Abstract
Keywords
Sumatriptan Pentylenetetrazole Nitric oxide Soluble guanylyl cyclase Cyclic guanosine monophosphate Seizure Mice
Introduction
Epilepsy is an overwhelming neurological disorder worldwide, recognized by repetitive seizures through hyper neuronal discharge. Hence, epileptic seizure is phenomenon of abnormal neuronal excitation of a set of neurons in brain as a result of Ca2 + influx (1). Already available anticonvulsants act through hyperpolarization, altering calcium and sodium channels, and modulating the activity of N-methyl-D-aspartate (NMDA) or AMPA/kainite receptors (2, 3). Postsynaptic Ca2 + transfer through NMDA receptors cause subsequent activation of nitric oxide (NO) pathway (4). Whereas, among all three isoforms of nitric oxide synthase (NOS), the neuronal NOS (nNOS) is mainly responsible to generate NO in brain (5). Furthermore, the pentylenetetrazole (PTZ)-induced clonic seizure model is considered as an authentic experimental model, causing NO mediated neuro-excitation (6).
It is well-known that NO exerts proconvulsive properties in PTZ-induced seizure model. In contrast, the nitrergic system inhibitors are assumed to possess anticonvulsive properties against PTZ-induced seizure (7, 8). Moreover, in central nervous system (CNS), NO releases the cyclic guanosine monophosphate (cGMP) through stimulation of soluble guanylyl cyclase (sGC), an intracellular physiological receptor of NO (9). In different brain regions, sGC comprises of two subunits of α and β, which further exists in four isoforms namely α1, α2, β1, and β2, in form of two heterodimers α1/β1 and α2/β1 (10, 11). The role of NO-cGMP pathway in seizure pathogenesis is well-established (12). Hence, inhibitors of NO-cGMP pathway could elevate the PTZ-induced seizure threshold (13).
Sumatriptan is a selective agonist of 5-HT1B/1D auto-receptors, used as an excellent remedy to treat migraine and cluster headache. Although, the antimigraine effect of sumatriptan is mediated through 5HT1B/1D receptors, in CNS the involvement of NO and cGMP signaling pathway in pharmacological and clinical applications of sumatriptan has been well-documented in literature (14-18). Furthermore, the inhibitory role of sumatriptan on seizure threshold has been already reported through possible involvement of non-serotonergic 5-HT1B/D receptors and nitric oxide (NO) pathway (19-21).
There is little evidence about the involvement of cGMP signaling in the anticonvulsant effect of sumatriptan in experimental model of PTZ-induced seizure. Therefore, we aimed to evaluate the possible role of NO-cGMP signaling in anticonvulsant activity of sumatriptan. Furthermore, we investigated the involvement of nNOS, and α1, α2, β1, and β2 subunits of soluble guanylyl cyclase genes expression in anticonvulsant properties of sumatriptan in PTZ-induced clonic seizure in mice.
Experimental
Animals
Adult male Naval Medical Research Institute (NMRI) mice weighing 23-30 grams were used in the study. The animals were housed in a temperature (22 ± 5 °C) and humidity (60-70%) controlled room maintained at 12 h light /dark cycles and had free access to ad libitum diet and water. The experimental procedures were in accordance with the National Institute of Health guide for the Care and Use of Laboratory Animals (8th Edition, 2011, the National Academies Press, Constitution Ave., Washington, DC, USA) and approved by the research ethical committee of Tehran University of Medical Sciences.
Chemicals
The drugs used in the present study were: sumatriptan (5-HT1B/1D agonist), pentylenetetrazole (PTZ, GABAA receptor antaggonist), aminoguanidine (AG, a specific iNOS inhibitor), 7-Nitroindazole (7-NI, a specific nNOS inhibitor), sildenafil (PDE5 inhibitor), sodium nitrite, and Trizol reagent, which were purchased from Sigma (St Louis, MO, USA). The other used chemicals were as below: N(G)-nitro-L-arginine (L-NNA, a non-specific NOS inhibitor, Fluka, Switzerland); methylene blue (MB, a sGC inhibitor, Hoechst, Germany); Griess reagent (Enzo life sciences, NY, USA); and cDNA synthesis kit (Life Technologies Ltd., UK).
Drugs preparation and administration
All drugs were dissolved in normal saline except 7-NI, which was dissolved in 1% solution of Tween 80. All drugs were injected in a volume of 10 mL/kg via intraperitoneal (i.p.) rout except PTZ (0.5%), which was administered via intravenous (i.v.) route for all experiments. The dose selection, route of drug administration, and injection time of all drugs were selected by pilot study and previously published research work (22). In all experiments, based on pilot study sumatriptan was injected at dose rate of 0.3 and 1.2 mg/kg (0.3, 0.6, 1.2, 2.4 mg/kg) and 30 min prior to PTZ-induced seizures as reported previously (21). The drug administration schedule is represented in Figure 1.
Study groups
The following study groups were examined to determine the involvement of NO/cGMP pathway in anticonlvusant effect of sumatriptan. In group 1, mice were injected with the corresponding volume of saline (control) or vehicles (Tween 80) before PTZ-induced clonic seizure (CS). In group 2, mice were injected with different doses of L-NNA (1, 5, and 10 mg/kg), 7-NI (30, 45, and 60 mg/kg), AG (30, 50, and 100 mg/kg), MB (0.1, 0.5, and 1 mg/kg) and sildenafil (5, 10, and 20 mg/kg) alone. In group 3, mice were injected with L-NNA (1 mg/kg), 7-NI (30 mg/kg), AG (30, 50, and 100 mg/kg), MB (0.5 mg/kg) and sildenafil (5 mg/kg) along with sumatriptan. In group 4, mice were coadministered with 7-NI (30 mg/kg) and MB (0.5 mg/kg) along with sumatriptan.
Seizure induction
PTZ-induced seizures threshold was measured by previously studied protocol (23). In short, PTZ (0.5%, 5 mg/mL) was injected using a 30 gauge winged infusion set into the tail vein of freely moving mice at a constant rate of 1 mL/min. Infusion was stopped immediately when forelimb clonus followed by full clonus of the body, was used as the endpoint for PTZ-induced CST. The minimal dose of PTZ (mg/kg) required to induce a clonic seizure was measured as the index of CST. Following formula was used to measure PTZ-induced CST: [infusion duration (min) × infusion rate (mL/min) × PTZ concentration (mg/mL) × 1000]/[weight of mouse (g)]. All of the animals were sacrificed via cervical dislocation throughout the study.
Nitrite assay
Nitrite level was assessed as an index of NO production based on Griess reaction (24, 25). Prefrontal cortex (PFC) were dissected on ice-cold surface and immediately immersed in liquid nitrogen. Briefly, samples were homogenized in chilled phosphate buffer (pH 7.4) and centrifuged at 800 g for 20 min at 4 ℃ to obtain supernatant. Then, supernatant was mixed with equal volume of Griess reagent and incubated at room temperature for 30 min under reduced light. Concentration of nitrite was quantified using spectrophotometer at 540 nm against a nitrite standard (0.1 M NaNO2 in water).
Quantitative real-time polymerase chain reaction (QRT-PCR) study
The cerebral cortex tissues were dissected and freezed at-80 ºC till further analysis. The frozen tissues were homogenized and total RNA was extracted by Trizol reagent. Then, cDNA kit was used to obtain the single strand cDNA followed by amplification of specific mRNA. The specific primers used for PCR amplification are shown in Table 1. A LightCycler®96 system (Roche Diagnostics, Mannheim, Germany) was used to perform QRT-PCR. Thermal reaction conditions were maintained in accordance to previous studies (26). The relative expression of target genes was normalized to GAPDH expression in the same reaction. For calculations, 2-ΔΔCT method was used to measure the fold change in the mRNA expression of target genes as compared to control. All experiments run in triplicate and following formula was used to calculate: ΔΔCT = (CT target–CT GAPDH) experimental sample–(CT target–CT GAPDH) control sample.
Statistical analysis
GraphPad Prism 7 software (GraphPad Software San Diego, CA, USA) was used for statistical analysis. All data are expressed as mean ± standard error of the mean (SEM). The statistical differences between groups were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. P ≤ 0.05 was considered as statistically significant.
Results
Dose response of sumatriptan on Clonic Seizure Threshold (CST)
The data in Figure 2 shows the effect of various doses of sumatriptan (0.3, 0.6, 1.2, 2.4mg/kg) on PTZ induced seizure. Statistical analysis showed that sumatriptan at doses of 0.6 mg/kg (P ≤ 0.01) and 1.2 mg/kg (P ≤ 0.001) significantly attenuated PTZ induced clonic seizure. All other doses remained non-significant (P > 0.05) as compared to control.
Involvement of NO in anticonvulsant effect of sumatriptan
Involvement of NO in anticonvulsant effect of sumatriptan was confirmed using NOS inhibitors including L-NNA (a nonspecific NOS inhibitor) and 7-NI (neuronal NOS inhibitor). The results revealed that L-NNA and 7-NI alone had no effect on CST (P > 0.05). Figure 3A shows that pretreatment of mice with L-NNA (1 and 5 mg/kg, i.p.) 15 min before subeffective dose of sumatriptan (0.3mg/kg, i.p.) significantly increased the CST compared to sumatriptan treated group (P ≤ 0.001, P ≤ 0.01, respectively). Illustrating in Figure 3B, 7-NI (30 mg/kg, i.p.) 15 min prior subeffective dose of sumatriptan significantly boosted the CST compared to sumatriptan treated group (P ≤ 0.001). However, as Figure 4 shows, the pretreatment of mice with the selective iNOS inhibitor, AG (30, 50, and 100 mg/kg, i.p.) failed to augment the anticonvulsant effect of a subeffective dose of sumatriptan (P > 0.05).
Involvement of cGMP in anticonvulsant effect of sumatriptan
Involvement of cGMP in anticonvulsant effect of sumatriptan was confirmed using cGMP pathway inhibitors including MB (sGC inhibitor) and sildenafil (PDE5 inhibitor). The results showed that MB and sildenafil alone had no effect on CST (P > 0.05). Figure 5A illustrates that pretreatment of the mice with MB (0.5 and 1 mg/kg, i.p.) 15 min prior the subeffective dose of sumatriptan (0.3 mg/kg, i.p.) significantly increased the CST compared to sumatriptan treated group (P ≤ 0.001, P ≤ 0.05, respectively). Figure 5B shows that sildenafil (5 mg/kg, i.p.) 15 min before the effective dose of sumatriptan significantly diminished the CST compared to the sumatriptan treated group (P ≤ 0.001).
Interaction of NO and cGMP pathway
To investigate the NO mediated activation of cGMP and their possible interaction, the subeffective doses of 7-NI (30 mg/kg, i.p.) + MB (0.5 mg/kg, i.p.) were coadministered alone or 15 min before subeffective dose of sumatriptan (0.3 mg/kg, i.p). Figure 6 shows that coadministration of 7-NI + MB with sumatriptan significantly boosted the CST compared to control/vehicle and sumatriptan treated groups (P ≤ 0.001).
Effect of sumatriptan on NO metabolites
As demonstrated in Figure 7, the effective dose of sumatriptan (1.2 mg/kg, i.p) significantly reduced the nitrite levels in prefrontal cortex (PCF) compared to the control group (P ≤ 0.01).
Figure 8A shows that nitrite concentration was significantly decreased by subeffective dose of sumatriptan (0.3 mg/kg, i.p.) when treated with subeffective doses of L-NNA (1 mg/kg, i.p.) and 7-NI (30 mg/kg, i.p.) compared to control/vehicle (P ≤ 0.01, P ≤ 0.005, respectively). Figure 8B shows the nitrite concentration was significantly decreased by subeffective dose of sumatriptan (0.3 mg/kg, i.p.) when treated with subeffective dose of MB (0.5 mg/kg, i.p.) compared to the control group (P ≤ 0.005).
Evaluation of qRT-PCR genes expression
Figure 9 illustrates that PTZ administration significantly increased the mRNA expression of nNOS in cerebral cortex of mice (P ≤ 0.0001). In contrast, the effective dose of sumatriptan (1.2 mg/kg, i.p.) and coadministration of subeffective doses of sumatriptan (0.3 mg/kg) + 7-NI (30 mg/kg) significantly reversed the PTZ-induced overexpression of nNOS (P ≤ 0.01, P ≤ 0.001, respectively) gene.
Moreover, the effective dose of sumatriptan significantly downregulated the PTZ-induced overexpression of α1 (P ≤ 0.001, Figure 10A), α2 (P ≤ 0.05, Figure 10B), and β1 (P ≤ 0.05, Figure 10C) genes compared to the PTZ treated group. However, coadministration of subeffective doses of sumatriptan (0.3 mg/kg, i.p.) + MB (0.5 mg/kg, i.p.) significantly downregulated the PTZ-induced overexpression of α1 (P ≤ 0.001, Figure 10A), α2 (P ≤ 0.001, Figure 10B), and β1 (P ≤ 0.01, Figure 10C) genes compared to PTZ-treated group. In contrast, the gene expression of β2 remained non-significant (P > 0.05) in all four groups.
Discussion
In the present study, we examined the possible role of NO-cGMP signaling pathway in anticonvulsant effect of acute sumatriptan administration using specific and nonspecific inhibitors of NOS, sGC, and PDE5 in mices as involvement of NO-cGMP pathway in PTZ-induced seizure has been reported recently (27). In addition, we also evaluated the contribution of inducible NOS (iNOS) in this effect. Furthermore, all findings were confirmed by studying the mRNA expression of nNOS, α1, α2, β1, and β2 genes by qRT-PCR analysis of the mices cerebral cortex tissues.
Epileptic seizure is phenomenon of excessive and hyper synchronous discharge of a set of neurons in brain as result of neuronal excitation due to Ca2+ influx (28). Regardless of the manufacture of countless anticonvuulsive therapeutic options, newer drugs with more potent antiepileptic activity and fewer side effects are needed to explore (29). Sumatriptan is a selective agonist of 5-HT1B/1D autoreceptors on serotonergic terminals. Despite of major clinical application of sumatriptan in migraine, neuroprotective effect of this drug in various studies including cerebral ischemia, tolerance and dependence, seizure, depression and obsessive-compulsive disorder (OCD), and anxiety has been reported recently (15, 21, 30-32).
Nitric oxide (NO) is an important intracellular signaling molecule, produced from three different isoforms of NOS through activation of L-arginine depending upon intracellular pathophysiological processes (33). Specifically in brain, the increased intracellular influx of Са2+ initiates NOS stimulation specifically nNOS and subsequent increase in NO concentration (34). The contribution of nNOS in neuronal disorders especially in modulation of seizure susceptibility is well-established (35).
The involvement of nitrergic system in PTZ-induced seizure is evident from a number of previous studies (23, 36). Moreover, the role of NOS inhibitors as anticonvulsant agents through diminution of NO concentration against PTZ-induced seizure is well reported in literature (37-39). Furthermore, the anticonvulsant properties of sumatriptan against PTZ-induced seizure have been already studied (40). In addition, a number of studies reported the involvement of NO as a main signaling mechanism underlying the therapeutic and pharmacological effects of sumatriptan (17, 18, 41). As shown in Figure 3, the subeffective doses of L-NNA and 7-NI augmented the anticonvulsive effect of subeffective administration of sumatriptan. This data reveals the involvement of NO in anticonvulsant effect of sumatriptan against PTZ-induced seizure, which corroborates the previous experiments (21).
It has been demonstrated that enhanced excitatory neurotransmission by NO lead to sGC stimulation and subsequent activation of cGMP in post synaptic membranes (42). Furthermore, the functional stimulation of cGMP leads to neurodegenerative disorders including epilepsy (43). Evidences have been shown the involvement of NO and cGMP pathways in therapeutic effects of sumatriptan. It has been reported that during migraine episode, the NO-mediated increased levels of cGMP were significantly reversed by sumatriptan in L-arginine-NO-cGMP dependent manner (16). As shows in Figure 5, in consistence with previous studies, the subeffective dose of sumatriptan when coadministered with cGMP inhibitors significantly attenuated the PTZ-induced seizure in mice (13). In addition, as shown in Figure 7, sumatriptan significantly reduced the nitrite concentration in PFC of mice, which strengthens the involvement of NO-cGMP pathway in anticonvulsant activity of sumatriptan as reported previously (44).
The sGC comprises of two subunits of α and β represents in four isoform namely α1, α2, β1, and β2, and exists in two heterodimers of α1/β1 and α2/β1, whereas, the homodimers (β2) are enzymatically inactive (45). The activation of sGC subunits leads to cGMP simulation (10, 11). The NO-mediated neuronal excitability in cerebral cortex is well-known (46). Moreover, in cerebral cortex, the sGC subunits present in form of two functional heterodimers of α1/β1 and α2/β1, which coexist with nNOS (9, 47). Based on these evidences, as shown in Figures 9 and 10, the results of the present study showed that sumatriptan downregulated the PTZ-induced mRNA expression of nNOS, and α1, α2 and β1 subunits of soluble guanylyl cyclase as reported previously (48, 49).
![Schematic description of study design](https://services.brieflands.com/cdn/serve//315db/0211ce7b5d34979b5fff81efae500b0e3a2193cf/ijpr-19-181-g001.jpg)
![Effect of various doses of sumatriptan (0.3, 0.6, 1.2 and 2.4 mg/kg) on clonic seizure threshold (CST) on PTZ induced seizures in mice. Data are expressed as mean ± S.E.M. for 8 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc-test. **P ≤ 0.01, ***P ≤ 0.001 compared to control/vehicle](https://services.brieflands.com/cdn/serve//315db/a1da7e5532e5526e164c8e5bc6d511fcc891ab3d/ijpr-19-181-g002.jpg)
![Effect of subeffective doses of NOS inhibitors (A) L-NNA (1, 5, and 10 mg/kg), (B) 7-NI (30, 45, and 60 mg/kg) alone or in combination with acute subef fective dose of sumatriptan (0.3 mg/kg) on PTZ-induced clonic seizure threshold (CST) in mice. Data are expressed as mean ± S.E.M. for 8 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 compared to control/vehicle, ##P ≤ 0.01, ###P ≤ 0.001 compared to sumatriptan group](https://services.brieflands.com/cdn/serve//315db/94ae74dc17f4304b2c8382a6785da21da8e251de/ijpr-19-181-g003.jpg)
![Effect of subeffective doses of AG (30, 50, and 100 mg/kg) alone or in combination with acute subeffective dose of sumatriptan (0.3 mg/kg) on PTZ-induced CST in mice. Data are expressed as mean ± S.E.M. for 8 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test](https://services.brieflands.com/cdn/serve//315db/d4f39cafcfee71268d454d0c8dd28e8f1e97b871/ijpr-19-181-g004.jpg)
![Effect of subeffective doses of (A) MB (0.1, 0.5, and 1 mg/kg), (B) sildenafil (5, 10, and 20 mg/kg) alone or in combination with acute subeffective and effective doses of sumatriptan (0.3 and 1.2 mg/kg) on PTZ-induced CST in mice. Data are expressed as mean ± S.E.M. for 8 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. *P ≤ 0.005, ***P ≤ 0.001 compared to control, #P ≤ 0.05, ###P ≤ 0.001 compared to sumatriptan group](https://services.brieflands.com/cdn/serve//315db/bb121a1609fe051802df1bcbb273c82b4bd3c7a7/ijpr-19-181-g005.jpg)
![Effect of subeffective doses of coadministration of 7-NI (30 mg/kg) + MB (0.5 mg/kg) alone or in combination with acute subeffective dose of sumatriptan (0.3 mg/kg) on PTZ-induced CST in mice. Data are expressed as mean ± S.E.M. for 8 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. ***P ≤ 0.001 compared to control group, @@@P ≤ 0.001 compared to vehicle group, ###P ≤ 0.001 compared to sumatriptan group](https://services.brieflands.com/cdn/serve//315db/4f07155f05b7d27cad02bd4c3c197142cb67b1c3/ijpr-19-181-g006.jpg)
![Effect of sumatriptan on prefrontal cortex (PFC) nitrite levels of mice. Data are expressed as mean ± S.E.M. for 4 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. **P ≤ 0.01 compared to control group](https://services.brieflands.com/cdn/serve//315db/78ff57a961960471feb603ea560215f5d017f80d/ijpr-19-181-g007.jpg)
![Effect of subeffective doses of (A) 7-NI (30 mg/kg) and L-NNA (1 mg/kg), (B) MB (0.5 mg/kg) with acute subeffective dose of sumatriptan (0.3 mg/kg) on PFC nitrite levels of mice. Data are expressed as mean ± S.E.M. for 3 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 compared to control/vehicle group. #P ≤ 0.05, ##P ≤ 0.01, ###P ≤ 0.001 compared to sumatriptan group](https://services.brieflands.com/cdn/serve//315db/76ef165841b7c0c23bd8627819f7d8b4cf10ad74/ijpr-19-181-g008.jpg)
![Effect of sumatriptan on relative mRNA expression of nNOS in cerebral cortex of mice against PTZ-induced clonic seizure. Data are expressed as mean ± S.E.M. for 3 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. ****P ≤ 0.0001 compared to control group, @@P ≤ 0.01, @@@P ≤ 0.001 compared to PTZ group](https://services.brieflands.com/cdn/serve//315db/53adc9ba7acf5e5c033a9dc434dcd9b0b3253b74/ijpr-19-181-g009.jpg)
![Effect of sumatriptan on relative mRNA expression of (A) α1, (B) α2, (C) β1, and (D) β2 subunits of soluble guanylyl cyclase genes in cerebral cortex of mices against PTZ-induced clonic seizure. Data are expressed as mean ± S.E.M. for 3 mices, analyzed by one-way ANOVA followed by Tukey's post-hoc test. ****P ≤ 0.0001 compared to vehicle control, @P ≤ 0.05, @@P ≤ 0.01, @@@P ≤ 0.001 compared to PTZ group](https://services.brieflands.com/cdn/serve//315db/7643b00f585bcbae2b492421b73101160fbe4fb8/ijpr-19-181-g010.jpg)
Nucleotide sequences of the primers used in study
Gene name | Forward primer | Reverse primer | Amplicon length |
---|---|---|---|
nNOS | AATGGGTCTTGTGTATGCTAGG | ATGAAGATGGGAAGGAGTTGG | 186 |
α1 | GTAAGTGATAGCGGTGCCC | ACAGTGATCTTGCTTCCCAG | 130 |
α2 | TGCACAGACACTTAAGGAGAAG | CTAGCATCCTGGTCTTGTGATC | 158 |
β1 | TGAGATGCAGAAACAAGCCC | GAACCCAGAATCCCCAGAAG | 167 |
β2 | CACTGTATCCTCTGATCTCTGC | AAATCTCACCATCGTACCTGC | 157 |
GAPDH | AATACGGCTACAGCAACAGG | TGGGATGGAAATTGTGAGGG | 160 |
Conclusion
The findings of the present study demonstrated that acute administration of sumatriptan reversed the PTZ-induced seizure at least, in part, through inhibition of NO-cGMP signaling pathway.
Acknowledgements
References
-
1.
Behr C, Goltzene M, Kosmalski G, Hirsch E, Ryvlin P. Epidemiology of epilepsy. Rev Neurol. 2016;172:27-36. [PubMed ID: 26754036].
-
2.
LaRoche SM, Helmers SL. The new antiepileptic drugs: scientific review. JAMA. 2004;291:605-14. [PubMed ID: 14762040].
-
3.
Elger CE. Epilepsy in 2015: Classic antiepileptic drugs under fire, and new options emerge. Nat. Rev. Neurol. 2016;12:72-4. [PubMed ID: 26794652].
-
4.
Paoletti P. Molecular basis of NMDA receptor functional diversity. Eur. J.Neurosci. 2011;33:1351-65. [PubMed ID: 21395862].
-
5.
Förstermann U, Sessa WC. Nitric oxide synthases: regulation and function. Eur. Heart J. 2011;33:829-37. [PubMed ID: 21890489].
-
6.
Navidpour L, Shafaroodi H, Miri R, Dehpour AR, Shafiee A. Lipophilic 4-imidazoly-1, 4-dihydropyridines: synthesis, calcium channel antagonist activity and protection against pentylenetetrazole-induced seizure. Il Farmaco. 2004;59:261-9. [PubMed ID: 15081343].
-
7.
Mohseni G, Ostadhadi S, Akbarian R, Chamanara M, Norouzi Javidan A, Dehpour A-R. Anticonvulsant effect of dextrometrophan on pentylenetetrazole-induced seizures in mice: Involvement of nitric oxide and N-methyl-d-aspartate receptors. Epilepsy Behav. 2016;65:49-55. [PubMed ID: 27875784].
-
8.
Lesani A, Javadi-Paydar M, Khodadad TK, Asghari-Roodsari A, Shirkhodaei M, Norouzi A, Dehpour AR. Involvement of the nitric oxide pathway in the anticonvulsant effect of tramadol on pentylenetetrazole-induced seizures in mice. Epilepsy Behav. 2010;19:290-5. [PubMed ID: 20880756].
-
9.
Corbalán R, Chatauret N, Behrends S, Butterworth RF, Felipo V. Region selective alterations of soluble guanylate cyclase content and modulation in brain of cirrhotic patients. Hepatology. 2002;36:1155-62. [PubMed ID: 12395325].
-
10.
Ding JD, Burette A, Nedvetsky PI, Schmidt HH, Weinberg RJ. Distribution of soluble guanylyl cyclase in the rat brain. J. Comp. Neurol. 2004;472:437-48. [PubMed ID: 15065118].
-
11.
Mergia E, Russwurm M, Zoidl G, Koesling D. Major occurrence of the new α2β1 isoform of NO-sensitive guanylyl cyclase in brain. Cellular Signalling. 2003;15:189-95. [PubMed ID: 12464390].
-
12.
Garthwaite J. Glutamate, nitric oxide and cell-cell signalling in the nervous system. Trends Neurosci. 1991;14:60-7. [PubMed ID: 1708538].
-
13.
Bahremand A, Nasrabady SE, Ziai P, Rahimian R, Hedayat T, Payandemehr B, Dehpour AR. Involvement of nitric oxide-cGMP pathway in the anticonvulsant effects of lithium chloride on PTZ-induced seizure in mice. Epilepsy Res. 2010;89:295-302. [PubMed ID: 20304610].
-
14.
Jennings E, Ryan R, Christie M. Effects of sumatriptan on rat medullary dorsal horn neurons. Pain. 2004;111:30-7. [PubMed ID: 15327806].
-
15.
Stepień A, Chalimoniuk M, Strosznajder J. Serotonin 5HT1B/1D receptor agonists abolish NMDA receptor-evoked enhancement of nitric oxide synthase activity and cGMP concentration in brain cortex slices. Cephalalgia. 1999;19:859-65. [PubMed ID: 10668104].
-
16.
Tepper SJ, Rapoport AM, Sheftell FD. Mechanisms of action of the 5-HT1B/1D receptor agonists. Arch.Neurol. 2002;59:1084-8. [PubMed ID: 12117355].
-
17.
Hassanipour M, Rajai N, Rahimi N, Fatemi I, Jalali M, Akbarian R, Shahabaddini A, Nazari A, Amini-Khoei H, Dehpour AR. Sumatriptan effects on morphine-induced antinociceptive tolerance and physical dependence: The role of nitric oxide. Eur. J. Pharmacol. 2018;835:52-60. [PubMed ID: 30016663].
-
18.
Stepien A, Chalimoniuk M. Level of nitric oxide-dependent cGMP in patients with migraine. Cephalalgia. 1998;18:631-4. [PubMed ID: 9876887].
-
19.
Stean TO, Atkins AR, Heidbreder CA, Quinn LP, Trail BK, Upton N. Postsynaptic 5-HT1B receptors modulate electroshock-induced generalised seizures in rats. Br. J. Pharmacol. 2005;144:628-35. [PubMed ID: 15678098].
-
20.
Wesolowska A, Nikiforuk A, Chojnacka-Wojcik E. Anticonvulsant effect of the selective 5-HT1B receptor agonist CP 94253 in mice. Eur. J. Pharmacol. 2006;541:57-63. [PubMed ID: 16765343].
-
21.
Gooshe M, Ghasemi K, Rohani MM, Tafakhori A, Amiri S, Aghamollaii V, Ahmadi M, Dehpour AR. Biphasic effect of sumatriptan on PTZ-induced seizures in mice: Modulation by 5-HT1B/D receptors and NOS/NO pathway. Eur. J. Pharmacol. 2018;824:140-7. [PubMed ID: 29410249].
-
22.
Ghasemi M, Shafaroodi H, Nazarbeiki S, Meskar H, Ghasemi A, Bahremand A, Ziai P, Dehpour AR. Inhibition of NMDA receptor/NO signaling blocked tolerance to the anticonvulsant effect of morphine on pentylenetetrazole-induced seizures in mice. Epilepsy Res. 2010;91:39-48. [PubMed ID: 20663644].
-
23.
Rahimi N, Hassanipour M, Yarmohammadi F, Faghir Ghanesefat H, Pourshadi N, Bahramnejad E, Dehpour A. Nitric oxide and glutamate are contributors of anti-seizure activity of rubidium chloride: a comparison with lithium. Neurosci. Lett. 2019;708:134349. [PubMed ID: 31238129].
-
24.
Heydari A, Davoudi S. The effect of sertraline and 8-OH-DPAT on the PTZ_induced seizure threshold: Role of the nitrergic system. Seizure. 2017;45:119-24. [PubMed ID: 28012414].
-
25.
Tsikas D. Analysis of nitrite and nitrate in biological fluids by assays based on the Griess reaction: appraisal of the Griess reaction in the L-arginine/nitric oxide area of research. J. Chromatogr. B. 2007;851:51-70.
-
26.
Javadi S, Ejtemaeimehr S, Keyvanfar HR, Moghaddas P, Aminian A, Rajabzadeh A, Mani AR, Dehpour AR. Pioglitazone potentiates development of morphine-dependence in mice: Possible role of NO/cGMP pathway. Brain Res. 2013;1510:22-37. [PubMed ID: 23399681].
-
27.
Esmaili Z, Heydari A. Effect of acute caffeine administration on PTZ-induced seizure threshold in mice: Involvement of adenosine receptors and NO-cGMP signaling pathway. Epilepsy Res. 2019;149:1-8. [PubMed ID: 30391360].
-
28.
Fisher RS, Boas WVE, Blume W, Elger C, Genton P, Lee P, Engel Jr J. Epileptic seizures and epilepsy: definitions proposed by the International League Against Epilepsy (ILAE) and the International Bureau for Epilepsy (IBE). Epilepsia. 2005;46:470-2. [PubMed ID: 15816939].
-
29.
Meng F, You Y, Liu Z, Liu J, Ding H, Xu R. Neuronal calcium signaling pathways are associated with the development of epilepsy. Mol. Med. Rep. 2015;11:196-202. [PubMed ID: 25339366].
-
30.
Mies G. Neuroprotective effect of sumatriptan, a 5-HT1D receptor agonist, in focal cerebral ischemia of rat brain. J. Stroke Cerebrovasc Dis. 1998;7:242-9. [PubMed ID: 17895091].
-
31.
Pathak S, Cottingham EM, McConville BJ. The use of sumatriptan in the treatment of obsessive-compulsive disorder in an adolescent. J. Child Adolesc. Psychopharmacol. 2003;13:93-4.
-
32.
Amital D, Fostick L, Sasson Y, Kindler S, Amital H, Zohar J. Anxiogenic effects of Sumatriptan in panic disorder: a double-blind, placebo-controlled study. Eur. Neuropsychopharmacol. 2005;15:279-82. [PubMed ID: 15820416].
-
33.
Moezi L, Shafaroodi H, Hassanipour M, Fakhrzad A, Hassanpour S, Dehpour AR. Chronic administration of atorvastatin induced anti-convulsant effects in mice: the role of nitric oxide. Epilepsy Behav. 2012;23:399-404. [PubMed ID: 22405864].
-
34.
Rameau GA, Chiu LY, Ziff EB. NMDA receptor regulation of nNOS phosphorylation and induction of neuron death. Neurobiol. Aging. 2003;24:1123-33. [PubMed ID: 14643384].
-
35.
Rajasekaran K, Jayakumar R, Venkatachalam K. Increased neuronal nitric oxide synthase (nNOS) activity triggers picrotoxin-induced seizures in rats and evidence for participation of nNOS mechanism in the action of antiepileptic drugs. Brain Res. 2003;979:85-97. [PubMed ID: 12850575].
-
36.
Shafaroodi H, Moezi L, Ghorbani H, Zaeri M, Hassanpour S, Hassanipour M, Dehpour AR. Sub-chronic treatment with pioglitazone exerts anti-convulsant effects in pentylenetetrazole-induced seizures of mice: The role of nitric oxide. Brain Res. Bull. 2012;87:544-50. [PubMed ID: 22366335].
-
37.
Homayoun H, Khavandgar S, Namiranian K, Gaskari SA. and Dehpour AR. The role of nitric oxide in anticonvulsant and proconvulsant effects of morphine in mice.Epilepsy Res. 2002;48:33-41. [PubMed ID: 11823108].
-
38.
De Luca G, Di Giorgio RM, Macaione S, Calpona PR, Di Paola ED, Costa N, Cuzzocrea S, Citraro R, Russo E, De Sarro G. Amino acid levels in some brain areas of inducible nitric oxide synthase knock out mouse (iNOS-/-) before and after pentylenetetrazole kindling. Pharmacol. Biochem. Behav. 2006;85:804-12. [PubMed ID: 17223186].
-
39.
Itoh K, Watanabe M. Paradoxical facilitation of pentylenetetrazole-induced convulsion susceptibility in mice lacking neuronal nitric oxide synthase. Neuroscience. 2009;159:735-43. [PubMed ID: 19162139].
-
40.
Jand A, Palizvan MR. Sumatriptan, an Antimigraine Drug, Inhibits Pentylenetetrazol-induced Seizures in NMRI Mice. Drug Res. 2017;67:179-82.
-
41.
Akerman S, Williamson DJ, Kaube H, Goadsby PJ. The effect of anti-migraine compounds on nitric oxide-induced dilation of dural meningeal vessels. Eur. J. Pharmacol. 2002;452:223-8. [PubMed ID: 12354573].
-
42.
Bellamy TC, Garthwaite J. The receptor-like properties of nitric oxide-activated soluble guanylyl cyclase in intact cells. Mol. Cell Biochem. 2002;230:165-76. [PubMed ID: 11952092].
-
43.
Meldrum B, Garthwaite J. Excitatory amino acid neurotoxicity and neurodegenerative disease. Trends Pharmacol. Sci. 1990;11:379-87. [PubMed ID: 2238094].
-
44.
Bahramnjead E, Roodsari SK, Rahimi N, Etemadi P, Aghaei I, Dehpour AR. Effects of modafinil on clonic seizure threshold induced by pentylenetetrazole in mice: involvement of glutamate, nitric oxide, GABA, and serotonin pathways. Neurochem. Res. 2018;43:2025-37. [PubMed ID: 30145742].
-
45.
Gibb BJ, Garthwaite J. Subunits of the nitric oxide receptor, soluble guanylyl cyclase, expressed in rat brain. Eur. J. Neurosci. 2001;13:539-44. [PubMed ID: 11168561].
-
46.
Smith SL, Otis TS. Persistent changes in spontaneous firing of Purkinje neurons triggered by the nitric oxide signaling cascade. J. Neurosci. 2003;23:367-72. [PubMed ID: 12533595].
-
47.
Bidmon H-J, Starbatty J, Görg B, Zilles K, Behrends S. Cerebral expression of the α2-subunit of soluble guanylyl cyclase is linked to cerebral maturation and sensory pathway refinement during postnatal development. Neurochem. Int. 2004;45:821-32. [PubMed ID: 15312976].
-
48.
Solmaz V, Aksoy D, Yurtogulları S, Semiz M, Aydemir E. and Erbas O. The Effects of Methylene Blue and Tadalafil in Pentylenetetrazole Induced Convulsion Model.Gulhane Med. J. 2016;58.
-
49.
Itoh K, Watanabe M, Yoshikawa K, Kanaho Y, Berliner L, Fujii H. Magnetic resonance and biochemical studies during pentylenetetrazole-kindling development: the relationship between nitric oxide, neuronal nitric oxide synthase and seizures. Neuroscience. 2004;129:757-66. [PubMed ID: 15541897].