Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Investigating the Presence of Efflux Pump Genes adeI and adeJ in Clinical Antibiotic-Resistant Isolates of Acinetobacter baumannii

Author(s):
Samaneh GhafariSamaneh Ghafari1, Reza MirnejadReza Mirnejad2, Fatemeh SameniFatemeh Sameni3, Mohamad Hoseyn Dehghan-TarazjaniMohamad Hoseyn Dehghan-Tarazjani4, Mansoor KhalediMansoor Khaledi3, Mohammad NiakanMohammad Niakan3,*
1Department of Environmental Health Engineering, Faculty of Health, Alborz University of Medical Sciences, Alborz, Karaj, Iran
2Molecular Biology Research Center, Systems Biology and Poisonings Institute, Baqiyatallah University of Medical Sciences, Tehran, Iran
3Department of Microbiology, Faculty of Medicine, Shahed University, Tehran, Iran
4Department of Biochemistry, School of Medicine, Alborz University of Medical Sciences, Karaj, Iran

Jundishapur Journal of Microbiology:Vol. 16, issue 3; e135795
Published online:Jun 11, 2023
Article type:Research Article
Received:Mar 11, 2023
Accepted:May 21, 2023
How to Cite:Ghafari S, Mirnejad R, Sameni F, Dehghan-Tarazjani MH, Khaledi M, et al. Investigating the Presence of Efflux Pump Genes adeI and adeJ in Clinical Antibiotic-Resistant Isolates of Acinetobacter baumannii. Jundishapur J Microbiol. 2023;16(3):e135795. doi: https://doi.org/10.5812/jjm-135795

Abstract

Background:

Acinetobacter baumannii is one of the most important known causes of hospital infections worldwide that is resistant to many common antibiotics. Efflux pumps are among the main reasons behind resistance in this bacterium.

Objectives:

This study was conducted to investigate the presence of efflux pump genes (adeI, adeJ) in clinical antibiotic-resistant isolates of A. baumannii in Tehran hospitals.

Methods:

One hundred fifty clinical samples of wounds, urine, sputum, and blood were collected periodically (6 months) from Tehran hospitals. Acinetobacter baumannii was identified using common biochemical methods. After conducting biochemical tests, the final confirmation of the samples was performed by examining the blaOXA-51-like gene by molecular polymerase chain reaction (PCR) method. The disk diffusion antimicrobial susceptibility testing was performed using Mueller Hinton agar growth medium according to Clinical and Laboratory Standards Institute (CLSI) guidelines on nine antibiotics. Then the samples were investigated for the presence of adeI and adeJ genes.

Results:

Examining the antibiotic resistance of the isolates showed that the resistance level varied from 48.1% to 98.2%, depending on the antibiotic type. In this study, isolates showed the highest and lowest resistance to tetracycline and gentamicin, respectively. Also, positive isolates for the presence of adeI and adeJ genes showed the highest resistance to tetracycline, amikamycin, ceftazidime, and ceftriaxone. Isolates that were negative for the presence of these two genes showed the highest sensitivity to imipenem, gentamicin, and ciprofloxacin.

Conclusions:

In this study, the correlation of antibiotic resistance test and PCR results showed that the presence of adeI and adeJ genes in the samples significantly increased the resistance to all investigated antibiotics. Therefore, evaluating efflux pumps proves to be useful in identifying antibiotic-resistant strains and appropriate drug treatment. Of course, the role of other factors in creating resistance should not be neglected.

1. Background

Acinetobacter baumannii is an opportunistic pathogen and the leading cause of death in the Intensive Care Unit (ICU) (1, 2). This bacterium has developed as a hospital pathogen that can cause infection in different body parts (3). These infections include urinary tract infections, bacteremia, pneumonia, and wound infections. The death rate of this bacterium in vulnerable people could reach 60% (4-7). Acinetobacter baumannii possesses many properties that might lead to drug resistance. The main resistance mechanisms include the production of antimicrobial inactivating enzymes, such as beta-lactamases and amino-glycosidase (8, 9), changing the target position and reducing membrane permeability, biofilm formation, and high expression of efflux pumps, particularly those with resistance nodulation cell division (RND) transporters (8, 10, 11).
Six major families of the efflux system have been identified as causes of drug resistance: Multidrug and toxic compound extrusion (MATE), ATP-binding- cassette (ABC), small multidrug resistance (SMR), major facilitator superfamily (MFS), and drug metabolite transporter (DMT) (12). The RND family has a large distribution in gram-negative bacteria and plays a role in the efflux of antibiotics and chemicals (13). Until now, five types of RND systems have been identified in Acinetobacter species, three of which are more expressed in clinical isolates of A. baumannii, including AdeABC, AdeFGH, and AdeIJK (14-16). The presence of the inner membrane, periplasm, and outer membrane in the structure of RND pumps makes them unique. This feature leads to the direct transfer of the substrate from the cytoplasm to the outside of the cell. As a result, it forces the drug to pass through the outer membrane, which has low permeability (17, 18).
The adeABC efflux pump exists in about 80% of clinical samples, and increasing the expression of this gene leads to resistance to many antibiotics (19). The adeIJK efflux pump consists of three components; adeI is similar to the membrane fusion protein, adeJ is similar to RND proteins, and adeK works like OMF. These three genes are widely distributed in A. baumannii species, and they have been shown to contribute to resistance to several antibiotics (20). The adeIJK creates resistance to beta-lactams, chloramphenicol, tetracycline, erythromycin, fluoroquinolones, fusidic acid, rifampicin, trimethoprim, acridine (dyes), sodium dodecyl sulfate (21). Although the mean expression level of the adeJ is relatively low, as long as the plasmid expresses adeIJk, it can significantly increase the macrophage inhibitory cytokine (MIC) level compared to cloxacillin, oxacillin, nitrotyrosine, and ethidium bromide. Accordingly, it is speculated that the physiological effect of the adeIJK pump may be stronger than that of the adeABC (21, 22). Research shows that due to the high resistance of A. baumannii to many antibiotics, it is very difficult to treat the infections caused by it. One reason is that different resistance mechanisms have been identified in this bacterium. Also, infections caused by efflux pumps in A. baumannii require a complex treatment.

2. Objectives

As a result, due to the high importance of efflux pumps in creating antibiotic resistance in this bacterium and the lack of extensive studies investigating adeIJK efflux pumps, this study was conducted to investigate the presence of adeI and adeJ efflux pump genes in clinical antibiotic-resistant isolates of A. baumannii.

3. Methods

3.1. Sample Collection and Identification of Bacteria

One hundred fifty clinical samples (including wounds, urine, sputum, and blood) were collected from Tehran hospitals between January 2021 and July 2021. After performing biochemical tests (23, 24), the final confirmation of A. baumannii was performed by confirming the presence of a blaOXA-51-like gene by PCR method.

3.2. Antibiotic Susceptibility Test

The antibiotic susceptibility test of the clinical samples of A. baumannii was performed by disk diffusion method (Mast, Germany) on Mueller Hinton agar medium (Merck, Germany) based on the CLSI 2021 (25). The discs contain amikacin (30 mcg), gentamicin (10 mcg), imipenem (10 mcg), meropenem (10 mcg), ceftazidime (30 mcg), ciprofloxacin (5 mcg), trimethoprim/sulfamethoxazole (25 mcg), tetracycline (30 mcg), and ceftriaxone (30 mcg). These discs were obtained from MAST, England. The antibiogram of the standard strain of A. baumannii (ATCC19606) was used to control the results (26).

3.3. DNA Extraction

DNA extraction was performed with a DNA extraction kit (Bioneer Company Korea, Cat. No. K-3032-2-) (24).

3.4. Amplification of Efflux Pump and blaOXA-51-Like Genes

The presence of adeI, adeJ, and blaOXA-51-like genes was checked by molecular PCR method. adeI and adeJ primers (Table 1) were designed by AlleleID6 software. Identification of the bla OXA-51-like gene was performed using the primer from Kaviani et al.’s study (Table 1) (27). The PCR reaction was performed in a total volume of 25 µL, which included DDW (µL11), (Ampliqon3/Master Mix (µL12), Primer (R and F) (µL1), and Template DNA (µL1). Thermal cycling parameters for identification of blaOXA-51-like gene included primary denaturation at 95°C for 5 minutes (1 cycle), denaturation at 95°C for 45 seconds (30 cycles), annealing at 58°C for 60 seconds (30 cycles), extension at 72°C for 60 seconds (30 cycles), and final extension at 72 °C for 5 minutes (1 cycle).
Table 1.Primers Used in This Study
GeneSequence (5’ – 3’)Expected Size (bp)Sources
adeI560This study
FGTAGCAAAGGCTCCGATGAG
RCGTTACCAACGGGTCAGTCT
adeJ479This study
FCATATTTGCGTGGGTGATTG
RCACGGCTAAGCGGTTCTTTA
blaOXA-51-like342(27)
FTAATGCTTTGATCGGCCTTG
RTGGATTGCACTTCATCTTGG

3.5. Statistical Analysis

The data were collected, processed, and then analyzed by SPSS software version 21. Frequency and percentage statistical indicators were used to present descriptive results. Descriptive results were presented as frequency and percentage.

4. Results

Among 150 non-fermenting isolates sent to the laboratory, 60 were identified as A. baumannii based on differential biochemical tests. In addition, the identity of all isolates was confirmed by amplifying the bla OXA-51-like gene by molecular PCR method; in all isolates, the PCR product was 342 base pairs long (Figure 1). In this study, 25 samples from the ICU ward, 17 from the infectious ward, 13 from the emergency ward, and 5 from other wards were separated as A. baumannii. The samples consisted of 25 blood (41.7%), 15 sputum (25%), 12 wounds (20%), and 8 urine samples (13.3%).
Electrophoresis results of the PCR product (342bp <i>blaOXA-51</i>-like). C<sup>+</sup>, positive control sample; row 1 – 4, clinical samples.
Figure 1.

Electrophoresis results of the PCR product (342bp blaOXA-51-like). C+, positive control sample; row 1 – 4, clinical samples.

4.1. Antibiogram Results

The antibiotic resistance level of the isolates was investigated, which varied from 45 to 98.3 depending on the antibiotic type. The isolates were resistant to gentamicin 45%, amikacin 96.7%, imipenem 70%, meropenem 66.7%, ceftazidime 96.6%, ciprofloxacin 56.7%, trimethoprim-sulfamethoxazole 55%, tetracycline 98.3%, and ceftriaxone 83.3% (Table 2).
Table 2.The Percentage of Resistance to Different Antibiotics in Acinetobacter baumannii (N = 60)
AntibioticResistance aIntermediate aSensitive a
Ceftriaxone50 (83.3)1 (1.7)9 (15)
Tetracycline59 (98.3)-1 (1.7)
Trimethoprim/ sulfamethoxazole33 (55)-27 (45)
Ciprofloxaci34 (56.7)-26 (43.3)
Ceftazidim58 (96.6)1 (1.7)1 (1.7)
Meropenem40 (66.7)2 (3.3)18 (30)
Imipenem42 (70)4 (6.7)14 (23.3)
Gentamicin27 (45)-33 (55)
Amikacin58 (96.7)2 (3.3)-

a Values are presented as mean ± SD or No. (%).

4.2. Polymerase Chain Reaction Results

After the above steps, the samples were checked for the presence of adeI and adeJ genes (Figures 2 and 3). The distribution rate of these two genes was 90% in the isolates.
Electrophoresis results of the polymerase chain reaction (PCR) product of <i>adeI</i> gene (560bp). C<sup>+</sup>, positive control sample; row 1 - 8, clinical samples.
Figure 2.

Electrophoresis results of the polymerase chain reaction (PCR) product of adeI gene (560bp). C+, positive control sample; row 1 - 8, clinical samples.

Electrophoresis results of polymerase chain reaction (PCR) product of <i>adeJ</i> gene (479 bp). C<sup>+</sup>, control sample; rows 1 – 10, clinical samples.
Figure 3.

Electrophoresis results of polymerase chain reaction (PCR) product of adeJ gene (479 bp). C+, control sample; rows 1 – 10, clinical samples.

4.3. Correlation of Antibiogram with Polymerase Chain Reaction Results

The correlation between antibiogram and PCR results was investigated in the isolates. The results showed that the distribution of efflux pump genes could be divided into two groups (Table 3). In the first group, 90% of the isolates were positive for the presence of adeI and adeJ genes. These two genes encoded by the adeIJ efflux pump and transcribes simultaneously co-existed in the strains. This group showed high resistance to tetracycline (98.2%), amikamycin (96.3%), ceftazidime (96.3%), and ceftriaxone (88.9%). The resistance of the isolates to other antibiotics was also high (48.1% to 98.2%). In the second group, the isolates were negative for the presence of adeI and adeJ genes. This group showed high sensitivity (50% to 83.3%) to the studied antibiotics. The sensitivity rate to imipenem, gentamicin, and ciprofloxacin was 83.3%.
Table 3.The Correlation of Antibiogram with Polymerase Chain Reaction Results
AntibioticadeIJ+N (54)adeIJ–N (6)
R aI aS aR aI aS a
Ceftriaxone48 (88.9)-6 (11.1)2 (33.3)1 (16.7)3 (50)
Tetracyclin53 (98.2)-1 (1.8)6 (100)--
Trimethoprim-sulfamethoxazole31 (57.40)-23 (42.60)2 (33.3)-4 (66.7)
Ciprofloxacin33 (61.1)-21 (38.9)1 (16.7)-5 (83.3)
Ceftazidime52 (96.3)1 (1.85)1 (1.85)6 (100)-
Meropenem37 (68.5)2 (3.7)15 (27.8)3 (50)-3 (50)
Ampenem41 (75.9)4 (7.4)9 (16.7)1 (16.7)-5 (83.3)
Gentamicin26 (48.1)-28 (51.9)1 (16.7)-5 (83.3)
Amikacin52 (96.3)2 (3.7)-6 (100)--

a Values are presented as mean ± SD or No. (%).

5. Discussion

Acinetobacter species, particularly A. baumannii, has intrinsic and acquired antibacterial resistance. This species also has a high tendency to express antibiotic-resistance genes. It is one of the common causes of hospital infections, particularly in the ICU, so identifying and evaluating the prevalence of these pumps is very important in the treatment of bacterial infections (28). AdeABC and AdeIJK pumps play an important role in creating drug resistance in this bacterium (19). In this study, the presence of pump efflux genes (adeI, adeJ) in clinical strains of antibiotic-resistant A. baumannii was investigated. The findings showed that the isolates had the highest and lowest resistance to tetracycline and gentamicin, respectively. The positive isolates for the presence of adeI and adeJ genes showed the highest resistance to tetracycline, amikacin, ceftazidime, and ceftriaxone. Also, the negative isolates for the presence of adeI and adeJ genes showed the highest resistance to tetracycline and amikacin and the highest sensitivity to imipenem, gentamicin, and ciprofloxacin. These findings were in line with Kor et al.’s study (29) investigating the distribution of adeA, adeI, adeJ, and adeY efflux pump genes and integrons in clinical isolates of A. baumannii. Their results showed that most of the isolates had adeA and adeIJ genes simultaneously, and the isolates containing these two genes showed the highest level of resistance to all antibiotics.
Additionally, the correlation between the antibiotic resistance test and PCR results showed that the presence of adeI and adeJ genes in the samples significantly increased the resistance to all investigated antibiotics (Table 2). In this study, adeI and adeJ genes were transcribed simultaneously and were present in the isolates. These two genes, together with the adek gene, form the adeIJK operon, which was consistent with Damier-Piolle et al. and Marchand et al.’s studies (22, 30). Also, the high resistance in the studied isolates (48.1 - 98.2 %) resulted from the presence of adeI and adeJ genes. In this regard, Choi et al. (31) investigated the role of the adeIJK efflux pump in creating antibiotic resistance in A. baumannii isolates. The results showed that adeJ gene expression played a role in resistance and sensitivity to cefepime, ceftazidime, ciprofloxacin, imipenem, meropenem, and trimethoprim/sulfamethoxazole antibiotics, and the high expression of adeIJK involved in multidrug resistance of A. baumannii isolates. The results also demonstrated that the presence of the adeIJ gene was related to resistance to tetracycline, ceftriaxone, trimethoprim-sulfamethoxazole, ciprofloxacin, and ceftazidime. Similar results have been reported by Damier- Piolle et al. (22).
The majority of the isolates were separated from the ICU, which can be seen as an alarm for global health due to the expansion of resistance mechanisms in A. baumannii strains. In this regard, Shinohara et al. (32) conducted a study on the outbreak of endemic carbapenem-resistant A. baumannii in a coronavirus disease 2019 (COVID-19) specific ICU. Also, Shi et al. (33) investigated multidrug-resistant A. baumannii hospital infections associated with high mortality in the pediatric ICU. These studies show the high presence of A. baumannii in the ICU and the importance of identifying resistance mechanisms in this bacterium in order to choose the appropriate drug to prevent the spread of resistance mechanisms in this bacterium. Nikasa et al. (34), Goudarzi et al. (35), and Ardebili et al. (36) have also conducted similar studies on efflux pump genes and their effects on antibiotic resistance of A. baumannii and suggested the strong involvement of efflux pumps in creating antibiotic resistance of A. baumannii.

5.1. Conclusions

In this study, most A. baumannii isolates were collected from the ICU. Since these isolates showed high antibiotic resistance, it is important to identify the factors that play a role in the development of antibiotic resistance in this bacterium. The high resistance of A. baumannii strains to many antibiotics has made it difficult to treat its resultant infections. Even though efflux pumps play a major role in creating antibiotic resistance, only a few studies investigated adeI and adeJ efflux pump genes. Therefore, this study was conducted to investigate the distribution of the adeIJ efflux pump in clinical isolates of A. baumannii and its role in creating antibiotic resistance. As expected, the results showed the significant effects of adeI and adeJ genes in increasing resistance to different antibiotics in the clinical isolates of A. baumannii.

Acknowledgments

Footnotes

References

  • 1.
    Hamza M, Yaaqoob L. Evaluation the effect of green synthesis titanium dioxide nanoparticles on Acinetobacter baumannii isolates. Iraqi J Agric Sci. 2020;51(6):1486-95. https://doi.org/10.36103/ijas.v51i6.1176.
  • 2.
    Kanafani ZA, Zahreddine N, Tayyar R, Sfeir J, Araj GF, Matar GM, et al. Multi-drug resistant Acinetobacter species: A seven-year experience from a tertiary care center in Lebanon. Antimicrob Resist Infect Control. 2018;7:9. [PubMed ID: 29387343]. [PubMed Central ID: PMC5778738]. https://doi.org/10.1186/s13756-017-0297-6.
  • 3.
    Hajikhani B, Sameni F, Ghazanfari K, Abdolali B, Yazdanparast A, Asarehzadegan Dezfuli A, et al. Prevalence of blaNDM-producing Acinetobacter baumannii strains isolated from clinical samples around the world; a systematic review. Gene Reports. 2023;30. https://doi.org/10.1016/j.genrep.2022.101728.
  • 4.
    Al-Shaabani M, Al-Ethawi A, Al-Mathkhury H. Eco-frienly synthesis of gold nanoparticles and study their effect with antibiotics against Acinetobacter baumannii. Iraqi J Agric Sci. 2020;51(4):1204-11. https://doi.org/10.36103/ijas.v51i4.1099.
  • 5.
    Vasoo S. Susceptibility testing for the polymyxins: Two steps back, three steps forward? J Clin Microbiol. 2017;55(9):2573-82. [PubMed ID: 28724555]. [PubMed Central ID: PMC5648694]. https://doi.org/10.1128/JCM.00888-17.
  • 6.
    Isler B, Doi Y, Bonomo RA, Paterson DL. New treatment options against carbapenem-resistant Acinetobacter baumannii infections. Antimicrob Agents Chemother. 2019;63(1). [PubMed ID: 30323035]. [PubMed Central ID: PMC6325237]. https://doi.org/10.1128/AAC.01110-18.
  • 7.
    Hashemi B, Afkhami H, Khaledi M, Kiani M, Bialvaei AZ, Fathi J, et al. Frequency of Metalo beta Lactamase genes, bla IMP1, INT 1 in Acinetobacter baumanii isolated from burn patients North of Iran. Gene Reports. 2020;21. https://doi.org/10.1016/j.genrep.2020.100800.
  • 8.
    Lee C, Lee JH, Park M, Park KS, Bae IK, Kim YB, et al. Biology of Acinetobacter baumannii: Pathogenesis, antibiotic resistance mechanisms, and prospective treatment options. Front Cell Infect Microbiol. 2017;7. https://doi.org/10.3389/fcimb.2017.00055.
  • 9.
    Khaledi M, Shahini Shams Abadi M, Validi M, Zamanzad B, Vafapour R, Gholipour A. Phenotypic and genotypic detection of metallo-beta-lactamases in A. baumanii isolates obtained from clinical samples in Shahrekord, southwest Iran. BMC Res Notes. 2019;12(1):597. [PubMed ID: 31533853]. [PubMed Central ID: PMC6751628]. https://doi.org/10.1186/s13104-019-4636-y.
  • 10.
    Leus IV, Weeks JW, Bonifay V, Smith L, Richardson S, Zgurskaya HI. Substrate specificities and efflux efficiencies of RND efflux pumps of Acinetobacter baumannii. J Bacteriol. 2018;200(13). [PubMed ID: 29661860]. [PubMed Central ID: PMC5996695]. https://doi.org/10.1128/JB.00049-18.
  • 11.
    Aghili Amjad A, Niakan M, Sameni F, Bakhti S, Khaledi M, Afkhami H, et al. The adeH and adeS efflux pump genes in imipenem and colistin-resistant Acinetobacter baumannii clinical isolates. J Med Microbiol Infect Dis. 2022;10(4):186-91. https://doi.org/10.52547/JoMMID.10.4.186.
  • 12.
    Abdi SN, Ghotaslou R, Ganbarov K, Mobed A, Tanomand A, Yousefi M, et al. Acinetobacter baumannii Efflux Pumps and Antibiotic Resistance. Infect Drug Resist. 2020;13:423-34. [PubMed ID: 32104014]. [PubMed Central ID: PMC7024869]. https://doi.org/10.2147/IDR.S228089.
  • 13.
    Lucassen K, Muller C, Wille J, Xanthopoulou K, Hackel M, Seifert H, et al. Prevalence of RND efflux pump regulator variants associated with tigecycline resistance in carbapenem-resistant Acinetobacter baumannii from a worldwide survey. J Antimicrob Chemother. 2021;76(7):1724-30. [PubMed ID: 33760099]. https://doi.org/10.1093/jac/dkab079.
  • 14.
    Jacobs AC, Thompson MG, Black CC, Kessler JL, Clark LP, McQueary CN, et al. AB5075, a highly virulent isolate of acinetobacter baumannii, as a model strain for the evaluation of pathogenesis and antimicrobial treatments. mBio. 2014;5(3):e01076-14. [PubMed ID: 24865555]. [PubMed Central ID: PMC4045072]. https://doi.org/10.1128/mBio.01076-14.
  • 15.
    Tipton KA, Farokhyfar M, Rather PN. Multiple roles for a novel RND-type efflux system in Acinetobacter baumannii AB5075. Microbiologyopen. 2017;6(2). [PubMed ID: 27762102]. [PubMed Central ID: PMC5387308]. https://doi.org/10.1002/mbo3.418.
  • 16.
    Chin CY, Tipton KA, Farokhyfar M, Burd EM, Weiss DS, Rather PN. A high-frequency phenotypic switch links bacterial virulence and environmental survival in Acinetobacter baumannii. Nat Microbiol. 2018;3(5):563-9. [PubMed ID: 29693659]. [PubMed Central ID: PMC5921939]. https://doi.org/10.1038/s41564-018-0151-5.
  • 17.
    Nikaido H. Structure and mechanism of RND-type multidrug efflux pumps. Adv Enzymol Relat Areas Mol Biol. 2011;77:1-60. [PubMed ID: 21692366]. [PubMed Central ID: PMC3122131]. https://doi.org/10.1002/9780470920541.ch1.
  • 18.
    Zgurskaya HI, Rybenkov VV, Krishnamoorthy G, Leus IV. Trans-envelope multidrug efflux pumps of Gram-negative bacteria and their synergism with the outer membrane barrier. Res Microbiol. 2018;169(7-8):351-6. [PubMed ID: 29454787]. [PubMed Central ID: PMC6095828]. https://doi.org/10.1016/j.resmic.2018.02.002.
  • 19.
    Leus IV, Adamiak J, Trinh AN, Smith RD, Smith L, Richardson S, et al. Inactivation of AdeABC and AdeIJK efflux pumps elicits specific nonoverlapping transcriptional and phenotypic responses in Acinetobacter baumannii. Mol Microbiol. 2020;114(6):1049-65. [PubMed ID: 32858760]. https://doi.org/10.1111/mmi.14594.
  • 20.
    Ardehali SH, Azimi T, Fallah F, Owrang M, Aghamohammadi N, Azimi L. Role of efflux pumps in reduced susceptibility to tigecycline in Acinetobacter baumannii. New Microbes New Infect. 2019;30:100547. [PubMed ID: 31193724]. [PubMed Central ID: PMC6541740]. https://doi.org/10.1016/j.nmni.2019.100547.
  • 21.
    Xu C, Bilya SR, Xu W. adeABC efflux gene in Acinetobacter baumannii. New Microbes New Infect. 2019;30:100549. [PubMed ID: 31193498]. [PubMed Central ID: PMC6535689]. https://doi.org/10.1016/j.nmni.2019.100549.
  • 22.
    Damier-Piolle L, Magnet S, Bremont S, Lambert T, Courvalin P. AdeIJK, a resistance-nodulation-cell division pump effluxing multiple antibiotics in Acinetobacter baumannii. Antimicrob Agents Chemother. 2008;52(2):557-62. [PubMed ID: 18086852]. [PubMed Central ID: PMC2224764]. https://doi.org/10.1128/AAC.00732-07.
  • 23.
    Ranjbar R, Zayeri S, Mirzaie A. Development of multiplex PCR for rapid detection of metallo-beta-lactamase genes in clinical isolates of Acinetobacter baumannii. Iran J Microbiol. 2020;12(2):107-12. [PubMed ID: 32494344]. [PubMed Central ID: PMC7244819].
  • 24.
    Basatian-Tashkan B, Niakan M, Khaledi M, Afkhami H, Sameni F, Bakhti S, et al. Antibiotic resistance assessment of Acinetobacter baumannii isolates from Tehran hospitals due to the presence of efflux pumps encoding genes (adeA and adeS genes) by molecular method. BMC Res Notes. 2020;13(1):543. [PubMed ID: 33213526]. [PubMed Central ID: PMC7678095]. https://doi.org/10.1186/s13104-020-05387-6.
  • 25.
    Kareem IN, Al-Hasnawy HH, Ali JA. Role of some proteins in resistance of clinical Acinetobacter baumannii isolates to imipenem. Int J Health Sci. 2022;6:15118–15127. https://doi.org/10.53730/ijhs.v6nS2.8996.
  • 26.
    Xiong L, Yi F, Yu Q, Huang X, Ao K, Wang Y, et al. Transcriptomic analysis reveals the regulatory role of quorum sensing in the Acinetobacter baumannii ATCC 19606 via RNA-seq. BMC Microbiol. 2022;22(1):198. [PubMed ID: 35971084]. [PubMed Central ID: PMC9380347]. https://doi.org/10.1186/s12866-022-02612-z.
  • 27.
    Kaviani R, Pouladi I, Niakan M, Mirnejad R. Molecular detection of Adefg efflux pump genes and their contribution to antibiotic resistance in Acinetobacter baumannii clinical isolates. Rep Biochem Mol Biol. 2020;8(4):413-8. [PubMed ID: 32582800]. [PubMed Central ID: PMC7275827].
  • 28.
    Preena PG, Swaminathan TR, Kumar VJR, Singh ISB. Antimicrobial resistance in aquaculture: a crisis for concern. Biologia. 2020;75(9):1497-517. https://doi.org/10.2478/s11756-020-00456-4.
  • 29.
    Kor SB, Tou B, Chieng C, Hiew M, Chew CH. Distribution of the multidrug efflux pump genes adeA, adeI, adeJ, adeY and integrons in clinical isolates of Acinetobacter baumannii from Malaysian hospitals. Biomed Res. 2014;25(2):143-8.
  • 30.
    Marchand I, Damier-Piolle L, Courvalin P, Lambert T. Expression of the RND-type efflux pump AdeABC in Acinetobacter baumannii is regulated by the AdeRS two-component system. Antimicrob Agents Chemother. 2004;48(9):3298-304. [PubMed ID: 15328088]. [PubMed Central ID: PMC514774]. https://doi.org/10.1128/AAC.48.9.3298-3304.2004.
  • 31.
    Choi JA, Kim C, Jang S, Cho S, Jang CH, Ko Y, et al. Role of efflux pump gene adeIJK to multidrug resistance in Acinetobacter baumannii clinical isolates. Ann Clin Microbiol. 2020;23(1). https://doi.org/10.5145/acm.2020.23.1.45.
  • 32.
    Shinohara DR, Dos Santos Saalfeld SM, Martinez HV, Altafini DD, Costa BB, Fedrigo NH, et al. Outbreak of endemic carbapenem-resistant Acinetobacter baumannii in a coronavirus disease 2019 (COVID-19)-specific intensive care unit. Infect Control Hosp Epidemiol. 2022;43(6):815-7. [PubMed ID: 33685542]. [PubMed Central ID: PMC7985906]. https://doi.org/10.1017/ice.2021.98.
  • 33.
    Shi J, Sun T, Cui Y, Wang C, Wang F, Zhou Y, et al. Multidrug resistant and extensively drug resistant Acinetobacter baumannii hospital infection associated with high mortality: a retrospective study in the pediatric intensive care unit. BMC Infect Dis. 2020;20(1):597. [PubMed ID: 32787942]. [PubMed Central ID: PMC7422664]. https://doi.org/10.1186/s12879-020-05321-y.
  • 34.
    Nikasa P, Abdi-Ali A, Rahmani-Badi A, Al-Hamad A. In vitro evaluation of proton motive force-dependent efflux pumps among multidrug resistant Acinetobacter baumannii isolated from patients at Tehran hospitals. Jundishapur J Microbiol. 2013;6(7). https://doi.org/10.5812/jjm.6792.
  • 35.
    Goudarzi H, Doraghi M, Dabiri H, Ghalavand Z. Functional analysis of multidrug efflux pumps genes of Acinetobacter baumannii strains. Pejouhesh dar Pezeshki (Research in Medicine). 2013;37(2):107-12. Persian.
  • 36.
    Ardebili A, Talebi M, Azimi L, Rastegar Lari A. Effect of efflux pump inhibitor carbonyl cyanide 3-chlorophenylhydrazone on the minimum inhibitory concentration of ciprofloxacin in Acinetobacter baumannii clinical isolates. Jundishapur J Microbiol. 2014;7(1). e8691. [PubMed ID: 25147654]. [PubMed Central ID: PMC4138672]. https://doi.org/10.5812/jjm.8691.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles