Jundishapur J Nat Pharm Prod

Image Credit:Jundishapur J Nat Pharm Prod

Ameliorative Effect of Chitosan-Propolis Nanoparticles on the Estradiol Valerate-Induced Polycystic Ovary Syndrome Model

Author(s):
Seyede Fatemeh HosseiniSeyede Fatemeh HosseiniSeyede Fatemeh Hosseini ORCID1,*, Forouzan KhodaeiForouzan Khodaei2, 3, 4, Zeynab HasansaghaZeynab Hasansagha5, Hamidreza KhosravizadehHamidreza KhosravizadehHamidreza Khosravizadeh ORCID6, Mostafa AbdollahiMostafa Abdollahi6, Ehsaneh AzaryanEhsaneh Azaryan7
1Department of Anatomy, School of Nursing, Birjand University of Medical Sciences, Birjand, Iran
2Food and Supplements Safety Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
3College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu, China
4Department of Pharmacology and Toxicology, School of Pharmacy, Shiraz University of Medical Sciences, Shiraz, Iran
5Department of Cardiology, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran
6Department of Nursing, Tabas School of Nursing, Birjand University of Medical Sciences, Birjand, Iran
7Department of Molecular Medicine, Cellular and Molecular Research Center, Birjand University of Medical Sciences, Birjand, Iran

Jundishapur Journal of Natural Pharmaceutical Products:Vol. 18, issue 4; e137193
Published online:Nov 02, 2023
Article type:Research Article
Received:Apr 29, 2023
Accepted:Sep 20, 2023
How to Cite:Hosseini SF, Khodaei F, Hasansagha Z, Khosravizadeh H, Abdollahi M, et al. Ameliorative Effect of Chitosan-Propolis Nanoparticles on the Estradiol Valerate-Induced Polycystic Ovary Syndrome Model. Jundishapur J Nat Pharm Prod. 2023;18(4):e137193. doi: https://doi.org/10.5812/jjnpp-137193

Abstract

Background:

Polycystic ovary syndrome (PCOS) is an endocrine disorder affecting women. Previous research has shown that PCOS is associated with insulin resistance, oxidative stress, and immune system malfunctions. Also, the antioxidant effects of propolis and the positive effects of chitosan nanoparticles on the reproductive system have been demonstrated in some reports.

Objectives:

The current study is designed to investigate the protective effects of chitosan-propolis nanoparticle against estradiol valerate-induced (EV) PCOS model of rats compared to metformin (Met) (as a control treatment).

Methods:

Intramuscular injection of EV (4 mg/kg, 28 days) was used to induce PCOS in rats, followed by oral administration of 500 mg/kg chitosan-propolis nanoparticle for 42 days. Rats were divided into 4 groups: Control, PCOS, metformin (PCOS and 150 mg/kg metformin), and chitosan-propolis nanoparticles (PCOS and chitosan-propolis nanoparticle administration, 500 mg/kg) groups.

Results:

All animals were subjected to serum factors analysis and histopathological study of ovaries. Estradiol valerate-induced induced PCOS while administration of chitosan-propolis nanoparticle recovered it. The body weight (P < 0.01) and ovarian morphology improved. The serum biochemical parameters, including estrogen (P < 0.05), progesterone (P < 0.001), vitamin D (P < 0.01), calcium (P < 0.01), and insulin resistance index (P < 0.05) were reversed after chitosan-propolis nanoparticle intervention. These EV-induced alterations included inhibited superoxide dismutase (SOD) activity (P < 0.05) and increased malondialdehyde (MDA) level (P < 0.001), and it was demonstrated that chitosan-propolis nanoparticle/Met administered for 42 consecutive days and gavages with EV reversed the oxidative stress factors. Additionally, in EV-treated animals, there was a significant upregulation of certain relative mRNA expressions, such as monocyte chemoattractant protein (MCP) (P < 0.01), interleukin 18 (IL-18) (P < 0.05), and C-reactive protein (CRP) (P < 0.01) genes. These data clearly show that chitosan-propolis nanoparticle/Met may have a protective effect on this inflammatory disorder.

Conclusions:

Taken together, the final results of this study are consistent with the assumption that chitosan-propolis nanoparticle /Met had ameliorative and protective effects against the harmful effects of EV. Although it is hypothesized that ameliorative effects might have been involved, the fundamental pathways remain to be illuminated.

1. Background

Polycystic ovary syndrome (PCOS), which has a prevalence of 5 - 21%, is the most prevalent cause of sterility, irregular menstrual periods, or no periods at all (1). Symptoms of this disease include irregular periods or no periods at all, difficulty getting pregnant (because of irregular ovulation or failure to ovulate), hirsutism or hairiness, increased LH hormone, obesity, increased insulin resistance, formation of multiple cysts in the ovaries, hyperandrogenism, and infertility (2-4). Insulin resistance can lead to type II diabetes (5). Hyperglycemia occurs in PCOS patients because of insufficient pancreatic insulin production or pancreatic beta cell problems (5). According to numerous studies, low vitamin D and calcium levels can also lead to higher oxidative stress and an increased risk of PCOS (6-8). Several studies indicate that oxidative stress caused by hormonal and metabolic problems significantly contributes to the development of the disease (9, 10). According to ovarian histological research, some PCOS patients have ovarian tissues larger than average, increasing the ovary's volume to more than 10 cm (11, 12).
This illness is multifactorial, and no single cause has been identified hitherto. One of the major causes of PCOS is a dysfunction of the hypothalamus-pituitary-ovary axis. In actuality, PCOS is linked to abnormal gonadotropin secretions and elevated steroid synthesis in the ovary (13). The production of androgens in the ovaries rises when LH content is higher than FSH concentration (14, 15). Theca cells in PCOS patients are much more active than normal at converting androgenic precursors to testosterone, according to research conducted in vitro and in vivo (16). In actuality, theca cells create androgens in reaction to luteinizing hormone, and patients' blood levels of androgens rise as a result. Additionally, there is an increase in insulin and insulin-like growth factors (IGFs), which boost androgen synthesis in theca cells and improve LH function (17).
Metabolic abnormalities are caused by various environmental and genetic factors in individuals with PCOS (18). Free radicals, such as reactive nitrogen species (RNS) and reactive oxygen species (ROS), are among the very potent environmental variables (19). The antioxidant defense system is one of the body's defenses against the impacts of ROS, and by lowering ROS levels, it can mitigate some of the harm and complications caused by ROS and oxidative stress (20).
Polycystic ovary syndrome may result from altered ovary steroidogenesis caused by oxidative stress (21). Oxidative stress results from a mismatch between the body's free radicals, such as ROS and RNSs, and the antioxidant system's effectiveness (22, 23). Inflammation may result from an increase in reactive stress brought on by the buildup of free radicals or a decrease in the antioxidant defense system (24). Even though ovulation and fertility are both regarded as inflammatory processes and the ovary naturally expresses certain cytokines or inflammatory factors (25), the reduction of antioxidant factors or the increase of oxidative stress causes the inflammation to increase. The expression level of the factors that promote inflammation, such as interleukin 6 (IL-6), interleukin 18 (IL-18), TNF-α, and C-reactive protein (CRP) in polycystic ovarian tissue are observed compared to healthy tissue (26).
Therapeutic supplements that reduce oxidative stress to treat complications in patients with PCOS are considered effective (27, 28). Propolis is a natural substance that is made by honey bees. Hitherto, its many biological effects, including anti-inflammatory (29), antibacterial (30), antifungal (31), antioxidant, anti-cancer (32), and immune effects (33), have been reported. The basic propolis ingredients responsible for its biological properties include phenols, flavonoids, and aromatic compounds (34). It has recently been discovered that propolis can boost the activity of antioxidant enzymes like glutathione peroxidase, catalase, and superoxide dismutase in animal models of diabetes mellitus (35, 36). One study reported that Iranian propolis can halt oxidative stress and histopathological alterations in the ovaries of newborn stress-exposed rats (37).
Bees make propolis from a variety of plant gums (38). Propolis has been linked to several biological and pharmacological effects, including immune, anti-inflammatory, antibacterial, antifungal, and antioxidant benefits (39, 40). Therefore, this natural substance's antioxidant and anti-inflammatory properties are being extensively researched (41-43). According to research by Rivera-Yanez et al. on an animal model of diabetes mellitus in 2018, propolis can boost the activity of antioxidant enzymes (36). Propolis significantly reduces the oxidative stress that various xenobiotics cause in newborn rats' ovaries (37).

2. Objectives

The current study aims to assess the protective and therapeutic effects of the natural substance propolis on PCOS in animals induced by estradiol valerate. The possible protective mechanisms of this natural substance were examined by analyzing oxidative stress biomarkers and anti-inflammatory functional indices. Also, considering the importance of oxidative stress in the development of PCOS and the necessity of using antioxidant compounds to reduce the complications caused by oxidative stress in women with PCOS, as well as the importance of metabolic disorders related to glucose metabolism and insulin hormone function, in this research, the impacts of the natural substances propolis and chitosan in nanoparticle form on the levels of estrogen, progesterone, vitamin D, calcium, and the insulin resistance index in mouse models of PCOS induced by estradiol valerate are examined.

3. Methods

3.1. Chemicals

Iranian propolis (Chenaran in Khorasan-Razavi Province, Juniperus polycarpos; 36.64908 N) was purchased directly from bee farms (Ahota Company, Mashhad, Iran). Metformin was purchased from Pursina Company (CAS 1691-5G; Tehran, Iran) and chitosan (CAS 448877, 17β-Oestradiol-17-valerat (CAS E1631) from Sigma-Aldrich. Kits for estrogen (CAS 2844-96), progesterone (CAS P-069), and vitamin D (CAS 6744-96) were supplied by Diaplus Company (Seoul, Korea), and the insulin kit (CAS 1391038) was purchased from Mercodia Company (Northern Sweden). All salts used to prepare buffer solutions were obtained from Merck (Merck KGaA, 64271, Darmstadt, Germany). Easy Gluco was used to assess the glucose serum levels.

3.2. Preparation of Propolis Extracts

Propolis was extracted from wax-free bee hives. 50 g of propolis was dissolved in 500 mL of 80% alcohol and shaken for 48 hours at room temperature (44). Then, it was filtered, and the alcohol was rotary evaporated. After weighing the purified extract, a 10% solution in 80% alcohol was made and kept at 4°C. One mg/mL stock solutions were prepared and utilized in subsequent studies.

3.3. Preparation of Chitosan-Propolis Nanoparticles

The ionic gelation technique was modified to create chitosan nanoparticles enclosed in alcohol extract. Chitosan solutions at 0.2 w/v concentrations were made in glacial acetic acid at 0.1% v/v and then filtered. In deionized water, sodium tripolyphosphate solution (TPP) (0.2% w/v) was made. 0.4 ± 1.6 mg/mL of alcohol extract was added to a chitosan solution that contained 0.4% w/v tween 80. The TPP solution was then gradually added while stirring continuously after the mixture had been sonicated for five minutes. Throughout the trial, the chitosan/TPP ratio was held constant at 2:1. The chitosan-propolis conjugated nanoparticles were separated from the obtained supernatant by ultracentrifugation at 25000 rpm for 20 minutes. These particles were then submitted for further characterization (44).

3.4. Physical Quality Control of Chitosan-Propolis Nanoparticles

After preparing the suspensions, the size distributions of the chitosan-propolis nanoparticles were determined using a laser diffraction particle size analyzer (Japan) at room temperature.

3.5. Experimental Protocol

3.5.1. Animals

Mature female Wistar rats (age 10 - 12 weeks and weighing 140 - 160 g) were obtained from Birjand University of Medical Sciences' Comparative and Experimental Medicine Center, Birjand, Iran. Animals had free access to water and food in the cage. They were kept in a controlled environment with regulated light (12:12 h), temperature (23 - 25°C), and relative humidity (40%). The rats were managed according to the animal management procedure approved by the Ethical Committee of Research at Birjand University of Medical Sciences (ethical number: IR.BUMS.REC.1400.163).

3.5.2. Estradiol Valerate Induced-Polycystic Ovarian Syndrome

This research used the hormonal induction method with estradiol valerate (Abu Reyhan Pharmaceuticals, Tehran). The selected animals underwent three consecutive estrus cycles following fifteen days of daily vaginal smear tests (each cycle has four stages: Proestrus, estrus, metestrus, and diaestrus). Throughout the estrus period of the reproductive cycle, 40 mg/kg of estradiol valerate was subcutaneously injected into each animal. To achieve complete syndrome induction, the vaginal smear test was continued after the daily injection until the alteration in the estrous cycle and its abnormality and achieving the phase of persistent vaginal certification and persistent vaginal cornification as the most significant symptoms of the syndrome.

3.5.3. Groups

Animals (six animals per group) were randomly allocated into (1) the control group (30 µL DMSO, gavages); (2) PCOS group (by a single intramuscular injection of estradiol valerate-induced (EV) at a dose of 4 mg/kg/day (dissolved in 0.4 mL of sesame oil) for 28 days); (3) PCOS (4 mg/kg EV BW) + chitosan-propolis nanoparticles (500 mg/kg; 2 times per weeks for 42 consecutive days, gavages); (4) PCOS (4 mg/kg EV) + metformin (150 mg/kg, dissolved in normal saline (NS), daily for 42 consecutive days, gavages). Metformin (45) and EV (46) doses were determined according to previous studies. Duration of metformin and chitosan-propolis nanoparticles treatment were set according to vaginal smear alteration in the estrous cycle and its normality in the metformin group.

3.5.4. Serum Hormone Analysis

All animals were anesthetized with 10 mg/kg of xylazine and 70 mg/kg of ketamine (IP) 48 hours after the final therapeutic dosage of metformin and chitosan-propolis nanoparticles. Serum samples were kept at -70°C for later analysis after blood samples (5 mL) from the right atrium were taken and centrifuged for 5 minutes at 3500 rpm. The animals’ estrogen, progesterone, vitamin D, calcium, and insulin serum levels were measured using an ELISA reader following the manufacturer's recommendations.

3.5.5. Biochemical Assays

After the intervention, blood was drawn from the rats’ tails, and the Easy Gluco device was used to test the blood sugar levels to determine serum glucose levels. The HOMA-IR (homeostasis model evaluation of insulin resistance) index was calculated as (fasting serum glucose × fasting serum insulin/22.5) to measure insulin resistance.

3.5.6. Histological Analysis

After the course of therapy, the tissue of the ovaries was removed and fixed for 24 hours in a buffered formalin solution (0.64% NaH2PO4, 0.4% Na2HPO4, and 10% formaldehyde in distilled water; pH = 7.4). Then, tissue samples were mounted on glass plates, sectioned at a thickness of 5 μm, stained with H&E or Trichrome Masson, and examined under a light microscope (Olympus CX21®, Japan) (23). According to Erickson's categorization, antral follicles, secondary and primary follicles were counted on all slides (24). Only visible nuclei in follicles were counted, and follicular cysts were quantified.

3.5.7. Determination of Superoxide Dismutase

According to the kit's instructions, the commercial rat ELISA kit (Eastbiopharm, China) was used to find superoxide dismutase (SOD) activity in the blood of the control and experimental groups. The superoxide anion was converted to oxygen and hydrogen peroxide at 420 nm, where the SOD activity was determined. Superoxide dismutase activity (inhibition rate) was calculated using the formula below:
SOD activity (inhibition rate %) = (AB1-AB3) - (AS-AB2)/AB1-AB2
A = Absorbance, B = Blank, S = Sample.

3.5.8. Measurement of Malondialdehyde Assay

Using a commercial rat ELISA kit, malondialdehyde (MDA) levels were used to assess the amounts of free radicals (lipid peroxidation) in serum samples. (Eastbiopharm, China). At 535 nm, the LPO content was determined spectrophotometrically.

3.5.9. Quantitative Real‑time PCR Analysis

The ovaries of all animals were removed. An RNA extraction kit (Pars Toos, IRN) was used to obtain total RNA from the samples. The RNA extraction's measurements and purity were confirmed using a NanoDrop spectrophotometer (Epoch Biotech). A cDNA synthesis reagent was used to reverse-transcribe the RNAs (Pars Toos, Iran). Using the Oligo 7 primer tool, particular primers for the monocyte chemoattractant protein (MCP), IL-18, and CRP genes were created (Table 1). For the quantitative RT-PCR study, the SYBR Green PCR Master Mix (Amplicon, Denmark) was used. cDNA was amplified using the ABI Step One Plus real-time PCR apparatus. (Applied Biosystems). To normalize the results on gene expression, GAPDH was used. The 2-ΔΔCt technique was used to determine the expression levels of the target genes.
Table 1.Sequences of Primers Used for Real-time PCR
NameForwardReverse
CRPGCAGTAGGTGGGCCTGAAATCCCGTCAAGCCAAAGCTCTA
MCP1TGCAGTTAATGCCCCACTCAAGTTCTCCAGCCGACTCATTG
IL-18CAGCCAACGAATCCCAGACCAGATAGGGTCACAGCCAGTCC
GAPDHCGAACCTCTCTGCTCCTCCTGTTCGCATGGTGTCTGAGCGATGTGG

Abbreviations: CRP, C-reactive protein; MCP1, monocyte chemoattractant protein 1; IL-18, interleukin 18.

3.6. Statistical Analysis

Graph Pad Prism 6 software (Graph Pad Software Inc., San Diego, CA, USA) was used for the statistical analysis. The threshold for statistical significance was set at a P-value of less than 0.05. Data were presented as the mean ± SEM, and data comparison was performed by the one-way analysis of variance with the Dunnett post-test.

4. Result

4.1. Physical Quality Control of Chitosan-Propolis Nanoparticles

The average size of chitosan-propolis nanoparticles was measured. The findings showed that the chitosan-propolis nanoparticles had an average particle size of approximately 251.18 ± 17.70 mm (V).

4.2. Effects of Chitosan-Propolis Nanoparticles on the Body Weight

All rats in all groups finished the experiment. First, since the rise in body weight is one of the most significant clinical characteristics of PCOS, the body weights of all animals were measured on the first and last days of the experiment. According to our findings, estradiol valerate administration increased the end body weight of the PCOS group compared to the control group (P < 0.01, Table 2). Compared to the PCOS group, rats treated with metformin or chitosan-propolis nanoparticles (500 mg/kg) had lower body weights, but the difference was not statistically significant.
Table 2.The Animals' Body Weight Was Measured Daily for the 42-Day Experiment (42 Days After Estradiol Valerate Injection to Induce Polycystic Ovary Syndrome and Administration of Chitosan-Propolis Nanoparticles or Metformin) a
ControlPCOSMetforminChitosan-Propolis Nanoparticles
Before the experimental period151 ± 9.42149 ± 7.8153 ± 7.5151 ± 14.1
After the experimental period180 ± 5.5207 ± 6.6 b199 ± 5.17200 ± 13.8

Abbreviation: PCOS, polycystic ovary syndrome.

a Values are presented as mean ± SE (n = 6/each group).

b Statistically different from the control rats (P ≤ 0.01).

4.3. Effects of Chitosan-Propolis Nanoparticles on Hormone Levels

The study's findings demonstrated that the PCO group's progesterone serum levels were considerably lower than the control group's (P < 0.001). Additionally, compared to the PCOs group, a notable rise in progesterone serum level was seen in the experimental groups treated with metformin and chitosan-propolis nanoparticles (P < 0.01) (Figure 1, F (2.381, 11.90) = 32.26). However, compared to the control group, the PCO group's serum estrogen level rose significantly (P < 0.05). In contrast, a significant decline and an increase in estrogen levels were observed in the experimental groups treated with metformin and chitosan-propolis nanoparticles, respectively, compared to the control and PCOs groups (P < 0.01) (Figure 1, F (1.762, 8.810)).
Serum progesterone, estradiol, vitamin D, and calcium levels in control, polycystic ovary syndrome (PCOS), metformin, and chitosan-propolis nanoparticle rats after six weeks of the experimental period. Values are presented as mean ± SE (n = 6/each group). * Statistically different from the control rats (P ≤ 0.05), ** statistically different from the control rats (P ≤ 0.01), *** statistically different from the control rats (P ≤ 0.001); # statistically different from the PCOS rats (P ≤ 0.05), ## statistically different from the PCOS rats (P ≤ 0.01), ### statistically different from the PCOS group. Chito-pro nano: Chitosan-propolis nanoparticle; PCOS: Polycystic ovary syndrome.
Figure 1.

Serum progesterone, estradiol, vitamin D, and calcium levels in control, polycystic ovary syndrome (PCOS), metformin, and chitosan-propolis nanoparticle rats after six weeks of the experimental period. Values are presented as mean ± SE (n = 6/each group). * Statistically different from the control rats (P ≤ 0.05), ** statistically different from the control rats (P ≤ 0.01), *** statistically different from the control rats (P ≤ 0.001); # statistically different from the PCOS rats (P ≤ 0.05), ## statistically different from the PCOS rats (P ≤ 0.01), ### statistically different from the PCOS group. Chito-pro nano: Chitosan-propolis nanoparticle; PCOS: Polycystic ovary syndrome.

4.4. Effects of Chitosan-Propolis Nanoparticles on Vitamin D Levels

Compared to the control group, the administration of EV substantially reduced vitamin D serum levels (P < 0.01). The PCOS-induced reduction in vitamin D was exacerbated by the delivery of metformin and chitosan-propolis nanoparticles (P < 0.05 and P < 0.01, respectively) (Figure 1, F (2.578, 12.89)).

4.5. Effects of Chitosan-Propolis Nanoparticles on Calcium Level

According to Figure 1, the administration of EV significantly reduced calcium serum levels compared to the control group (P < 0.01), and the treatment with metformin significantly increased calcium levels after EV administration (P < 0.001). Additionally, compared to the PCOs group, the chitosan-propolis nanoparticle group's calcium serum level was considerably (P < 0.01) higher (F (2.680, 10.72)).

4.6. Effects of Chitosan-Propolis Nanoparticles on the Histology of Ovaries

The ovarian sections taken from the control animals showed a natural structure with follicles at different stages of growth and normal granulosa cell layers. In contrast, numerous follicular cysts were present in PCOS ovaries with degrading granulosa cells in the thin layer of granulosa cells. Compared with control animals, the numbers of primary and antral follicles significantly decreased in the PCOS group. In comparison with the ovaries of the PCOS group, treatment with chitosan-propolis nanoparticles (500 mg/kg) or metformin for 42 days significantly decreased the number of follicular cysts (Figures 2 and 3).
Histopathology of a section in ovarian tissues of adult control (A); polycystic ovary syndrome (PCOS) (B); metformin (C); and chitosan-propolis nanoparticle (D) rats using hematoxylin and eosin staining
Figure 2.

Histopathology of a section in ovarian tissues of adult control (A); polycystic ovary syndrome (PCOS) (B); metformin (C); and chitosan-propolis nanoparticle (D) rats using hematoxylin and eosin staining

Histopathology of a section in ovarian tissues of adult control (A); polycystic ovary syndrome (PCOS) (B); metformin (C); and chitosan-propolis nanoparticle (D) rats using Trichrome Masson staining
Figure 3.

Histopathology of a section in ovarian tissues of adult control (A); polycystic ovary syndrome (PCOS) (B); metformin (C); and chitosan-propolis nanoparticle (D) rats using Trichrome Masson staining

4.7. Effects of Chitosan-Propolis Nanoparticles on Biochemical Markers

In individuals with PCOS, metabolic abnormalities are primarily characterized by insulin resistance and hyperinsulinemia. As anticipated, the fasting insulin levels in PCOS rats were higher than in control rats. Compared to the control rats, insulin levels in PCOS rats were substantially higher (P < 0.01). There was no difference between the metformin and chitosan-propolis nanoparticle groups compared to the control group, and insulin levels decreased in the metformin and chitosan-propolis nanoparticle groups compared to the pcos group (P < 0.01 and P < 0.05) (Figure 4, F (2.475, 12.38)). The administration of EV also considerably raised fasting blood glucose (FBG) levels compared to the control group, as shown in Figure 4 (P < 0.05). Additionally, compared to the control group, metformin and chitosan-propolis nanoparticles significantly reversed the FBG level increase caused by EV (P < 0.001). In addition, administration of metformin and chitosan-propolis nanoparticles to rats with PCOS resulted in a reduction of their FBG levels compared to the PCOS group (P < 0.001) (F (1.823, 9.117)). After six weeks of testing, the HOMA-IR score in control, PCOS, metformin, and chitosan-propolis nanoparticle rats was shown in Figure 4. When compared to the reference group, the administration of EV significantly raised the HOMA-IR index (P < 0.05), and the administration of chitosan-propolis nanoparticles significantly decreased the HOMA-IR index (P < 0.05). Additionally, the HOMA-IR index was substantially (P < 0.01) lower in the metformin (P < 0.001) and chitosan-propolis nanoparticle (P < 0.01) groups compared to the PCOs group (F (2.974, 14.87)).
Serum insulin concentration (mLU/L), FBG (mg/dL), and HOMA-IR levels in control, PCOS, metformin, and chitosan-propolis nanoparticle rats after six weeks of the experimental period. Values are presented as mean ± SE (n = 6/group). * statistically different from the control rats,
** statistically different from the control rats (P ≤ 0.01), *** statistically different from the control rats; # statistically different from the PCOS rats (P ≤ 0.05), ## statistically different from the PCOS rats (P ≤ 0.01), ### statistically different from the PCOS group. Chito-pro nano: Chitosan-propolis nanoparticle; FBG: Fasting blood glucose; PCOS: Polycystic ovary syndrome.
Figure 4.

Serum insulin concentration (mLU/L), FBG (mg/dL), and HOMA-IR levels in control, PCOS, metformin, and chitosan-propolis nanoparticle rats after six weeks of the experimental period. Values are presented as mean ± SE (n = 6/group). * statistically different from the control rats, ** statistically different from the control rats (P ≤ 0.01), *** statistically different from the control rats; # statistically different from the PCOS rats (P ≤ 0.05), ## statistically different from the PCOS rats (P ≤ 0.01), ### statistically different from the PCOS group. Chito-pro nano: Chitosan-propolis nanoparticle; FBG: Fasting blood glucose; PCOS: Polycystic ovary syndrome.

4.8. Effects of Chitosan-Propolis Nanoparticles on SOD

Several enzymes are important in the antioxidant defense system. One of these enzymes, SOD, catalyzes the dismutation of superoxide into hydrogen peroxide, which is subsequently oxidized by catalase or glutathione. As seen in Figure 4, PCOS significantly reduced SOD activity compared to the control group (P < 0.05), but PRO treatment considerably increased SOD activity compared to the PCOS group (P < 0.01) (Figure 5). Between the metformin (Met) therapy groups and the control groups, there was no statistically significant difference (P > 0.05), (F (3, 8) = 8.359).
Percentage inhibition of superoxide dismutase (SOD) and malondialdehyde levels in blood samples of different groups. * P &lt; 0.05, ** P &lt; 0.01, *** P &lt; 0.001 for each group compared to the control group; ## P &lt; 0.01, ### P &lt; 0.001 for each group compared to the polycystic ovary syndrome (PCOS) group.
Figure 5.

Percentage inhibition of superoxide dismutase (SOD) and malondialdehyde levels in blood samples of different groups. * P < 0.05, ** P < 0.01, *** P < 0.001 for each group compared to the control group; ## P < 0.01, ### P < 0.001 for each group compared to the polycystic ovary syndrome (PCOS) group.

4.9. Effects of Chitosan-Propolis Nanoparticles on MDA Levels

Compared to the control groups, a significantly higher amount of MDA was found in the serum of the PCOS groups, as shown in Figure 5 (P < 0.001). Compared to the induced PCOS groups, the levels of MDA were considerably lower in the PCOS + PRO and PCOS + Met groups (P < 0.01 and P < 0.001, respectively) F (3, 8) = 75.99.

4.10. Quantitative Real‑time PCR Analysis

Data from qPCR showed that the CRP, MCP1, and IL-18 genes were all expressed at different levels (Figure 6). The PCOS group significantly outperformed the control group regarding CRP levels (P < 0.01). In contrast, the PRO and met-treated PCOS groups significantly outperformed the PCOS group in terms of CRP levels (P < 0.01 and P < 0.05, respectively), F (1.173, 2.345) = 161.0. The PCOS group's MCP1 gene expression increased (P < 0.05). Monocyte chemoattractant protein 1 gene expression was significantly downregulated in the PCOS + PRO group compared to the PCOS group (P < 0.05) but not significantly different from the control group in the PCOS + Met group (P > 0.05), F (1.359, 2.719) = 36.57. Compared to the control group, in the PCOS group, upregulation of the gene expression for IL-18 was substantially decreased (P < 0.05). Additionally, the PCOS + Met group significantly reduced the expression of this gene in comparison to the PCOS group (P < 0.05), while the PCOS + PRO group's comparison to the control group did not reach statistical significance (P > 0.05); F (3, 8) = 7.024.
Comparison of the gene’s expression levels: C-reactive protein (CRP), monocyte chemoattractant protein 1 (MCP1), and interleukin 18 (IL-18). * P &lt; 0.05, ** P &lt; 0.01 for each group compared to the control group; # P &lt; 0.05, ## P &lt; 0.01 for each group compared to the polycystic ovary syndrome (PCOS) group.
Figure 6.

Comparison of the gene’s expression levels: C-reactive protein (CRP), monocyte chemoattractant protein 1 (MCP1), and interleukin 18 (IL-18). * P < 0.05, ** P < 0.01 for each group compared to the control group; # P < 0.05, ## P < 0.01 for each group compared to the polycystic ovary syndrome (PCOS) group.

5. Discussion

The findings of the current research demonstrated that estradiol valerate treatment changed the histology of the ovarian tissue for 42 consecutive days as the number of primary follicles and antral follicles greatly declined and the number of large fluid-filled cystic follicles increased in the estradiol valerate group. In the estradiol valerate group, progesterone blood levels fell, and estradiol levels rose. Studies utilizing the estradiol valerate PCOS model have demonstrated a correlation between hyperandrogenism and sympathetic ovarian system hyperactivity.
A serious clinical complication that may result in polycystic ovary syndrome or increased estrogen levels is estradiol valerate-induced PCOS (47). Estradiol production is caused by the dominant follicle growing, and high estrogen levels indicate that FSH production discontinues through a negative feedback system. However, a high and sustained estrogen level causes a one-time LH surge, resulting in ovulation (48). Elevated androgen levels may cause follicle disintegration by accelerating the destruction of oocytes and pyknotic granulosa cells. Similar outcomes were observed in the present study's rats when PCOS was induced using estradiol valerate. Infertility has been linked to PCOS' abnormal ovarian tissue shape, function, and steroidogenesis regulation (49). Patients with PCOS have a severe rise in estradiol, insulin resistance, and glucose intolerance, all associated with ovarian tissue damage (50).
Our results also demonstrated the number of cysts in the estradiol valerate group by the HE stain method. Histopathology of ovarian tissue in people with PCOS has demonstrated that numerous cysts are formed in the central area of the ovary (47). In our study, when metformin or chitosan-propolis nanoparticles were administered to PCOS rats, the number of cystic ovaries decreased compared to the PCOS group.
Propolis nutritional supplements can be a therapy for women with polycystic ovaries by influencing the body's inflammatory index, testosterone, and metabolic rate. As demonstrated by Tatli Seven et al., propolis and nano-propolis (NP) administration can reduce oxidative stress by increasing GSH, CAT, and GPx activities (51) and has a function in PCOS. People have long used propolis as a remedy for different illnesses (52), and due to its numerous therapeutic effects, it is now extensively used in the food and pharmaceutical industries (52). The propolis nanoparticle's shape may contribute to the intensity of these effects. Additionally, chitosan alone has therapeutic benefits for several illnesses, and when combined with propolis, it can potentially reverse the negative impacts of estradiol valerate in PCOS.
Our findings demonstrated that estradiol valerate treatment for 42 days substantially raised the serum levels of estradiol in PCOS animals, and progesterone levels decreased. Additionally, administering metformin or chitosan-propolis substantially reversed the impairment induced by estradiol valerate. The effects of chitosan-propolis nanoparticles on hormones and insulin resistance index seem to be the fundamental mechanisms for these nanoparticle effects in the current model. This may be due to propolis reducing oxidative stress and improving bio-distribution when combined with chitosan nanoparticles.
According to research by Taghvaee Javanshir et al., rats can develop PCOS when given estradiol valerate for 25 days. It can cause morphological changes, anovulation, metabolic problems, hormonal changes, and follicular cysts in the ovaries (47). Polycystic ovary syndrome is often associated with being overweight, which increases the risk of other PCOS disorders. It has been established that elevated estradiol can contribute to obesity in PCOS patients with this condition. These findings support earlier findings published by Stener-Victorin et al. (53) and Taghvaee Javanshir et al. (47). According to these studies, estradiol valerate increases lipid metabolism, which results in body weight reduction. Additionally, PCOS increases sympathetic system function, which may also affect weight (47). However, not all PCOS sufferers exhibit obesity-related symptoms (54). Metformin administration and chitosan-propolis nanoparticles reduced body weight, but these variations were not statistically significant.
The lack of regulation of calcium (55) and vitamin D (56) serum levels can also play a role in PCOS, and this study demonstrated that the reduction of calcium and vitamin D serum levels plays a role in the antioxidant imbalance (55). In our study, in the estradiol valerate group, a significant decrease in the level of these two markers was observed, and the treatment with metformin and chitosan-propolis nanoparticles balanced their serum levels, which may be attributed to the antioxidant role and the activation of antioxidant enzyme pathways, including glutathione and superoxide dismutase.
Stress can alter the levels of hormones and corticosterone, which play a significant role in accelerating follicular atresia (37). Estradiol valerate increased the oxidative stress factor of the ovary, with the combined impact greater than the individual exposure. Malondialdehyde levels rose in the ovarian tissue of PCOS animal models, according to Tahmasebi et al. still, there was no discernible difference between the normal and PCOS groups regarding the ovarian tissue's overall antioxidant capacity (57). In experimental animals exposed to estradiol valerate, Kokabiyan et al. (58) found that the levels of MDA, AST, ALT, and ALP significantly rose. In contrast, the levels of SOD in liver tissue and serum decreased.
Inflammatory markers such as CRP, MCP1, and IL-18 regulate ovary functions, and upregulation or downregulation of these factors can lead to PCOS. Interleukin 18, one of the most important cytokines in cell proliferation, has a key role in interferon-gamma (IFN-γ) secretion and splenocyte proliferation. In addition, serum IL-18 levels appear to be closely linked to total testosterone levels and have emerged as a significant predictor of insulin resistance. C-reactive protein is a low-grade chronic inflammatory factor the liver generates in response to interleukin-6 stimulation. On the other hand, CRP was elevated not only compared to age and BMI (59, 60) but also similar between PCOS and control groups (61, 62). According to Wu et al., women with PCOS had substantially higher CRP levels (63). Monocyte chemoattractant protein 1, a chemokine that attracts monocytes to inflammatory sites, is another inflammatory factor closely linked to PCOS. In some research, elevated MCP1 mRNA expression has been seen in THP-1 human mononuclear macrophages, which suggests that inflammatory factors are present in PCOS patients' serum (64). As a result, other investigations have found, according to a meta-analysis study, that PCOS patients have substantially higher levels of MCP1, which are unrelated to people's BMI (65). In this research, CRP, MCP1, and IL-18 gene expression were significantly higher in the estradiol valerate group compared to the control group, indicating inflammation in mice with PCOS.
In this research, propolis-treated animals simultaneously showed decreased MDA levels, CRP, MCP1, and IL-18 gene expression, and increased SOD activity. Arabameri et al. (37) have demonstrated that Iranian propolis can reduce abnormal ovaries in newborn rats and the psychological stress caused by the separation of the mother and her offspring.
In the current research, we measured the MDA level and SOD activity using estradiol valerate alone and its co-administration with metformin or chitosan-propolis nanoparticles. According to the findings, it modulated inflammatory factors. According to other researchers, the chitosan nanoparticles mentioned in the paper help reduce toxicity (66). The use of nanoparticles in conjunction with natural products for the "green chemistry" of nanoparticle creation is appreciated today in nanotechnology, nanomedicine, and nano-based drug delivery systems. Consequently, utilizing green nanoparticles for drug transport can lessen adverse drug effects. The bioactivity of these nanomaterials can also be improved by modifying the nanostructures' size, form, hydrophobicity, and surface. Because of its ease of manipulation (67), quick solubility effects (68), biocompatibility (69), and low toxicity (70) without side effects, chitosan has been promising in the synthesis of nanoparticles. Chitosan nanoparticles are considered when creating novel drug delivery methods because they improve biodistribution and lower drug toxicity (66). Chitosan aids in the transport of drugs by enhancing absorption. On the other hand, chitosan, in conjunction with other compounds, including sodium tripolyphosphate (in nanoparticle form) (66) and fennel seed extract (71), plays a significant role in improving polycystic symptoms, including ovulatory activity. Considering that chitosan contributes to the treatment by improving drug delivery mechanisms, Tatli Seven and coworkers demonstrated that administering propolis and NP can reduce oxidative stress through increased GSH, CAT, and GPx activities (51) and also plays a role in PCOS. Propolis has been used for medicinal purposes for a significant period (52). Due to its numerous therapeutic effects, it is now extensively used in the food and pharmaceutical industries (52). The propolis nanoparticle's shape may contribute to the intensity of these effects. Additionally, chitosan alone has therapeutic benefits for several illnesses, and when combined with propolis, it can potentially reverse the negative impacts of estradiol valerate in PCOS.

5.1. Conclusions

The data from the present study suggest that chitosan-propolis nanoparticles have antidiabetic effects in PCOS animals. The defensive abilities of this nanoparticle appear to be significantly influenced by the control of insulin and the reduction of hormonal levels in the ovarian tissue. We can gain a better understanding of this nanoparticle's effects on PCOS and diabetes by examining its impact on key targets such as vitamin D, serum calcium, oxidative stress, and inflammation factors. As a result, PCOS patients may benefit from using chitosan-propolis nanoparticles as a preventative measure and an additional therapy.

Acknowledgments

Footnotes

References

  • 1.
    Rashidi B, Haghollahi F, Shariat M, Zayerii F. The effects of calcium-vitamin D and metformin on polycystic ovary syndrome: a pilot study. Taiwan J Obstet Gynecol. 2009;48(2):142-7. [PubMed ID: 19574176]. https://doi.org/10.1016/S1028-4559(09)60275-8.
  • 2.
    Boyle J, Teede HJ. Polycystic ovary syndrome: an update. Aust Fam Physician. 2012;41(10):752-6.
  • 3.
    Karjula S, Morin-Papunen L, Auvinen J, Ruokonen A, Puukka K, Franks S, et al. Psychological Distress Is More Prevalent in Fertile Age and Premenopausal Women With PCOS Symptoms: 15-Year Follow-Up. J Clin Endocrinol Metab. 2017;102(6):1861-9. [PubMed ID: 28323926]. [PubMed Central ID: PMC5470769]. https://doi.org/10.1210/jc.2016-3863.
  • 4.
    Kim J, Mersereau JE, Khankari N, Bradshaw PT, McCullough LE, Cleveland R, et al. Polycystic ovarian syndrome (PCOS), related symptoms/sequelae, and breast cancer risk in a population-based case-control study. Cancer Causes Control. 2016;27(3):403-14. [PubMed ID: 26797454]. [PubMed Central ID: PMC4981498]. https://doi.org/10.1007/s10552-016-0716-7.
  • 5.
    Ovalle F, Azziz R. Insulin resistance, polycystic ovary syndrome, and type 2 diabetes mellitus. Fertil Steril. 2002;77(6):1095-105. [PubMed ID: 12057712]. https://doi.org/10.1016/s0015-0282(02)03111-4.
  • 6.
    Zhao JF, Li BX, Zhang Q. Vitamin D improves levels of hormonal, oxidative stress and inflammatory parameters in polycystic ovary syndrome: a meta-analysis study. Ann Palliat Med. 2021;10(1):169-83. [PubMed ID: 33545754]. https://doi.org/10.21037/apm-20-2201.
  • 7.
    Nasri K, Akrami S, Rahimi M, Taghizadeh M, Behfar M, Mazandaranian MR, et al. The effects of vitamin D and evening primrose oil co-supplementation on lipid profiles and biomarkers of oxidative stress in vitamin D-deficient women with polycystic ovary syndrome: A randomized, double-blind, placebo-controlled trial. Endocr Res. 2018;43(1):1-10. [PubMed ID: 28742409]. https://doi.org/10.1080/07435800.2017.1346661.
  • 8.
    Jamilian M, Mirhosseini N, Eslahi M, Bahmani F, Shokrpour M, Chamani M, et al. The effects of magnesium-zinc-calcium-vitamin D co-supplementation on biomarkers of inflammation, oxidative stress and pregnancy outcomes in gestational diabetes. BMC Pregnancy Childbirth. 2019;19(1):107. [PubMed ID: 30922259]. [PubMed Central ID: PMC6440090]. https://doi.org/10.1186/s12884-019-2258-y.
  • 9.
    Tefagh G, Payab M, Qorbani M, Sharifi F, Sharifi Y, Ebrahimnegad Shirvani MS, et al. Effect of vitamin E supplementation on cardiometabolic risk factors, inflammatory and oxidative markers and hormonal functions in PCOS (polycystic ovary syndrome): a systematic review and meta-analysis. Sci Rep. 2022;12(1):5770. [PubMed ID: 35388031]. [PubMed Central ID: PMC8985066]. https://doi.org/10.1038/s41598-022-09082-3.
  • 10.
    Gong Y, Luo S, Fan P, Jin S, Zhu H, Deng T, et al. Growth hormone alleviates oxidative stress and improves oocyte quality in Chinese women with polycystic ovary syndrome: a randomized controlled trial. Sci Rep. 2020;10(1):18769. [PubMed ID: 33127971]. [PubMed Central ID: PMC7599233]. https://doi.org/10.1038/s41598-020-75107-4.
  • 11.
    Bannigida DM, Nayak BS, Vijayaraghavan R. Insulin resistance and oxidative marker in women with PCOS. Arch Physiol Biochem. 2020;126(2):183-6. [PubMed ID: 30450993]. https://doi.org/10.1080/13813455.2018.1499120.
  • 12.
    Khashchenko E, Vysokikh M, Uvarova E, Krechetova L, Vtorushina V, Ivanets T, et al. Activation of Systemic Inflammation and Oxidative Stress in Adolescent Girls with Polycystic Ovary Syndrome in Combination with Metabolic Disorders and Excessive Body Weight. J Clin Med. 2020;9(5):1399. [PubMed ID: 32397375]. [PubMed Central ID: PMC7291245]. https://doi.org/10.3390/jcm9051399.
  • 13.
    Liao B, Qiao J, Pang Y. Central Regulation of PCOS: Abnormal Neuronal-Reproductive-Metabolic Circuits in PCOS Pathophysiology. Front Endocrinol (Lausanne). 2021;12:667422. [PubMed ID: 34122341]. [PubMed Central ID: PMC8194358]. https://doi.org/10.3389/fendo.2021.667422.
  • 14.
    Okigbo CC, Gill S, Hall JE. The Hypothalamic-Pituitary Axis in PCOS. In: Pal L, Seifer DB, editors. Polycystic Ovary Syndrome. Cham: Springer; 2022. p. 73-93. https://doi.org/10.1007/978-3-030-92589-5_5.
  • 15.
    Gharanjik F, Shojaeifard MB, Karbalaei N, Nemati M. The Effect of Hydroalcoholic Calendula Officinalis Extract on Androgen-Induced Polycystic Ovary Syndrome Model in Female Rat. Biomed Res Int. 2022;2022:7402598. [PubMed ID: 35845946]. [PubMed Central ID: PMC9283045]. https://doi.org/10.1155/2022/7402598.
  • 16.
    Yesiladali M, Yazici MGK, Attar E, Kelestimur F. Differentiating Polycystic Ovary Syndrome from Adrenal Disorders. Diagnostics (Basel). 2022;12(9):2045. [PubMed ID: 36140452]. [PubMed Central ID: PMC9498167]. https://doi.org/10.3390/diagnostics12092045.
  • 17.
    Afradiasbagharani P, Hosseini E, Allahveisi A, Bazrafkan M. The insulin-like growth factor and its players: their functions, significance, and consequences in all aspects of ovarian physiology. Middle East Fertil Soc J. 2022;27(1):27. https://doi.org/10.1186/s43043-022-00119-1.
  • 18.
    Franks S, McCarthy MI, Hardy K. Development of polycystic ovary syndrome: involvement of genetic and environmental factors. Int J Androl. 2006;29(1):278-85. discussion 286-90. [PubMed ID: 16390494]. https://doi.org/10.1111/j.1365-2605.2005.00623.x.
  • 19.
    Papalou O, Victor VM, Diamanti-Kandarakis E. Oxidative Stress in Polycystic Ovary Syndrome. Curr Pharm Des. 2016;22(18):2709-22. [PubMed ID: 26881435]. https://doi.org/10.2174/1381612822666160216151852.
  • 20.
    Yeon Lee J, Baw CK, Gupta S, Aziz N, Agarwal A. Role of Oxidative Stress in Polycystic Ovary Syndrome. Curr Womens Health Rev. 2010;6(2):96-107. https://doi.org/10.2174/157340410791321336.
  • 21.
    Morgante G, Darino I, Spano A, Luisi S, Luddi A, Piomboni P, et al. PCOS Physiopathology and Vitamin D Deficiency: Biological Insights and Perspectives for Treatment. J Clin Med. 2022;11(15):4509. [PubMed ID: 35956124]. [PubMed Central ID: PMC9369478]. https://doi.org/10.3390/jcm11154509.
  • 22.
    Khodaei F, Khoshnoud MJ, Heidaryfar S, Heidari R, Karimpour Baseri MH, Azarpira N, et al. The effect of ellagic acid on spinal cord and sciatica function in a mice model of multiple sclerosis. J Biochem Mol Toxicol. 2020;34(11):e22564. [PubMed ID: 32640490]. https://doi.org/10.1002/jbt.22564.
  • 23.
    Khodaei F, Kholghipour H, Hosseinzadeh M, Rashedinia M. Effect of sodium benzoate on liver and kidney lipid peroxidation and antioxidant enzymes in mice. J Rep Pharm Sci. 2019;8(2):217-23. https://doi.org/10.4103/jrptps.JRPTPS_68_18.
  • 24.
    Khodaei F, Rashedinia M, Heidari R, Rezaei M, Khoshnoud MJ. Ellagic acid improves muscle dysfunction in cuprizone-induced demyelinated mice via mitochondrial Sirt3 regulation. Life Sci. 2019;237:116954. [PubMed ID: 31610192]. https://doi.org/10.1016/j.lfs.2019.116954.
  • 25.
    Rostamtabar M, Esmaeilzadeh S, Tourani M, Rahmani A, Baee M, Shirafkan F, et al. Pathophysiological roles of chronic low-grade inflammation mediators in polycystic ovary syndrome. J Cell Physiol. 2021;236(2):824-38. [PubMed ID: 32617971]. https://doi.org/10.1002/jcp.29912.
  • 26.
    Yang Y, Qiao J, Li R, Li MZ. Is interleukin-18 associated with polycystic ovary syndrome? Reprod Biol Endocrinol. 2011;9:7. [PubMed ID: 21244650]. [PubMed Central ID: PMC3035581]. https://doi.org/10.1186/1477-7827-9-7.
  • 27.
    Macut D, Bjekic-Macut J, Savic-Radojevic A. Dyslipidemia and oxidative stress in PCOS. Front Horm Res. 2013;40:51-63. [PubMed ID: 24002405]. https://doi.org/10.1159/000341683.
  • 28.
    Dubey P, Reddy S, Boyd S, Bracamontes C, Sanchez S, Chattopadhyay M, et al. Effect of Nutritional Supplementation on Oxidative Stress and Hormonal and Lipid Profiles in PCOS-Affected Females. Nutrients. 2021;13(9):2938. [PubMed ID: 34578816]. [PubMed Central ID: PMC8467908]. https://doi.org/10.3390/nu13092938.
  • 29.
    Khayyal MT, el-Ghazaly MA, el-Khatib AS. Mechanisms involved in the antiinflammatory effect of propolis extract. Drugs Exp Clin Res. 1993;19(5):197-203. [PubMed ID: 7513636].
  • 30.
    Sforcin JM, Fernandes Jr A, Lopes CA, Bankova V, Funari SR. Seasonal effect on Brazilian propolis antibacterial activity. J Ethnopharmacol. 2000;73(1-2):243-9. [PubMed ID: 11025162]. https://doi.org/10.1016/s0378-8741(00)00320-2.
  • 31.
    Shruthi E, Suma BS. Health from the Hive: Potential Uses of Propolis in General Health. Int J Clin Med. 2012;3(3):159-62. https://doi.org/10.4236/ijcm.2012.33033.
  • 32.
    Ahangari Z, Naseri M, Vatandoost F. Propolis: Chemical Composition and Its Applications in Endodontics. Iran Endod J. 2018;13(3):285-92. [PubMed ID: 30083195]. [PubMed Central ID: PMC6064031]. https://doi.org/10.22037/iej.v13i3.20994.
  • 33.
    Alp H. Effects of propolis on immune system. Anatolia Aegean Agricultural Research Institute Journal. 2018;28(2):99-104.
  • 34.
    Lotfy Khalil M. Biological activity of bee propolis in health and disease. Asian Pac J Cancer Prev. 2006;7(1):22-31. [PubMed ID: 16629510].
  • 35.
    Kitamura H. Effects of Propolis Extract and Propolis-Derived Compounds on Obesity and Diabetes: Knowledge from Cellular and Animal Models. Molecules. 2019;24(23):4394. [PubMed ID: 31805752]. [PubMed Central ID: PMC6930477]. https://doi.org/10.3390/molecules24234394.
  • 36.
    Rivera-Yanez N, Rodriguez-Canales M, Nieto-Yanez O, Jimenez-Estrada M, Ibarra-Barajas M, Canales-Martinez MM, et al. Hypoglycaemic and Antioxidant Effects of Propolis of Chihuahua in a Model of Experimental Diabetes. Evid Based Complement Alternat Med. 2018;2018:4360356. [PubMed ID: 29713363]. [PubMed Central ID: PMC5866899]. https://doi.org/10.1155/2018/4360356.
  • 37.
    Arabameri A, Sameni H, Bandegi A. The effects of propolis extract on ovarian tissue and oxidative stress in rats with maternal separation stress. Int J Reprod Biomed. 2017;15(8):509-20. [PubMed ID: 29082370]. [PubMed Central ID: PMC5653913].
  • 38.
    Keskin M. Chemical characterization of Arabic gum- chitosan-propolis beads and determination of α-amylase inhibition effect. Prog Nutr. 2020;22(2):562-7. https://doi.org/10.23751/pn.v22i2.9136.
  • 39.
    El-Seedi HR, Eid N, Abd El-Wahed AA, Rateb ME, Afifi HS, Algethami AF, et al. Honey Bee Products: Preclinical and Clinical Studies of Their Anti-inflammatory and Immunomodulatory Properties. Front Nutr. 2021;8:761267. [PubMed ID: 35047540]. [PubMed Central ID: PMC8762236]. https://doi.org/10.3389/fnut.2021.761267.
  • 40.
    Kurek-Gorecka A, Gorecki M, Rzepecka-Stojko A, Balwierz R, Stojko J. Bee Products in Dermatology and Skin Care. Molecules. 2020;25(3):556. [PubMed ID: 32012913]. [PubMed Central ID: PMC7036894]. https://doi.org/10.3390/molecules25030556.
  • 41.
    Guzelmeric E, Yuksel PI, Yaman BK, Sipahi H, Celik C, Kirmizibekmez H, et al. Comparison of antioxidant and anti-inflammatory activity profiles of various chemically characterized Turkish propolis sub-types: Which propolis type is a promising source for pharmaceutical product development? J Pharm Biomed Anal. 2021;203:114196. [PubMed ID: 34119836]. https://doi.org/10.1016/j.jpba.2021.114196.
  • 42.
    Conte FL, Pereira AC, Brites G, Ferreira I, Silva AC, Sebastião AI, et al. Exploring the antioxidant, anti-inflammatory and antiallergic potential of Brazilian propolis in monocytes. Phytomed Plus. 2022;2(2):100231. https://doi.org/10.1016/j.phyplu.2022.100231.
  • 43.
    Braakhuis A. Evidence on the Health Benefits of Supplemental Propolis. Nutrients. 2019;11(11):2705. [PubMed ID: 31717277]. [PubMed Central ID: PMC6893770]. https://doi.org/10.3390/nu11112705.
  • 44.
    Ong TH, Chitra E, Ramamurthy S, Siddalingam RP, Yuen KH, Ambu SP, et al. Chitosan-propolis nanoparticle formulation demonstrates anti-bacterial activity against Enterococcus faecalis biofilms. PLoS One. 2017;12(3):e0174888. [PubMed ID: 28362873]. [PubMed Central ID: PMC5376299]. https://doi.org/10.1371/journal.pone.0174888.
  • 45.
    Mahamed RR, Maganhin CC, Sasso GRS, de Jesus Simoes M, Baracat MCP, Baracat EC, et al. Metformin improves ovarian follicle dynamics by reducing theca cell proliferation and CYP-17 expression in an androgenized rat model. J Ovarian Res. 2018;11(1):18. [PubMed ID: 29490689]. [PubMed Central ID: PMC5831207]. https://doi.org/10.1186/s13048-018-0392-1.
  • 46.
    Farhadi-Azar M, Ghahremani M, Mahboobifard F, Noroozzadeh M, Yaghmaei P, Tehrani FR. Effects of Rosa damascena on reproductive improvement, metabolic parameters, liver function and insulin-like growth factor-1 gene expression in estradiol valerate induced polycystic ovarian syndrome in Wistar rats. Biomed J. 2023;46(3):100538. [PubMed ID: 35605922]. [PubMed Central ID: PMC10209690]. https://doi.org/10.1016/j.bj.2022.05.003.
  • 47.
    Taghvaee Javanshir S, Yaghmaei P, Hajebrahimi Z. Thymoquinone ameliorates some endocrine parameters and histological alteration in a rat model of polycystic ovary syndrome. Int J Reprod Biomed. 2018;16(4):275-84. [PubMed ID: 29942936]. [PubMed Central ID: PMC6004595]. https://doi.org/10.29252/ijrm.16.4.275.
  • 48.
    Gomez-Leon VE, Beard AD, Ginther OJ, Wiltbank MC. Effect of elevating luteinizing hormone action using low doses of human chorionic gonadotropin on double ovulation, follicle dynamics, and circulating follicle-stimulating hormone in lactating dairy cows. J Dairy Sci. 2022;105(8):7023-35. [PubMed ID: 35787327]. https://doi.org/10.3168/jds.2021-21767.
  • 49.
    Song L, Yu J, Zhang D, Li X, Chen L, Cai Z, et al. Androgen Excess Induced Mitochondrial Abnormality in Ovarian Granulosa Cells in a Rat Model of Polycystic Ovary Syndrome. Front Endocrinol (Lausanne). 2022;13:789008. [PubMed ID: 35370945]. [PubMed Central ID: PMC8967935]. https://doi.org/10.3389/fendo.2022.789008.
  • 50.
    Rojas J, Chavez M, Olivar L, Rojas M, Morillo J, Mejias J, et al. Polycystic ovary syndrome, insulin resistance, and obesity: navigating the pathophysiologic labyrinth. Int J Reprod Med. 2014;2014:719050. [PubMed ID: 25763405]. [PubMed Central ID: PMC4334071]. https://doi.org/10.1155/2014/719050.
  • 51.
    Tatli Seven P, Seven I, Karakus S, Iflazoglu Mutlu S, Ozer Kaya S, Arkali G, et al. The in-vivo assessment of Turkish propolis and its nano form on testicular damage induced by cisplatin. J Integr Med. 2021;19(5):451-9. [PubMed ID: 34417154]. https://doi.org/10.1016/j.joim.2021.08.002.
  • 52.
    Bhargava P, Mahanta D, Kaul A, Ishida Y, Terao K, Wadhwa R, et al. Experimental Evidence for Therapeutic Potentials of Propolis. Nutrients. 2021;13(8):2528. [PubMed ID: 34444688]. [PubMed Central ID: PMC8397973]. https://doi.org/10.3390/nu13082528.
  • 53.
    Stener-Victorin E, Ploj K, Larsson BM, Holmang A. Rats with steroid-induced polycystic ovaries develop hypertension and increased sympathetic nervous system activity. Reprod Biol Endocrinol. 2005;3:44. [PubMed ID: 16146570]. [PubMed Central ID: PMC1236959]. https://doi.org/10.1186/1477-7827-3-44.
  • 54.
    Barber TM, McCarthy MI, Wass JA, Franks S. Obesity and polycystic ovary syndrome. Clin Endocrinol (Oxf). 2006;65(2):137-45. [PubMed ID: 16886951]. https://doi.org/10.1111/j.1365-2265.2006.02587.x.
  • 55.
    Tehrani HG, Mostajeran F, Shahsavari S. The effect of calcium and vitamin D supplementation on menstrual cycle, body mass index and hyperandrogenism state of women with poly cystic ovarian syndrome. J Res Med Sci. 2014;19(9):875-80. [PubMed ID: 25535503]. [PubMed Central ID: PMC4268197].
  • 56.
    Lin MW, Wu MH. The role of vitamin D in polycystic ovary syndrome. Indian J Med Res. 2015;142(3):238-40. [PubMed ID: 26458338]. [PubMed Central ID: PMC4669857]. https://doi.org/10.4103/0971-5916.166527.
  • 57.
    Tahmasebi F, Movahedin M, Mazaheri Z. [Poly Cystic Ovary Model as an Elevated Oxidative Stress Factor]. J Mazandaran Univ Med Sci. 2015;25(127):82-91. Persian.
  • 58.
    Kokabiyan Z, Yaghmaei P, Jameie SB, Hajebrahimi Z. Therapeutic Effects of Eugenol in Polycystic Ovarian Rats Induced by Estradiol Valerate: A Histopathological and A Biochemical Study. Int J Fertil Steril. 2022;16(3):184-91. [PubMed ID: 36029055]. [PubMed Central ID: PMC9396002]. https://doi.org/10.22074/ijfs.2021.537724.1176.
  • 59.
    Kelly CC, Lyall H, Petrie JR, Gould GW, Connell JM, Sattar N. Low grade chronic inflammation in women with polycystic ovarian syndrome. J Clin Endocrinol Metab. 2001;86(6):2453-5. [PubMed ID: 11397838]. https://doi.org/10.1210/jcem.86.6.7580.
  • 60.
    Tarkun I, Arslan BC, Canturk Z, Turemen E, Sahin T, Duman C. Endothelial dysfunction in young women with polycystic ovary syndrome: relationship with insulin resistance and low-grade chronic inflammation. J Clin Endocrinol Metab. 2004;89(11):5592-6. [PubMed ID: 15531516]. https://doi.org/10.1210/jc.2004-0751.
  • 61.
    Topcu S, Caliskan M, Ozcimen EE, Tok D, Uckuyu A, Erdogan D, et al. Do young women with polycystic ovary syndrome show early evidence of preclinical coronary artery disease? Hum Reprod. 2006;21(4):930-5. [PubMed ID: 16373410]. https://doi.org/10.1093/humrep/dei431.
  • 62.
    Meyer C, McGrath BP, Teede HJ. Overweight women with polycystic ovary syndrome have evidence of subclinical cardiovascular disease. J Clin Endocrinol Metab. 2005;90(10):5711-6. [PubMed ID: 16046590]. https://doi.org/10.1210/jc.2005-0011.
  • 63.
    Wu Y, Zhang J, Wen Y, Wang H, Zhang M, Cianflone K. Increased acylation-stimulating protein, C-reactive protein, and lipid levels in young women with polycystic ovary syndrome. Fertil Steril. 2009;91(1):213-9. [PubMed ID: 18206145]. https://doi.org/10.1016/j.fertnstert.2007.11.031.
  • 64.
    Hu W, Qiao J, Yang Y, Wang L, Li R. Elevated C-reactive protein and monocyte chemoattractant protein-1 in patients with polycystic ovary syndrome. Eur J Obstet Gynecol Reprod Biol. 2011;157(1):53-6. [PubMed ID: 21530057]. https://doi.org/10.1016/j.ejogrb.2011.03.015.
  • 65.
    Wu Z, Fang L, Li Y, Yan Y, Thakur A, Cheng JC, et al. Association of circulating monocyte chemoattractant protein-1 levels with polycystic ovary syndrome: A meta-analysis. Am J Reprod Immunol. 2021;86(2):e13407. [PubMed ID: 33638245]. https://doi.org/10.1111/aji.13407.
  • 66.
    Sujima Anbu A, Venkatachalam P. Biological macromolecule cross linked TPP–chitosan complex: a novel nanohybrid for improved ovulatory activity against PCOS treatment in female rats. RSC Adv. 2016;6(97):94301-13. https://doi.org/10.1039/c6ra07228c.
  • 67.
    Narmani A, Jafari SM. Chitosan-based nanodelivery systems for cancer therapy: Recent advances. Carbohydr Polym. 2021;272:118464. [PubMed ID: 34420724]. https://doi.org/10.1016/j.carbpol.2021.118464.
  • 68.
    Qin C, Li H, Xiao Q, Liu Y, Zhu J, Du Y. Water-solubility of chitosan and its antimicrobial activity. Carbohydr Polym. 2006;63(3):367-74. https://doi.org/10.1016/j.carbpol.2005.09.023.
  • 69.
    Rodrigues S, Dionisio M, Lopez CR, Grenha A. Biocompatibility of chitosan carriers with application in drug delivery. J Funct Biomater. 2012;3(3):615-41. [PubMed ID: 24955636]. [PubMed Central ID: PMC4030999]. https://doi.org/10.3390/jfb3030615.
  • 70.
    Kean T, Thanou M. Biodegradation, biodistribution and toxicity of chitosan. Adv Drug Deliv Rev. 2010;62(1):3-11. [PubMed ID: 19800377]. https://doi.org/10.1016/j.addr.2009.09.004.
  • 71.
    Bayrami A, Shirdel A, Rahim Pouran S, Mahmoudi F, Habibi-Yangjeh A, Singh R, et al. Co-regulative effects of chitosan-fennel seed extract system on the hormonal and biochemical factors involved in the polycystic ovarian syndrome. Mater Sci Eng C Mater Biol Appl. 2020;117:111351. [PubMed ID: 32919695]. https://doi.org/10.1016/j.msec.2020.111351.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles