resistant to p53-induced apoptosis. Cancer Invest. 2008;26:680-8. [PubMed ID: 18608210].
  • 35.
    Venza M, Visalli M, Biondo C, Lentini M, Catalano T, Teti D, Venza I. Epigenetic regulation of p14ARF and p16INK4A expression in cutaneous and uveal melanoma. Biochim. Biophys. Acta Gene Regul. Mech. 2015;1849:247-56.
  • 36.
    Zhu WG, Hileman T, Ke Y, Wang P, Lu S, Duan W, Dai Z, Tong T, Villalona-Calero MA, Plass C. 5-aza-2′-deoxycytidine activates the p53/p21Waf1/Cip1 pathway to inhibit cell proliferation. J. Biol. Chem. 2004;279:15161-6. [PubMed ID: 14722112].
  • 37.
    Ling Y, Zhang C, Xu Y, Zhu J, Zhu C, Lu M. Promoter methylationassociated silencing of p27kip1 gene with metastasis in esophageal squamous cell carcinoma. Mol. Med. Report. 2014;9:1075-9.
  • 38.
    Cánepa ET, Scassa ME, Ceruti JM, Marazita MC, Carcagno AL, Sirkin PF, Ogara MF. INK4 proteins, a family of mammalian CDK inhibitors with novel biological functions. IUBMB Life. 2007;59:419-26. [PubMed ID: 17654117].
  • 39.
    Besson A, Dowdy SF, Roberts JM. CDK inhibitors: cell cycle regulators and beyond. Dev. Cell. 2008;14:159-69. [PubMed ID: 18267085].
  • 40.
    Jiemjit A, Fandy T, Carraway H, Bailey K, Baylin S, Herman J, Gore S. p21 WAF1/CIP1 induction by 5-azacytosine nucleosides requires DNA damage. Oncogene. 2008;27:3615-21. [PubMed ID: 18223691].
  • 41.
    Sato N, Matsubayashi H, Abe T, Fukushima N, Goggins M. Epigenetic down-regulation of CDKN1C/p57KIP2 in pancreatic ductal neoplasms identified by gene expression profiling. Clin.Cancer Res. 2005;11:4681-8. [PubMed ID: 16000561].
  • 42.
    Wang P, Yan Y, Yu W, Zhang H. Role of ten-eleven translocation proteins and 5-hydroxymethylcytosine in hepatocellular carcinoma. Cell Prolif. 2019;52:12626-33.

Copyright

This is an Open Access article distributed under the terms of the Creative Commons Attribution License, (http://creativecommons.org/licenses/by/3.0/) which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Similar Articles

31
Jul
2021

Effect of Zebularine in Comparison to Trichostatin A on the Intrinsic and Extrinsic Apoptotic Pathway, Cell Viability, and Apoptosis in Hepatocellular Carcinoma SK-Hep 1, Human Colorectal Cancer SW620, and Human Pancreatic Cancer PaCa-44 Cell Lines

Masumeh Sanaei,
Fraidoon Kavoosi

Sanaei M, Kavoosi F. Effect of Zebularine in Comparison to Trichostatin A on the Intrinsic and Extrinsic Apoptotic Pathway, Cell Viability, and Apoptosis in Hepatocellular Carcinoma SK-Hep 1, Human Colorectal Cancer SW620, and Human Pancreatic Cancer PaCa-44 Cell Lines. Iran J Pharm Res. 2021;20(3):e124295. doi: https://doi.org/10.22037/ijpr.2021.115097.15196

30
Apr
2016

Matrine inhibits diethylnitrosamine-induced HCC proliferation in rats through inducing apoptosis via p53, Bax-dependent caspase-3 activation pathway and down-regulating MLCK overexpression

Xiaolin Zhang,
Hao Yu

Zhang X, Yu H. Matrine inhibits diethylnitrosamine-induced HCC proliferation in rats through inducing apoptosis via p53, Bax-dependent caspase-3 activation pathway and down-regulating MLCK overexpression. Iran J Pharm Res. 2016;15(2):e125199. doi: https://doi.org/10.22037/ijpr.2016.1815

10
Feb
2026
Hepat Mon

USP7 Enhances Epithelial Mesenchymal Transition and Cancer Stem Cell-Like Properties in Hepatocellular Carcinoma by the AKT/β-Catenin Pathway: A Randomized Trial

Mingchao Hu,
Yuhong Zhu,
Lili Wang,
Huilan Ye,
Rongcan Xu,
Jinlong Zhai
,et al.

Hu M, Zhu Y, Wang L, Ye H, Xu R, et al. USP7 Enhances Epithelial Mesenchymal Transition and Cancer Stem Cell-Like Properties in Hepatocellular Carcinoma by the AKT/β-Catenin Pathway: A Randomized Trial. Hepat Mon. 2026;26(1):e166157. doi: https://doi.org/10.5812/hepatmon-166157

20
Dec
2025
Hepat Mon

Upregulation of Keratin 19 Expression by Hepatitis B Virus X Protein Promotes Hepatocellular Carcinoma Invasion, Metastasis, and Postoperative Recurrence

Jingyao Shen,
Jie Zhang,
Weimin Sun

Shen J, Zhang J, Sun W. Upregulation of Keratin 19 Expression by Hepatitis B Virus X Protein Promotes Hepatocellular Carcinoma Invasion, Metastasis, and Postoperative Recurrence. Hepat Mon. 2025;25(1):e165724. doi: https://doi.org/10.5812/hepatmon-165724

15
Apr
2026
Iran J Pharm Res

Wedelolactone Inhibits Hepatitis B Virus Replication by Modulating NF-κB and Nrf2/HO-1 Signaling: An in-vitro Huh7 1.3-mer HBV Plasmid Model

Bin Wang,
Xuehui Bu,
Umar Saeed,
Zahra Zahid Piracha,
Di Xiao

Wang B, Bu X, Saeed U, Zahid Piracha Z, Xiao D. Wedelolactone Inhibits Hepatitis B Virus Replication by Modulating NF-κB and Nrf2/HO-1 Signaling: An in-vitro Huh7 1.3-mer HBV Plasmid Model. Iran J Pharm Res. 2026;25(1):e168329. doi: https://doi.org/10.5812/ijpr-168329

Download PDF672.36 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles