Abstract
Background:
Congenital CMV infection is the most prevalent congenital infection in the world, and perinatal Listeria infection is an important cause of neonatal sepsis. The identification of these two infections is hard. The PCR technique is a sensitive method, which is not simply available in Iran.Objectives:
This study investigated the prevalence of CMV and Listeria in 100 urine samples from under 21-day-old neonates with positive risk factors by PCR electrophoresis and fluorescent end-point detection (FEP) PCR in Tehran referral hospitals.Methods:
We used 100 urine samples from neonates admitted to 11 medical centers in Tehran with positive selected clinical symptoms compatible with these infections. Electrophoresis and FEP PCR for CMV and Listeria were performed on all urine samples. For the data analysis, SPSS version 21 software was used, and p values of less than 0.05 were considered significant.Results:
We collected 100 urine samples from 100 under 21-day-old neonates, referring to Tehran hospitals. Seven cases were positive for Listeria, and 58 cases were positive for CMV by electrophoresis and FEP PCR. Respiratory distress was the most common clinical finding in both groups. The Mc-Nemar test revealed a statistical agreement between calcification and CMV and meningitis and Listeria (P = 0.18 and 0.07, respectively). There was a positive relationship between the neonates’ age and CMV-positive condition (P = 0.001). This result was not significant among Listeria-positive cases.Conclusions:
Screening for CMV and Listeria infections in neonates with clinical features compatible with these intrauterine infections may give important information for their treatment and follow-up.Keywords
1. Background
Neonatal acquired in utero, and perinatal infections are important to mortality and future growth and development of the neonates (1). Toxoplasmosis, Others, Rubella, Cytomegalovirus, Herpes (TORCH) represents a group of important pathogenic infections in the fetus. Cytomegalovirus (CMV) is one of the TORCH members and has various pathologic effects on the fetus. Intrauterine CMV infection is an asymptomatic course to a congenital syndrome, and unfortunately, asymptomatic cases may progress to a handicap later (2, 3). Developing countries in Africa (Gambia, Ivory Coast), Asia (China, Korea, Taiwan, India), and Latin America (Brazil, Chile, Mexico, Panama) report the birth prevalence of congenital CMV infection ranging from 0.6 to 6.1% of pregnancies (4). This is higher than the incidence in developed countries as 0.2% - 2% (average of 0.64%) of pregnancies in the US, Canada, Australia, and Western Europe (4-8). Cytomegalovirus inclusion disease manifestations are cutaneous (petechial, purpura, Blueberry muffin baby), hematologic (thrombocytopenia), and CNS (ventriculomegaly, Microcephaly, cerebral atrophy, chorioretinitis). Intrauterine growth retardation, hepatosplenomegaly, and sensorineural hearing loss (SNHL) may occur, with SNHL being the most common neurological complication (9). Various studies give relevant information on the importance of CMV in the etiology of SNHL. Today, more than 40% of deafness cases needing rehabilitation, which previously had no known etiology, are attributed to CMV (10).
Other perinatal infections, which are not TORCH group members such as Listeria, are relatively rare but can be the causes of sepsis syndrome and are preventable by health measures. The prevalence of Listeria infection in Iranian food products is high, and it was 52% and 48% in north and west abattoirs (11). Maternal infection by this organism may cause sepsis syndrome in neonates. In a study of early-onset sepsis in neonates in Kashan (2015), two (3.2%) out of 104 positive blood cultures were positive for Listeria (12). Screening of neonates with positive clinical manifestations compatible with these two infections can be an important measure in the early treatment of these infections and prevention of their later complications.
2. Objectives
Since there is not enough information on CMV and Listeria by PCR in Iran, this study aimed to investigate the prevalence of CMV and Listeria in 100 urine samples from neonates under 21-days-old who had positive risk factors for these two infections selected from Tehran referral hospitals.
3. Methods
We obtained 100 urine samples from neonates admitted to Children Medical Center (Markaz Tebbi) and ten other private centers, Tehran, Iran, from June 2013 to December 2014.
Neonates with at least two symptoms of brain calcification, meningitis, prematurity, icterus, microcephaly, convulsion, hydrocephaly, fever, anemia, splenomegaly, and hepatomegaly were included in this study. Neonates with known syndromes, culture and PCR-positive infections, or confirmed perinatal infections and chromosomal abnormalities were excluded from this study.
Urine samples were gathered from each neonate by sterile Nelaton tubes directly from the vesicle, divided into six sterile 1.5 mL test tubes and stored at -20°C.
The DNA extraction was done by High pure PCR Template Purification Kit (Roche, Germany) according to the manufacturer’s protocol. The DNA amplification was done using the fluorescence end-point detection method by Listeria monocytogenes PCR Kit and cytomegalovirus PCR Kit (DNA technology, Russia) according to the kits’ manuals. The kits had the CE/IVD certificates with 95% and 99.5% sensitivity and specificity, respectively. The kits contained specific and internal control primers and probes. No-template control (NTC) was used to monitor potential contamination in the master mix. The PCR assay was repeated twice to confirm the initial findings. The PCR primers are shown in Tables 1 and 2. The PCR gel electrophoresis results for CMV and Listeria are shown in Figures 1 and 2.
Data were gathered by questionnaires, and data analysis was performed by SPSS, version 21, software using logistic regression, MacNemar test, and chi-square test. A P value of less than 0.05 was considered significant.
The PCR Primer Sequences in CMV and Listeria Electrophoresis PCR
| Name | Primer Name | Sequence |
|---|---|---|
| Cytomegalovirus | UL55-F2m | 5’-ATAGGAGGCGCCACGTATTCC-3’ |
| UL55-R2m | 5’-GTACCCCTATCGCGTGTGTTC-3’ | |
| Listeria monocytogenesis | LMF1-2 | 5’- CATCTCCGCCTGCAAGTCC-3’ |
| LMR1-2 | 5’- TTGGCGGCACATTTGTCACTG-3’ |
PCR Primer Sequences in CMV and Listeria Fluorescent End-point Detection (FEP PCR)
| Name | Probe Name | Sequence |
|---|---|---|
| CMV | UL55-pr2 | (FAM)ATGGCCCAGGGTACGGATCTTATTCGCTGGCCAT(B HQ-1) |
| Listeria | LM-fp1 | AGACGCCAATCGAAAAGAAACACGCGTCT |
Gel electrophoresis of Listeria monocytogenes by a modeled primer from the hyl A gene with Vector NTI software. 143 Basepair and 50 Basepair DNA ladder. Number 1 and 2 samples are positive and negative controls, and 3 and 4 bands are positive and negative patient samples, respectively.
Gel electrophoresis of CMV by a modeled primer from the UL55 gene with Vector NTI Software by 254 Basepair and 100 Basepair Markers. Number 1 to 5 bands are positive and negative patient samples, and 6 and 7 bands are positive and negative controls, respectively.
4. Results
We collected 100 urine samples from 100 under 21-day-old neonates. The mean age was 9 ± 5 days (2 - 20 days). Seven cases were positive in both Listeria electrophoresis and FEP PCR. Five Listeria cases were males; the mean age was 8.8 ± 4.4 days (4 - 7 days). Moreover, 58 cases were positive in CMV electrophoresis and FEP PCR, 34 of whom were males. The mean age was 11 ± 4.5 days (2 - 20 days). The CMV-positive group had a higher age than the Listeria-positive group (P = 0.000). Three cases were positive for both Listeria and CMV; one case was male, and the mean age was 11.3 ± 4.9 days (8 - 17 days).
Prematurity was the most common clinical finding in both groups, but convulsion and microcephaly were the prevalent clinical findings in the CMV group. Other problems, such as hydrocephaly, fever, anemia, splenomegaly, and hepatomegaly, were positive in the CMV group (Table 3).
Clinical Findings of the PCR of 100 Urine Samples of Neonates from Tehran Hospitals (March 2013 - 14)
| Anomaly | CMV Negative | CMV Positive | Listeria Negative | Listeria Positive |
|---|---|---|---|---|
| Calcification | ||||
| Negative | 42 | 56 | 91 | 7 |
| Positive | 0 | 2 | 2 | 0 |
| Microcephaly | ||||
| Negative | 35 | 43 | 72 | 6 |
| Positive | 7 | 15 | 21 | 1 |
| Prematurity | ||||
| Negative | 28 | 41 | 68 | 1 |
| Positive | 14 | 17 | 25 | 6 |
| Convulsion | ||||
| Negative | 32 | 44 | 73 | 3 |
| Positive | 10 | 14 | 20 | 4 |
| Meningitis | ||||
| Negative | 41 | 58 | 92 | 7 |
| Positive | 1 | 0 | 1 | 0 |
| Icterus | ||||
| Negative | 31 | 49 | 74 | 6 |
| Positive | 11 | 9 | 19 | 1 |
| Othera | ||||
| Negative | 31 | 34 | 59 | 6 |
| Positive | 11 | 24 | 34 | 1 |
Table 4 shows the diagnostic accuracy indices along with Mc-Nemar test p values for comparing anomalies (calcification, microcephaly, prematurity, convulsion, and meningitis) based on CMV and Listeria results. The results of the Mc-Nemar test revealed a significant difference between anomaly findings based on the CMV and Listeria results, but there is an agreement between calcification and CMV positive condition; and meningitis and Listeria positive condition (P = 0.18 and 0.07, respectively). This means that brain calcification in CMV-positive and meningitis in Listeria-positive neonates are the expected findings.
Clinical Findings of CMV and Listeria Sensitivity and Specificity and Negative and Positive Predictive Values in 100 neonates from Tehran Hospitals (March 2013 - 14)
| Anomaly | CMV Negative | CMV Positive | P Value | Listeria Negative | Listeria Positive | P Value |
|---|---|---|---|---|---|---|
| Calcification | SP = 100 | SN = 3.4 | < 0.0001 | SP = 97.8 | SN = 0 | 0.18 |
| NPV = 42.9 | PPV = 100 | NPV = 92.9 | PPV = 0 | |||
| Microcephaly | SP = 83.3 | SN = 25.9 | < 0.0001 | SP = 77.4 | SN = 14.3 | 0.006 |
| NPV = 44.9 | PPV = 68.2 | NPV = 92.3 | PPV = 4.5 | |||
| Prematurity | SP = 66.7 | SN = 29.3 | < 0.0001 | SP = 73.1 | SN = 85.7 | <0.0001 |
| NPV = 40.6 | PPV = 54.8 | NPV = 98.6 | PPV = 19.4 | |||
| Convulsion | SP = 76.2 | SN = 24.1 | < 0.0001 | SP = 78.5 | SN = 57.1 | < 0.0001 |
| NPV = 42.1 | PPV = 58.3 | NPV = 96.1 | PPV = 16.7 | |||
| Meningitis | SP = 97.6 | SN = 0 | < 0.0001 | SP = 98.9 | SN = 0 | 0.070 |
| NPV = 41.4 | PPV = 0 | NPV = 92.9 | PPV = 0 | |||
| Icterus | SP = 73.8 | SN = 15.5 | < 0.0001 | SP = 79.6 | SN = 14.3 | 0.015 |
| NPV = 38.8 | PPV = 45 | NPV = 92.5 | PPV = 5.0 | |||
| Other | SP = 73.8 | SN = 41.4 | 0.001 | SP = 63.4 | SN = 14.3 | < 0.0001 |
| NPV = 47.7 | PPV = 68.6 | NPV = 90.8 | PPV = 2.9 |
Table 5 demonstrates the results of logistic regression for neonatal age and CMV findings. The odds ratio (OR) was equal to 1.17 (95%CI: 1.06 to 1.29; P = 0.001). This means that each day increase in age may increase the chance of positive CMV condition by 17%. Three cases had both infections, all of whom had prematurity, and one case had a convulsion.
Logistic Regression Results for the Relationship Between Age and CMV and Listeria
| OR | 95%CI | P Value | |
|---|---|---|---|
| CMV | 1.17 | 1.06 - 1.29 | 0.001 |
| Listeria | 0.97 | 0.82 - 1.13 | 0.67 |
5. Discussion
Congenital CMV infection is a prevalent disorder, especially in developing countries; the incidence of this infection is 0.7 - 4.5 million infections per year compared to 0.12 million per year in developed countries. The clinical features of this infection include stillbirth, IUGR, preterm birth, brain calcification, sensory neural hearing loss, visual disorders and loss, hepatosplenomegaly, thrombocytopenia, jaundice, microcephaly, and seizure. However, 90% of cases are asymptomatic at birth, and neurologic handicap may occur in them (13). In a study on saliva specimens from 600 healthy Iranian neonates in the South of Tehran (2012), two cases were positive in CMV PCR, and both of them were asymptomatic. This study did not suggest the screening of congenital CMV infection in Iranian neonates (14). However, it does not rule out the need for CMV screening in children with positive risk factors. There is a time limitation for the diagnosis of congenital CMV infection and the detection of this virus at ages older than two to three weeks can reflect the acquired or breastfed infection (15); thus, our study may reflect the congenital CMV infection.
In 2010, WHO developed an international standardized procedure for quantitative CMV measurement from the National Institute of Biological Standards and Controls in the United Kingdom (16). Reference reagents are now available, and their use allows the viral load to be expressed as international units/mL (17). Our study used both gel electrophoresis and (FEP) PCR for qualitative PCR measurement of CMV in the urine of neonates younger than 21 days with physical findings of probable congenital CMV infection; both results were completely in agreement. This may increase the accuracy of our findings. In a study in South Africa on hospital records of neonates tested for CMV infection, 91% of CMV-infected neonates had low birth weight, 83% were preterm, and 29% were small for gestational age. Hepatosplenomegaly and thrombocytopenia were more likely to occur in CMV-positive neonates (18). In our study, prematurity, microcephaly, convulsion, and hepatosplenomegaly were common findings. Listeria infection in the fetus and neonate is relatively rare. This organism can survive in cold temperatures, and eating contaminated food during pregnancy may cause perinatal infection; its incidence is 2 - 13/100,000 live births. It may occur hours after birth or may be delayed for several weeks. Clinical presentation depends on the timing and route of infection. Neonatal infection with Listeria mostly occurs during and after birth. Listeria accounts for 5% of early-onset sepsis in premature neonates with amnionitis (with a characteristic brown, murky amniotic fluid). Moreover, 70% of Listeria infections occur in infants younger than 35 weeks of gestation, and the late-onset disease is accompanied by meningitis. In our study, six cases of Listeria infection had prematurity, one case had a convulsion, and one case had meningitis. We had no information about the disease in their mothers (19, 20).
In a study in summer 2011, the prevalence of L. monocytogenes was estimated to be 5% in Kerman region raw milk samples (21). In the first study on broiler flocks in the west and North of Iran, L. monocytogenes was isolated from 44 out of 490 flocks and cloaca samples with a prevalence of 8.97% (2010). The potential risk factor for increasing Listeria colonization was the litter quality (11).
From 170 clinical samples from patients with spontaneous abortions hospitalized in Shariati Hospital, Tehran, Iran (2014), using multiplex PCR, 14 cases were positive, and from 107 samples of cheese, cream, and Kashk, nine (8.4%) were positive. In a study on pregnant women with premature delivery or perinatal fever in 2013 in Shandong, China, four neonates (0.34%) were identified with listeriosis by umbilical blood culture and placental swab culture (22, 23). In our study, six neonates who were positive for listeria had prematurity. The high prevalence of Listeria contamination in food may raise the possibility of Listeria infection in neonates in our community.
5.1. Conclusions
The results of this study showed that being aware of possible CMV infection in neonates with brain calcification is important, and meningitis can be a manifestation of Listeria infection. Studies with a higher number of samples are proposed to get precise information about the epidemiology of these two important infections in Iranian neonates.
References
-
1.
Neu N, Duchon J, Zachariah P. TORCH infections. Clin Perinatol. 2015;42(1):77-103. viii. [PubMed ID: 25677998]. https://doi.org/10.1016/j.clp.2014.11.001.
-
2.
Fowler KB, Stagno S, Pass RF. Maternal immunity and prevention of congenital cytomegalovirus infection. JAMA. 2003;289(8):1008-11. [PubMed ID: 12597753]. https://doi.org/10.1001/jama.289.8.1008.
-
3.
Gaytant MA, Rours GI, Steegers EA, Galama JM, Semmekrot BA. Congenital cytomegalovirus infection after recurrent infection: Case reports and review of the literature. Eur J Pediatr. 2003;162(4):248-53. [PubMed ID: 12647198]. https://doi.org/10.1007/s00431-002-1115-5.
-
4.
Lanzieri TM, Dollard SC, Bialek SR, Grosse SD. Systematic review of the birth prevalence of congenital cytomegalovirus infection in developing countries. Int J Infect Dis. 2014;22:44-8. [PubMed ID: 24631522]. [PubMed Central ID: PMC4829484]. https://doi.org/10.1016/j.ijid.2013.12.010.
-
5.
Dollard SC, Grosse SD, Ross DS. New estimates of the prevalence of neurological and sensory sequelae and mortality associated with congenital cytomegalovirus infection. Rev Med Virol. 2007;17(5):355-63. [PubMed ID: 17542052]. https://doi.org/10.1002/rmv.544.
-
6.
Kenneson A, Cannon MJ. Review and meta-analysis of the epidemiology of congenital cytomegalovirus (CMV) infection. Rev Med Virol. 2007;17(4):253-76. [PubMed ID: 17579921]. https://doi.org/10.1002/rmv.535.
-
7.
McMullan BJ, Palasanthiran P, Jones CA, Hall BM, Robertson PW, Howard J, et al. Congenital cytomegalovirus--time to diagnosis, management and clinical sequelae in Australia: opportunities for earlier identification. Med J Aust. 2011;194(12):625-9. [PubMed ID: 21692718].
-
8.
Munro SC, Hall B, Whybin LR, Leader L, Robertson P, Maine GT, et al. Diagnosis of and screening for cytomegalovirus infection in pregnant women. J Clin Microbiol. 2005;43(9):4713-8. [PubMed ID: 16145132]. [PubMed Central ID: PMC1234061]. https://doi.org/10.1128/JCM.43.9.4713-4718.2005.
-
9.
noorbakhsh S, Farhadi M, Tabatabaei A. Cytomegalovirus, a common cause of intrauterine infection: A case control study in Tehran, Iran. J Compr Ped. 2010;2(1). e93759.
-
10.
Boppana SB, Fowler KB, Pass RF, Rivera LB, Bradford RD, Lakeman FD, et al. Congenital cytomegalovirus infection: Association between virus burden in infancy and hearing loss. J Pediatr. 2005;146(6):817-23. [PubMed ID: 15973325]. https://doi.org/10.1016/j.jpeds.2005.01.059.
-
11.
Seifi S. Prevalence and risk factors for Listeria monocytogenes contamination in Iranian broiler flocks. Acta Scientiae Veterinariae. 2012;40(4):1-6.
-
12.
Mosayebi Z, Movahedian AH, Ebrahim B. [Evaluation of the epidemiologic features of early-onset sepsis in the neonatal ward of Shabih-Khani Hospital in Kashan, Iran]. Iran J Neonatol. 2014;5(4):20-3. Persian.
-
13.
van Zuylen WJ, Hamilton ST, Naing Z, Hall B, Shand A, Rawlinson WD. Congenital cytomegalovirus infection: Clinical presentation, epidemiology, diagnosis and prevention. Obstet Med. 2014;7(4):140-6. [PubMed ID: 27512442]. [PubMed Central ID: PMC4934990]. https://doi.org/10.1177/1753495X14552719.
-
14.
Fahimzad A, Afgeh SA, Eghbali E, Abdinia B, Shiva F, Rahbar M. Screening of congenital CMV infection in saliva of neonates by PCR: Report of a pilot screening study in Iran. Clin Lab. 2013;59(9-10):1171-4. [PubMed ID: 24273943]. https://doi.org/10.7754/clin.lab.2013.120910.
-
15.
Schleiss MR. Acquisition of human cytomegalovirus infection in infants via breast milk: Natural immunization or cause for concern? Rev Med Virol. 2006;16(2):73-82. [PubMed ID: 16287195]. https://doi.org/10.1002/rmv.484.
-
16.
Kraft CS, Armstrong WS, Caliendo AM. Interpreting quantitative cytomegalovirus DNA testing: Understanding the laboratory perspective. Clin Infect Dis. 2012;54(12):1793-7. [PubMed ID: 22412060]. [PubMed Central ID: PMC3357478]. https://doi.org/10.1093/cid/cis212.
-
17.
Caliendo AM. The long road toward standardization of viral load testing for cytomegalovirus. Clin Infect Dis. 2013;56(3):374-5. [PubMed ID: 23097589]. https://doi.org/10.1093/cid/cis905.
-
18.
Diar HA, Velaphi S. Characteristics and mortality rate of neonates with congenital cytomegalovirus infection. South Afr J Child Health. 2014;8(4):133. https://doi.org/10.7196/sajch.752.
-
19.
Kessler SL, Dajani AS. Listeria meningitis in infants and children. Pediatr Infect Dis J. 1990;9(1):61-3. [PubMed ID: 2105480]. https://doi.org/10.1097/00006454-199001000-00016.
-
20.
Gellin BG, Broome CV, Bibb WF, Weaver RE, Gaventa S, Mascola L. The epidemiology of listeriosis in the United States--1986. Listeriosis Study Group. Am J Epidemiol. 1991;133(4):392-401. [PubMed ID: 1899779]. https://doi.org/10.1093/oxfordjournals.aje.a115893.
-
21.
Mansouri-Najand L, Kianpour M, Sami M, Jajarmi M. Prevalence of Listeria monocytogenes in raw milk in Kerman, Iran. Vet Res Forum. 2015;6(3):223-6. [PubMed ID: 26893812]. [PubMed Central ID: PMC4611976].
-
22.
Pournajaf A, Rajabnia R, Sedighi M, Kassani A, Moqarabzadeh V, Lotfollahi L, et al. Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction. Rev Soc Bras Med Trop. 2016;49(5):624-7. [PubMed ID: 27812659]. https://doi.org/10.1590/0037-8682-0403-2015.
-
23.
Lv J, Qin Z, Xu Y, Xie Q. Listeria infection in Chinese pregnant women and neonates from Shandong. Int J Clin Exp Med. 2014;7(9):2730-4. [PubMed ID: 25356132]. [PubMed Central ID: PMC4211782].