Trends in Med Sci

Image Credit:Trends in Med Sci

Characterization of Virulence Genes and Antibiotic Resistance of Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-susceptible Staphylococcus aureus (MSSA) Isolates in Intensive Care Unit (ICU) and Non-ICU Wards

Author(s):
Javad MoazenJavad MoazenJavad Moazen ORCID1, 2, Fatemeh Riyahi ZanianiFatemeh Riyahi ZanianiFatemeh Riyahi Zaniani ORCID1, 2,*, Behzad Hallaj AsgharBehzad Hallaj AsgharBehzad Hallaj Asghar ORCID1
1Infectious and Tropical Diseases Research Center, School of Medicine, Dezful University of Medical Sciences, Dezful, Iran
2School of Medicine, Dezful University of Medical Sciences, Dezful, Iran

Journal of Advanced Immunopharmacology:Vol. 2, issue 2; e129037
Published online:Aug 02, 2022
Article type:Research Article
Received:Jun 14, 2022
Accepted:Jul 18, 2022
How to Cite:Moazen J, Riyahi Zaniani F, Hallaj Asghar B. Characterization of Virulence Genes and Antibiotic Resistance of Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-susceptible Staphylococcus aureus (MSSA) Isolates in Intensive Care Unit (ICU) and Non-ICU Wards. J Adv Immunopharmacol. 2022;2(2):e129037. doi: https://doi.org/10.5812/tms-129037

Abstract

Background:

We are witnessing the increasing use of antibiotics and the upward trend of resistant nosocomial infections. Therefore, identifying pathogens and determining the local patterns of antibiotic resistance are the health system's priorities in any region.

Objectives:

The current study aimed to investigate the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in the Intensive Care Unit (ICU) and Non-ICU wards, the toxic shock syndrome toxin-1 (TSST-1), alpha-toxin (Hla), and pantone-valentine leucocidin (PVL) genes in S. aureus strains, and antibiotic resistance patterns to provide a clinical guide for clinicians in Southwest Iran.

Methods:

Staphylococcus aureus was isolated from clinical specimens between 2018 and 2020. Methicillin-resistant S. aureus was detected by cefoxitin screening. Then, the antimicrobial resistance of all isolates was tested with the disk diffusion (DD) and the minimum inhibitory concentration (MIC) methods. Virulence genes, including TSST-1, Hla, and PVL, were evaluated by the PCR method.

Results:

Of 186 S. aureus strains isolated from various specimens, 51 (27.4%) were MRSA, with a 26.8% rate in the ICU. All isolates were susceptible to vancomycin, teicoplanin, linezolid, daptomycin, and quinupristin-dalfopristin. The penicillin-resistant S. aureus proportion was 93.5% (174/186), and more than 50% of all S. aureus isolates were resistant to fluoroquinolones. The incidence rates of virulence factors, including TSST-1, Hla, and PVL genes in MRSA, were 3.9%, 39.2%, and 2%, respectively.

Conclusions:

It is recommended to start empiric treatment against MRSA in case of severe infections in the ICU with either quinupristin-dalfopristin, daptomycin, vancomycin, teicoplanin, or linezolid until the culture and antibiotic susceptibility test results are available. Nevertheless, following the antibiotic resistance pattern is necessary to start treatment for other infections.

1. Background

Staphylococcus aureus is a Gram-positive bacterium that can cause a wide range of clinical syndromes, from minor infections, such as skin and soft tissue infections, to major infections, such as bloodstream infections (BSIs) and pneumonia. This bacterium usually causes both community-acquired and hospital-acquired infections (1). Methicillin-resistant S. aureus (MRSA) infections have risen recently and are one of the most severe threats to developed and developing countries. Infections caused by MRSA have been associated with a more severe prognosis than those by methicillin-susceptible S. aureus (MSSA) strains (1, 2).
The ability of S. aureus to cause multiple infections is due to the presence of virulence factors and their high expression, some of which are toxin Panton-Valentine leukocidin (PVL) toxin, alpha-hemolysin (Hla), and toxic shock syndrome toxin-1 (TSST-1). Panton-Valentine leukocidin is a cytolysin toxin encoded by the PVL gene, which causes cations to enter and destroy neutrophils through the pores it creates in them. Leukocidin can act as a virulence agent by destroying leukocytes and eventually reducing their populations in the host body. Toxic shock syndrome toxin belongs to a group of toxins known as pyrogenic toxin superantigens (PTSAgs). Superantigens stimulate T cells by activating the VB variable region on a T cell receptor (TCR) and MHC class 2. Activated T cells release cytokines such as interleukin-1 and TNF-α, which cause shock and tissue damage (3, 4).
Some S. aureus strains, including MRSA, have become a therapeutic challenge due to the increased microbial resistance, especially in hospital-acquired infections (5, 6). On the other hand, there is evidence of increasing community-acquired S. aureus. We are also witnessing the transfer of MRSA from the community to the hospital environment, which raises a matter for consideration (7). Incorrect choice of drugs or inadequate dosing can lead to the development of resistant strains (8).
Because of the increasing use of antibiotics and the upward trend of resistant nosocomial infections, we need to identify pathogens and determine the local patterns of antibiotic resistance as the priorities of the health system in any region. The benefits of antibiotic stewardship programs implemented based on regional patterns include better patient outcomes, reduced drug side effects, including Clostridium difficile infection, resource conservation, and improved antibiotic susceptibility rates (9).

2. Objectives

The current study aimed to investigate the prevalence of MRSA isolated from ICU and non-ICU wards, determine toxic shock syndrome toxin-1, alpha-toxin, and PVL genes in S. aureus strains, and evaluate antibiotic resistance patterns as a clinical guide for clinicians in Southwest Iran.

3. Methods

3.1. Patient Samples

This study was conducted from 2018 to 2020. All positive samples were from inpatients and outpatients in Ganjavian hospital, a referral center in the north of Khuzestan province, Southwest Iran. The clinical specimens included blood, skin and soft tissue, tracheal aspirates, and urine, among others.

3.2. Detection of Staphylococcus aureus

Standard microbiological procedures (such as Gram staining, catalase, coagulase, and mannitol fermentation on mannitol salt agar (Merck, USA)) were conducted to detect S. aureus. The PCR test was used to amplify part of the fem gene to confirm that the isolates were S. aureus (10).

3.3. Antibiotic Susceptibility Testing

Antibiotic Susceptibility Testing (AST) of all isolates was carried out with the disk diffusion (DD) and the minimum inhibitory concentration (MIC) methods as described by the Clinical and Laboratory Standards Institute (CLSI) guidelines (11).
The antibiotic discs (BD, USA), penicillin (10 U), gentamicin (10 µg), erythromycin (15 µg), rifampicin (5 µg), tetracycline (30 µg), quinupristin/dalfopristin (15 µg), ciprofloxacin (5 µg), levofloxacin (5 µg), cefoxitin (30 μg), trimethoprim/sulfamethoxazole (1.25/23.75 µg), clindamycin (2 µg), and linezolid (30 µg) were used for the DD method. Vancomycin, daptomycin, and teicoplanin antibiotics were used for the MIC method. The AST results were interpreted according to the CLSI guidelines M100 (11). Staphylococcus aureus ATCC 25923 was used as the control strain. Methicillin-resistant S. aureus was detected using the DD method with cefoxitin disks (30 µg) (BD, USA) (11).

3.4. DNA Isolation

The DNA was isolated from bacterial cells by using the boiling method. The primers specific to the fem, mecA, Hla, PVL, and TSST-1 genes synthesized by Metabion (Germany) are listed in Table 1.
Table 1.Oligonucleotide Primers Used in this Study
Sequence NameSequence (5' → 3')Amplicon Length, bpReferences
femA FCTTACTTACTGCTGTACCTG685(10)
femA RATCTCGCTTGTTGTGTGC
mecA FAGAAGATGGTATGTGGAAGTTAG584(12)
mecA RATGTATGTGCGATTGTATTGC
pvl FGGAAACATTTATTCTGGCTATAC502(13)
pvl RCTGGATTGAAGTTACCTCTGG
hla FCGGTACTACAGATATTGGAAGC744(13)
hla RTGGTAATCATCACGAACTCG
tst1 FTTATCGTAAGCCCTTTGTTG398(13)
tst1 RTAAAGGTAGTTCTATTGGAGTAGG

3.5. Polymerase Chain Reaction Analysis

The polymerase chain reaction (PCR) for each gene was performed in a 25 µL volume containing 1 μL of primer F (10 pmol/μL), 1 μL of primer R (10 pmol/μL), 2.5 μL of DNA template, 12.5 μL of 1× Taq DNA polymerase Amplicon Red Dye Master mix (3 mM MgCl2, 0.2% Tween 20, 0.4 mM dNTPs, and 0.2 units/μL Taq DNA polymerase).
The amplification of fragments specific to all genes was carried out under the following conditions: Initial denaturation (94°C, 5 min), followed by 33 cycles of denaturation (94°C, 30 s), primer annealing (55°C, 30 s), extension (72°C, 30 s), and final extension (72°C, 5 min). Amplifications were performed with a Bio-Rad T100 thermal cycler (USA). The PCR products were analyzed by electrophoresis on a 1.5% agarose gel stained with a safe stain. Molecular size markers (Thermo Fisher Scientific) were also run to verify the product size. The PCR amplicons were visualized using UV light.

3.6. Statistical Analysis

Data were imported into WHONET 2020 and IBM SPSS V.21 software for statistical analysis and interpretation of AST results. To describe the data, frequency and percentage in qualitative variables were used. Also, Chi-square test was used to analyze the data, and P-value < 0.05 was considered statistically significant.

4. Results

A total of 186 S. aureus isolates were analyzed. Of them, 60.2% (112/186) were isolated from male patients. Among all isolates, 38.2% (71/186) and 54.8% (102/186) were collected from the Intensive Care Unit (ICU) and non-ICU wards (general wards), respectively. The remaining 7% of the samples belonged to outpatients.
The majority of the analyzed isolates were from blood (35%), skin and soft tissue (27%), and tracheal aspirate (20%). Of the 186 S. aureus isolates from various specimens, 51 (27.4%) were MRSA. Of the 51 MRSA isolates, 32 and 19 were in the non-ICU wards (general wards) and the ICU ward, respectively (Table 2). The PCR product specific to the fem gene was detected in all isolates. Besides, the mecA gene was detected in all MRSA isolates. In addition, the genetic evaluation results for toxins (PVL, Hla, and TSST-1) are presented in Table 3 and Figure 1.
Agarose gel electrophoresis of the PCR products. Lane 1, negative template control (NTC); lanes 1 and 2, Hla (744 bp); lane 3, PVL (502 bp); lane M, DNA size marker, 100 bp; lanes 4 and 5, mecA (584 bp).
Figure 1.

Agarose gel electrophoresis of the PCR products. Lane 1, negative template control (NTC); lanes 1 and 2, Hla (744 bp); lane 3, PVL (502 bp); lane M, DNA size marker, 100 bp; lanes 4 and 5, mecA (584 bp).

The AST results of MRSA, MSSA, and S. aureus isolates are shown in Figure 2, and the antimicrobial resistance profiles of S. aureus isolates in the non-ICU patients, ICU patients, and outpatients are presented in Figure 3.
Antimicrobial resistance profiles of MRSA, MSSA, and <i>Staphylococcus aureus</i> isolates. Penicillin (PEN), cefoxitin (FOX), erythromycin (E), tetracycline (TET), clindamycin (CD), levofloxacin (LEVO), ciprofloxacin (CIP), gentamycin (GM), trimethoprim/sulfamethoxazole (TS), rifampin (RIF), teicoplanin (TEC), vancomycin (V), linezolid (LZD), daptomycin (DAP), quinupristin-dalfopristin (SYN).
Figure 2.

Antimicrobial resistance profiles of MRSA, MSSA, and Staphylococcus aureus isolates. Penicillin (PEN), cefoxitin (FOX), erythromycin (E), tetracycline (TET), clindamycin (CD), levofloxacin (LEVO), ciprofloxacin (CIP), gentamycin (GM), trimethoprim/sulfamethoxazole (TS), rifampin (RIF), teicoplanin (TEC), vancomycin (V), linezolid (LZD), daptomycin (DAP), quinupristin-dalfopristin (SYN).

Antimicrobial resistance profiles of <i>Staphylococcus aureus</i> isolates in non-ICU wards, ICU patients, and outpatients. Penicillin (PEN), erythromycin (E), tetracycline (TET), ciprofloxacin (CIP), levofloxacin (LEVO), clindamycin (CD), cefoxitin (FOX), gentamycin (GM), trimethoprim/sulfamethoxazole (TS), rifampin (RIF), teicoplanin (TEC), vancomycin (V), linezolid (LZD), daptomycin (DAP), quinupristin-dalfopristin (SYN).
Figure 3.

Antimicrobial resistance profiles of Staphylococcus aureus isolates in non-ICU wards, ICU patients, and outpatients. Penicillin (PEN), erythromycin (E), tetracycline (TET), ciprofloxacin (CIP), levofloxacin (LEVO), clindamycin (CD), cefoxitin (FOX), gentamycin (GM), trimethoprim/sulfamethoxazole (TS), rifampin (RIF), teicoplanin (TEC), vancomycin (V), linezolid (LZD), daptomycin (DAP), quinupristin-dalfopristin (SYN).

Table 2.Distribution of Methicillin-resistant Staphylococcus aureus Among Clinical Isolates from Non-intensive Care Unit, Intensive Care Unit Patients, and Outpatients a
SampleMRSAMSSATotal
Clinical specimens
Blood18 (28.1)46 (71.9)64 (100)
Skin and soft tissue13 (26)37 (74)50 (100)
Tracheal aspirate10 (27)27 (73)37 (100)
Urine6 (31.6)13 (68.4)19 (100)
Others4 (25)12 (75)16 (100)
Different wards
Non-ICU wards32 (31.4)70 (68.6)102(100)
ICU19 (26.8)52 (73.2)71(100)
Outpatients013 (100)13 (100)
Total51 (27.4)135 (72.6)186 (100)

a Values are expressed as No. (%)

Table 3.Prevalence of Toxic Shock Syndrome Toxin-1 (TSST-1), Alpha-Toxin (Hla), and Pantone-Valentine Leukocidin (PVL) Genes Among Methicillin-resistant Staphylococcus aureus (MRSA) and Methicillin-susceptible S. aureus (MSSA) Isolates based on wards and specimens a
GeneHlaTSST-1PVL
MRSA and MSSA strains
MRSA39.23.92
MSSA41.54.40
P-value0.7790.8750.103
Different wards
Non-ICU wards40.871.4
ICU44.12.90
Outpatients15.400
P-value0.1390.3110.443
Clinical specimens
Blood45.34.70
Skin and soft tissue4642
Tracheal aspirate32.48.10
Urine36.800
Others2500
P-value0.7230.5410.744
Total40.94.30.5

a Values are expressed as %.

5. Discussion

In this study, the incidence of MRSA infection was observed (27.4%) in all samples. Of 51 patients with MRSA infection, 62% and 37% were admitted to general wards and the ICU, respectively. Various studies have shown that the prevalence of MRSA varies depending on the geographic region. For instance, MRSA has been reported to be more prevalent in Southern Europe than in Northern Europe, and a prevalence of 2.3% to 69.1% has been reported for some regions in Asia (14). Also, the prevalence of hospital-acquired infections caused by MRSA is still above 50% in many countries (4).
One of the main goals of this study was to determine the incidence of MRSA in the ICU because the latest studies recommend that empiric therapy against MRSA be started for patients when more than about 10 - 20% of S. aureus isolates are methicillin-resistant, especially for some severe infections such as bacteremia or hospital-acquired pneumonia (HAP) and ventilator-associated pneumonia (VAP). In the present study, the incidence of MRSA in the ICU was 26.8%, and since no similar study has been conducted in our referral treatment center, it is recommended to start antibiotic treatment against MRSA until the culture and AST results are available (15). Therefore, if it is necessary to start treatment for these severe infections, quinupristin-dalfopristin, daptomycin, vancomycin, teicoplanin, or linezolid can be prescribed depending on the infection site. Indeed, it should be noted that daptomycin is not a good option for treating MRSA pneumonia due to the weak penetration of the drug into the lung tissue (16).
Fluoroquinolones have always been considered effective in treating infections caused by S. aureus. However, because of the high and irrational use of this class of drugs, the microbial resistance to quinolones is increasing worldwide (17, 18). In a study conducted by Yitayeh et al. from 2015 to 2018, 137 positive cultures were evaluated for antibiotic resistance by the disk diffusion technique. Also, 10.4% of Gram-positive strains were S. aureus. Besides, 60% of S. aureus species were MDR, and about 49% of Gram-positive species were resistant to ciprofloxacin (19). In our study, quinolone exhibited relatively high resistance (more than 50%) to all isolates of S. aureus and MRSA. Therefore, to treat infections caused by S. aureus, especially MRSA, in this geographical area, the choice of fluoroquinolones without access to antibiotic susceptibility testing is not logical.
This study implied that penicillins are not a good option for treating staphylococcal infections because of the high resistance of S. aureus to this class of drugs (more than 93%). Similarly, in a 2020 review article by Tsouklidis et al., penicillin treatment for staphylococcal infections was not successful (20).
In two studies conducted in Iran, MRSA species showed high resistance to aminoglycosides, especially gentamicin. In a study by Rahimi and Torabi in Isfahan, Iran, in 2017, the rate of MRSA resistance to gentamicin was over 60% (21, 22). In a review study by Darvishi et al., the resistance of Staphylococcus species to gentamicin was about 80% (23). On the other hand, in our study, 13.5% of all S. aureus isolates and about half MRSA isolates were resistant to gentamicin. In addition, the resistance rate of both S. aureus and MRSA species to clindamycin was about 48%. Based on similar studies conducted in our country, the resistance rate of MRSA to aminoglycosides is high, so it seems that this class of drugs is not a good option for treating MRSA infections.
Hospital-acquired MRSA (HA-MRSA) causes serious infections such as bacteremia and pneumonia and is often resistant to at least one of the drugs used for this organism. In our study, most infections caused by MRSA were of nosocomial origin and isolated from blood, skin and soft tissue, and respiratory secretions. According to similar studies, HA-MRSA infections are usually related to the patient's underlying disease, exposure to broad-spectrum antibiotics, or hospital procedure complications. Therefore, controlling the underlying disease, continuously monitoring antimicrobial susceptibility patterns, and adhering to nosocomial infection control measures are particularly important to preventing MRSA nosocomial infections (24, 25). We usually expect more MRSA infections in the ICU than in non-ICU wards (26, 27). However, our study did not show this pattern, and even the prevalence was slightly higher in non-ICU wards (31.4% in non-ICU vs. 26.8% in ICU). Also, due to the risk of transmitting the resistance pattern to acquired organisms from the community, we should consider the risk of more severe community-acquired MRSA infections in the future.
Rossato et al. in Brazil and Kot et al. in Poland showed no resistance to vancomycin, linezolid, or teicoplanin (28, 29). Also, in a study by Kayili and Sanlibaba in Turkey, no resistance to linezolid was reported in any of the S. aureus strains, but low resistance (18.8%) was observed to vancomycin (30). Fortunately, in our study, all strains of S. aureus were sensitive to vancomycin, linezolid, and teicoplanin. However, it should be noted that MRSA species can acquire antimicrobial resistance factors very quickly, so we think we cannot rely only on this study's results. Therefore, the antimicrobial resistance pattern of S. aureus strains should be examined continuously.
Staphylococcus aureus strains capable of producing PVL are more likely to cause severe infections such as necrotizing pneumonia and skin and soft tissue infections. In a study by Kwapisz et al. on MRSA and MSSA strains, the detection of the PVL gene was much more common in MRSA than in MSSA isolates (31). In another study by Zerehsaz et al. on 215 hospital strains of S. aureus in Tehran, Iran, the PVL and TSST-1 genes were found in 1.4% and 32.3% of the isolates, respectively (32). In this study, the prevalence of the PVL gene was significantly higher in MRSA strains (2%), while in all Staphylococcus strains, it was about 0.5%. On the other hand, the prevalence of the TSST-1 gene in all S. aureus strains was 4.3%. Regarding the detection of the PVL gene, the results are almost similar to previous studies, except that in our study, the prevalence of the TSST-1 gene was much lower. Although the prevalence of the PVL gene was relatively low, its higher detection in soft tissue infections is noteworthy. It seems that skin and soft tissue infections caused by S. aureus, especially MRSA, in this center should be seriously taken because there is a possibility of rapid progression to severe disease.

5.1. Conclusions

Based on the results of this study, in case of severe infections in the ICU such as bacteremia and HAP/VAP, it is recommended to start empiric treatment against MRSA with either quinupristin-dalfopristin, daptomycin, vancomycin, teicoplanin, or linezolid until the culture and antibiotic susceptibility testing results are available. Nevertheless, to start treatment for other infections caused by S. aureus strains, the choice of medication should be made based on the antibiotic resistance pattern.

Acknowledgments

Footnotes

References

  • 1.
    Ansari S, Jha RK, Mishra SK, Tiwari BR, Asaad AM. Recent advances in Staphylococcus aureus infection: focus on vaccine development. Infect Drug Resist. 2019;12:1243-55. https://doi.org/10.2147/idr.S175014.
  • 2.
    Cheung GY, Bae JS, Otto M. Pathogenicity and virulence of Staphylococcus aureus. Virulence. 2021;12(1):547-69. https://doi.org/10.1080/21505594.2021.1878688.
  • 3.
    Algammal AM, Hetta HF, Elkelish A, Alkhalifah DHH, Hozzein WN, Batiha GE, et al. Methicillin-Resistant Staphylococcus aureus (MRSA): one health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist. 2020;13:3255-65. https://doi.org/10.2147/idr.S272733.
  • 4.
    Que Y, Moreillon P. Staphylococcus aureus (Including Staphylococcal Toxic Shock). Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases. Churchill Livingstone; 2010. p. 2543-78. https://doi.org/10.1016/b978-0-443-06839-3.00195-8.
  • 5.
    Kanjilal S, Sater MR, Thayer M, Lagoudas GK, Kim S, Blainey PC, et al. Trends in Antibiotic Susceptibility in Staphylococcus aureus in Boston, Massachusetts, from 2000 to 2014. J Clin Microbiol. 2018;56(1). https://doi.org/10.1128/jcm.01160-17.
  • 6.
    Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, et al. Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research. Nat Rev Microbiol. 2019;17(4):203-18. https://doi.org/10.1038/s41579-018-0147-4.
  • 7.
    Arjyal C, Kc J, Neupane S. Prevalence of Methicillin-Resistant Staphylococcus aureus in Shrines. Int J Microbiol. 2020;2020:1-10. https://doi.org/10.1155/2020/7981648.
  • 8.
    Pérez VKC, Costa GMD, Guimarães AS, Heinemann MB, Lage AP, Dorneles EMS. Relationship between virulence factors and antimicrobial resistance in Staphylococcus aureus from bovine mastitis. J Glob Antimicrob Resist. 2020;22:792-802. https://doi.org/10.1016/j.jgar.2020.06.010.
  • 9.
    Barlam TF, Cosgrove SE, Abbo LM, MacDougall C, Schuetz AN, Septimus EJ, et al. Implementing an Antibiotic Stewardship Program: Guidelines by the Infectious Diseases Society of America and the Society for Healthcare Epidemiology of America. Clin Infect Dis. 2016;62(10):e51-77. https://doi.org/10.1093/cid/ciw118.
  • 10.
    Ardic N, Sareyyupoglu B, Ozyurt M, Haznedaroglu T, Ilga U. Investigation of aminoglycoside modifying enzyme genes in methicillin-resistant staphylococci. Microbiol Res. 2006;161(1):49-54. https://doi.org/10.1016/j.micres.2005.05.002.
  • 11.
    Wayne PA. Clinical and Laboratory Standards Institute: Performance standards for antimicrobial susceptibility testing: 20th informational supplement. Inform Suppl. 2010;31(1):100-21.
  • 12.
    Azimian A, Havaei SA, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic Characterization of a Vancomycin-Resistant Staphylococcus aureus Isolate from the Respiratory Tract of a Patient in a University Hospital in Northeastern Iran. J Clin Microbiol. 2012;50(11):3581-5. https://doi.org/10.1128/jcm.01727-12.
  • 13.
    Havaei SA, Azimian A, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic Characterization of Methicillin Resistant and Sensitive, Vancomycin Intermediate Staphylococcus aureus Strains Isolated from Different Iranian Hospitals. ISRN Microbiol. 2012;2012:1-6. https://doi.org/10.5402/2012/215275.
  • 14.
    Hassoun A, Linden PK, Friedman B. Incidence, prevalence, and management of MRSA bacteremia across patient populations—a review of recent developments in MRSA management and treatment. Critic Care. 2017;21(1). https://doi.org/10.1186/s13054-017-1801-3.
  • 15.
    Kalil AC, Metersky ML, Klompas M, Muscedere J, Sweeney DA, Palmer LB, et al. Management of Adults With Hospital-acquired and Ventilator-associated Pneumonia: 2016 Clinical Practice Guidelines by the Infectious Diseases Society of America and the American Thoracic Society. Clin Infect Dis. 2016;63(5):e61-e111. https://doi.org/10.1093/cid/ciw353.
  • 16.
    Brown NM, Goodman AL, Horner C, Jenkins A, Brown EM. Treatment of methicillin-resistant Staphylococcus aureus (MRSA): updated guidelines from the UK. JAC Antimicrob Resist. 2021;3(1). https://doi.org/10.1093/jacamr/dlaa114.
  • 17.
    Yang P, Chen Y, Jiang S, Shen P, Lu X, Xiao Y. Association between the rate of fluoroquinolones-resistant gram-negative bacteria and antibiotic consumption from China based on 145 tertiary hospitals data in 2014. BMC Infect Dis. 2020;20(1). https://doi.org/10.1186/s12879-020-04981-0.
  • 18.
    Solano-Gálvez SG, Valencia-Segrove MF, Prado MJO, Boucieguez ABL, Álvarez-Hernández DA, Vázquez-López R. Mechanisms of resistance to quinolones. Antimicrobial Resistance-A One Health Perspective. IntechOpen; 2020.
  • 19.
    Yitayeh L, Gize A, Kassa M, Neway M, Afework A, Kibret M, et al. Antibiogram Profiles of Bacteria Isolated from Different Body Site Infections Among Patients Admitted to GAMBY Teaching General Hospital, Northwest Ethiopia. Infect Drug Resist. 2021;Volume 14:2225-32. https://doi.org/10.2147/idr.S307267.
  • 20.
    Tsouklidis N, Kumar R, Heindl SE, Soni R, Khan S. Understanding the Fight Against Resistance: Hospital-Acquired Methicillin-Resistant Staphylococcus Aureus vs. Community-Acquired Methicillin-Resistant Staphylococcus Aureus. Cureus. 2020. https://doi.org/10.7759/cureus.8867.
  • 21.
    Kavusi M, Nemati Mansour F, Mahdion SM. The Prevalence of Antibiotic Resistance in Methicillin-Resistant Staphylococcus aureus and the Determination of Aminoglycoside Resistance Gene aac(6΄)-Ie/aph (2˝) Isolated from Hospitalized Patientsin Imam Hossein, Loghman Hakim, and Pars Hospitals in Tehran using Polymerase chain Reaction. J Ilam Univ Med Sci. 2019;27(1):85-94. https://doi.org/10.29252/sjimu.27.1.85.
  • 22.
    Rahimi F, Torabi M. Resistance to Aminoglycosides among Methicillin Resistant Staphylococcus aureus Strains Isolated from Patients with Urinary Tract Infection in Isfahan, Iran 2017. Iran J Infect Dis Trop Med. 2019.
  • 23.
    Darvishi M, Forootan M, Nazer MR, Karimi E, Noori M. Nosocomial Infections, Challenges and Threats: A Review Article. Iran J Med Microbiol. 2020;14(2):162-81. https://doi.org/10.30699/ijmm.14.2.162.
  • 24.
    Soltani R, Khorvash F, Pazandeh F. Antimicrobial Resistance Pattern of Nosocomial Infections at a Referral Teaching Hospital. J Pharm Care. 2020. https://doi.org/10.18502/jpc.v8i1.2744.
  • 25.
    Mao P, Peng P, Liu Z, Xue Z, Yao C. Risk Factors And Clinical Outcomes Of Hospital-Acquired MRSA Infections In Chongqing, China. Infect Drug Resist. 2019;12:3709-17. https://doi.org/10.2147/idr.S223536.
  • 26.
    Bhatta DR, Koirala S, Baral A, Amatya NM, Parajuli S, Shrestha R, et al. Methicillin-Resistant Staphylococcus aureus Contamination of Frequently Touched Objects in Intensive Care Units: Potential Threat of Nosocomial Infections. Can J Infect Dis Med Microbiol. 2022;2022:1-6. https://doi.org/10.1155/2022/1023241.
  • 27.
    Colaneri M, Carlo DD, Amatu A, Marvulli LN, Corbella M, Petazzoni G, et al. Ventilator-associated Pneumonia Due to MRSA vs MSSA: What Should Guide Empiric Therapy? Research Square. 2022. https://doi.org/10.21203/rs.3.rs-1373282/v1.
  • 28.
    Kot B, Wierzchowska K, Piechota M, Grużewska A. Antimicrobial resistance patterns in methicillin-resistant Staphylococcus aureus from patients hospitalized during 2015-2017 in hospitals in Poland. Medical Principles and Practice. 2020;29(1):61-8. https://doi.org/10.1159/000501788.
  • 29.
    Rossato AM, Primon-Barros M, Rocha LDL, Reiter KC, Dias CAG, d’Azevedo PA. Resistance profile to antimicrobials agents in methicillin-resistant Staphylococcus aureus isolated from hospitals in South Brazil between 2014-2019. Rev Soc Bras Med Trop. 2020;53. https://doi.org/10.1590/0037-8682-0431-2020.
  • 30.
    Kayili E, Sanlibaba P. Prevalence, characterization and antibiotic resistance of Staphylococcus aureus isolated from traditional cheeses in Turkey. Int J Food Prop. 2020;23(1):1441-51. https://doi.org/10.1080/10942912.2020.1814323.
  • 31.
    Kwapisz E, Garbacz K, Kosecka-Strojek M, Schubert J, Bania J, Międzobrodzki J. Presence of egc-positive major clones ST 45, 30 and 22 among methicillin-resistant and methicillin-susceptible oral Staphylococcus aureus strains. Sci Rep. 2020;10(1). https://doi.org/10.1038/s41598-020-76009-1.
  • 32.
    Zerehsaz J, Najar Peerayeh S. Prevalence of mecA, tsst1, and pvl, as Well as agr Specific Groups in Clinical Isolates of Staphylococcus aureus from Patients Admitted to Hospitals in Tehran, Iran. Qom Univ Med Sci J. 2020;14(9):59-68. https://doi.org/10.52547/qums.14.9.59.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles