Anthroponotic Cutaneous Leishmaniasis in Torghabeh - Shandiz, a Region with Rural Texture (A Molecular Study)

Author(s):
Bibi Razieh Hoseini FarashBibi Razieh Hoseini Farash1, Masoud MohajeryMasoud Mohajery1, Abdolmajid FataAbdolmajid Fata2,*, Seyed Aliakbar ShamsianSeyed Aliakbar Shamsian1, Abdorahim RezaeeAbdorahim Rezaee3, Mohammad Javad YazdanpanahMohammad Javad Yazdanpanah4
1Department of Parasitology and Mycology, Research Center for Skin Disease and Cutaneous leishmaniasis, School of Medicine, Mashhad University of Medical Sciences, Mashhad, IR Iran
2Department of Parasitology and Mycology, Research Center for Cutaneous, Emam Reza Hospital, School of Medicine, Mashhad University of Medical Sciences, Mashhad, IR Iran
3Department of Immunology, School of Medicine, Mashhad University of Medical Sciences Mashhad, IR Iran
4Department of Dermatology, Cutaneous Leishmaniasis Research Center, Gha’em Hospital, School of Medicine, Mashhad University of Medical Sciences Mashhad, IR Iran

Jundishapur Journal of Microbiology:Vol. 6, issue 10; e8274
Published online:Dec 01, 2013
Article type:Research Article
Received:Oct 09, 2012
Accepted:Mar 09, 2013
How to Cite:Hoseini Farash BR, Mohajery M, Fata A, Shamsian SA, Rezaee A, et al. Anthroponotic Cutaneous Leishmaniasis in Torghabeh - Shandiz, a Region with Rural Texture (A Molecular Study). Jundishapur J Microbiol. 2013;6(10):e8274. doi: https://doi.org/10.5812/jjm.8274

Abstract

Background:

Cutaneous leishmaniasis (CL) is endemic in many parts of Iran including Mashhad, center of Khorasan-Razavi province.

Objectives:

The main aim of our study was to prepare leishmaniasis map of Khorasan. In the present study, the situation of CL in Torghabeh – Shandiz, a district located in southwest of Mashhad, has been investigated by molecular methods.

Patients and Methods:

The study population included 164 people who had at least one skin lesion suspected to CL and referred to the health centers of the district. DNA extraction was performed by scraping the smears and using kit . DNA replication pattern of Leishmania produced bands for L. major / 615 bp and for L. tropica/744 bp using the selected primers.

Results:

Of 164 samples obtained from the skin lesions of the patients referred to the Torghabe - Shandiz health centers, Leishmania DNA was isolated from 136 smears by PCR method. All of the positive samples were recognized to be L. tropica.

Conclusions:

Torghabeh - Shandiz district with a rural texture is endemic for Anthroponotic Cutaneous Leishmaniasis (ACL). Further studies are recommended to discover the vectors and probable reservoirs in these areas.

1. Background

Cutaneous leishmaniasis (CL) is more common compared to the other forms of leishmaniasis. Uncontrolled migrations from rural to urban areas, building constructions, and mass accumulation of garbage, provide suitable environments for sandflies reproduction (1, 2). CL is endemic in many parts of Iran including Mashhad, center of Khorasan-Razavi province (3-5). Torghabeh - Shandiz district is a touristic countryside zone at the west of Mashhad on the mountainside of Beenalood. Because of its natural beauty and bushy gardens, it has always been considered a lovely promenade for nature-lovers. This area is endemic for CL. Formerly, by Immunological and molecular methods such as isoenzyme electrophoresis, ELISA monoclonal antibody and PCR, it was approved that both anthroponotic cutaneous leishmaniasis (ACL) and zoonotic cutaneous leishmaniasis (ZCL) are present in Mashhad, but adequate information about CL in Torghabeh – Shandiz district is not available (1, 5-10).

2. Objectives

The main goal of this study was to complete the leishmaniasis map of Khorasan-Razavi province. In the previous studies, the pattern of CL map has been investigated in several districts of this province e.g. Mashhad, Nishaboor, Sabzevar, Khaf and Taybad (1, 5, 6, 9-13). In the present study, the situation of CL in Torghabeh – Shandiz district has been investigated by molecular methods.

3. Patients and Methods

This study was performed at Mashhad University of Medical Sciences and Jahad Daneshgahi of Mashhad from January to December 2010. Based on the inclusion and exclusion criteria, the study population included 164 people who had at least one skin lesion suspected to CL and referred to the Torghabeh - Shandiz health centers. The number of collected samples in Torghabeh and Shandiz health centers were 65 and 99, respectively. Before sampling, an informed consent form was obtained and a questionnaire was filled out for each individual. We prepared two slide smears from the skin lesion of each patient. Geimsa-stained slides were observed under a light microscope with high magnification (1000X). All positive and negative results for amastigote were recorded. The slides were kept in a box for molecular testing. DNA extraction was performed by scraping the smears and using QIAamp DNA Mini Kit (Qiagene,Germany).
Primers used in this PCR reaction were synthetic oligo-nucleotides with kDNA pattern of Leishmania donovani. The sequences are: F: (5' TCGCAGAACGCCCCTACC' 3') and R: (3' AGGGGTTGGTGTAAAATAGG 5' (Tuba Negin, Iran) (12). DNA replication pattern of Leishmania produced bands for L. major / 615 base pair (bp) and for L.tropica / 744 bp using the abovementioned primers. The test was set up at different annealing temperatures (56, 58, 60 and 62°C) and concentrations of MgCl2 (0.5 to 4 µM). Finally, the sharpest bands were observed at 60°C and 2 µM of MgCl2 for both species. At last, the total volume of reaction was 25 µM of which 5 µM belonged to DNA. In each PCR test, two standard samples of parasites (strain MRHO/IR/75/ER of L. major and strain MHOM/IR/01/yaza of L. tropica) and a negative control sample were used to monitor the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and observed by UV Doc system (Doc-008.XD).

4. Results

Direct examination of 164 samples obtained from the skin lesions of the patients showed 122 positive results for Leishmania, but via PCR, Leishmania DNA was isolated from 136 (82.9%) smears. The number of patients from Torghabeh and Shandiz were 57 and 79, respectively. All of the positive samples were identified to be L. tropica (Figure 1).
Columns: 1, negative control; 2, positive control for <i>L. Tropica</i>; 3, positive control for <i>L. major</i>; 4, 100 bp DNA Ladder; 5 - 8, Patients’ samples.
Figure 1.

Columns: 1, negative control; 2, positive control for L. Tropica; 3, positive control for L. major; 4, 100 bp DNA Ladder; 5 - 8, Patients’ samples.

Among 136 patients approved for CL, 70 (51.5%) were female and 66 (48.5%) were male. Chi-square test indicated a homogenous distribution of infection risk (P = 0.732). The highest rate of CL was observed among the age groups of 1 - 10 and 21 - 30 years respectively. Based on different age groups, Chi-square test showed no homogenous distribution of patients (P < 0.001). Of 136 patients, 59 had only one skin lesion, 22 had two and the rest had three or more. Statistically, no significant difference was observed in both sexes related to the number of skin lesions.

5. Discussion

Cutaneous leishmaniasis (CL) is one of the major health problems and covers a wide area in Iran. Epidemiology of CL has changed in the past two decades in our country. Migration from the neighboring countries such as Afghanistan and Iraq, rural to urban habitations and numerous constructions have provided suitable conditions for the disease transmission (14). Based on the epidemiological studies, Mashhad district has been known as a focus area for ACL for sixty decade (3). Mohajery et al. have reported the existence of ZCL in addition to ACL in this city. Subsequent investigations have confirmed this result (10).
Sabzevar is one of the districts located at the margin of the desert which was previously considered as an endemic focus area for ACL; but a recent study showed the presence of both L. major and L. tropica in this district (12). Since 30 years ago, Torghabeh – Shandiz district with a rural environment has been known as the center of CL, but there were no evidence about Leishmania causative agents. In the present study, we have shown the presence of ACL using molecular techniques in this county for the first time. In this study, of 164 individuals having cutaneous lesions, 136 (82.9%) were positive for ACL, resulted from PCR method. Absence of L. major in these rural areas may be due to the absence of vectors and/or reservoirs of ZCL. The same result was observed in another study in Neishaboor (11).
In this study, DNA extraction of the specimen was performed on the slides, which makes it possible to identify the species in addition to rapid diagnosis of the disease. This method does not require culturing or mass production of promastigotes. Similar result has been obtained by some investigators (15). Moreover, Culture of all positive samples is not always a successful method. .Fata et al. have shown , extraction of Leishmania DNA from samples was preserved on the Whatman paper and direct smears gave a better result in comparison with extraction of DNA from promastigotes obtained from culture (6).
All of the samples were obtained from the positive smears besides 14 (10.3%) negative smear samples were positive for Leishmania using PCR method. It means that among 136 positive samples indicated by PCR, 14 had not been positive by direct smear method, which demonstrates the higher sensitivity of PCR in comparison with direct microscopic examination.These findings have been approved by previous studies in Iran and other countries which implies the fact that PCR on the direct slides for identification of Leishmania species is a rapid method with high sensitivity and specificity (15, 16). In another study which was performed on negative smears obtained from skin CL lesions, the result was significantly similar (17).
The results showed that despite the existence of L. major in the Mashhad district, these touristic countrysides with rural environments have remained as pure focus areas of L. tropica. Furthermore, Giemsa-stained slides are good samples for DNA extraction and there is no need for extra samples which can cause patients' suffering. Moreover, they are easily stored and sent to the molecular laboratories (18). CL is endemic in Torghabeh - Shandiz district. This countryside with a rural texture is an active focus area for ACL. Further studies are recommended to discover the vectors and probable reservoirs in this area. According to this study, PCR is a very rapid and sensitive diagnostic method, hence molecular tests are strongly recommend to be done at least for direct negative slides. It can be effective in acceleration of the healing process.

Acknowledgments

Footnotes

References

  • 1.
    Mohajery M, Hatam GhR, Javaheri A. Isolation of leishmania major by isoenzyme electrophoresis in Mashhad. J Mashhad Univ. Med. Sc. 2005;48(88):177-184.
  • 2.
    Vidyashankar Conjivaram. eMedicine Specialties, Pediatrics: General Medicine, Parasitology. 2006. Available from: http://www.emedicine.com/ped/topic1292.htm#target2.
  • 3.
    Mashhad Univ Med Sci. 1388. Information of Khorasan Razavi province health center.
  • 4.
    Azizi F, Hatami H, Janghorbani M. Epidemiology and control of common diseases in Iran. 2 ed. Tehran: Eshtiagh Publications; 2000.
  • 5.
    Valizadeh M, Dalimi Asl AH, Fata AM, Jaafari MR, Khamesipour A. A study on Leishmania species causing cutaneous leishmaniasis in Mashhad using specific monoclonal antibody. Modarres J Med Sci. 2005;7(2):107-13.
  • 6.
    Fata A, Khamesipour A, Mohajery M, Hosseini-nejad Z, Afzal-aghaee M, Berenji F, et al. Whatman paper (FTA cards) for storing and transferring Leishmania DNA for PCR examination. Iran J Parasitol. 2009;4(4):37-42.
  • 7.
    Hatam GhR, Ardahali S, Motazedian MH, Sajjadi M, Fakoore Ziba M. The method of isolation and characterization of leishmania parasite. Shiraz: Shabok publishers; 1384.
  • 8.
    Klaus S. Epidemiology of cutaneous leishmaniasis. Clin Dermatol. 1999;17(3):257-260. https://doi.org/10.1016/s0738-081x(99)00043-7.
  • 9.
    Mahmoodi Mohammad Reza, Mohajery Masoud, Tavakkol Afshari Jalil, Taghae Shakeri Mohhamad, Yazdan Panah Mohhamad Javad, Berenji Fariba, et al. Molecular identification of Leishmania species causing cutaneous leishmaniasis in Mashhad, Iran. Jundishapur J Microbiol. 2011;3(4):195-200.
  • 10.
    Moahajery M, Hatam GR, Shamsian AA, Javaheri A. [Separation of Leishmania species by isoenzyme Electrophoresis method in Mashhad. Mashhad]. Med. J Mashhad Univ. Med. Sc. 1384;88(3):113-177.
  • 11.
    Mohajery M, Hajaran H, Shamsian AA, Tavakol Afshari J, Sadabadi F. Identification of Leishmania species causing cutaneous Leishmaniasis by RAPD- PCR- in Nishaboor. Mashhad. Med. J Mashhad Univ. Med. Sc. 1387;51(100):79-86.
  • 12.
    Mohjery M, Shamsian AA, Rezaee A, Hasanpoor K, Shakeri T, Farnoosh GH. Evaluation of mulecular epidemiology of cutaneous leishmaniasis in Sabzevar. Med. J Mashhad Univ. Med. Sc. 2010.
  • 13.
    Salehi Gh. Molecular Identification of Leishmania Species in Khaf and Taybad. School of Medicine, Mashhad University of Medical Sciences; 2013.
  • 14.
    Ardahali S, Rezaei H, Nadeem A. Leishmaniasis and leishmania parasite. Tehran: Tehran University Publication. 1984:27-42.
  • 15.
    Motazedian MH, karamian M, Ardahali S, Hanjani F. Evaluation of polymerase chain reaction method in identifying the species of Leishmania parasites in the Archive stained slides with Giemsa. Med Res J. 1383;2(4):1-7.
  • 16.
    Bensoussan E, Nasereddin A, Jonas F, Schnur LF, Jaffe CL. Comparison of PCR Assays for Diagnosis of Cutaneous Leishmaniasis. J Clin Microbiol. 2006;44(4):1435-1439. https://doi.org/10.1128/jcm.44.4.1435-1439.2006.
  • 17.
    Mohaghegh M, Fata A, Salehi G, Berenji F, Bazzaz MM, Rafatpanah H, et al. Molecular identification of leishmania species using samples obtained from negative stained smears. Iran J Parasitol. 2013;8(2):337-41. [PubMed ID: 23914250].
  • 18.
    Kazemi-Rad E, Mohebali M, Hajjaran H, Rezaei SASAN, Mamishi S. Diagnosis and characterization of Leishmania species in Giemsa-stained slides by PCR-RFLP. Iran J Pub Health. 2008;37(1).

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles