The Mutations of Topoisomerase Genes and Their Effect on Resistance to Fluoroquinolones in Extended-Spectrum β-Lactamase-Producing Escherichia coli

Author(s):
Roya Chegene LorestaniRoya Chegene Lorestani1, Alisha AkyaAlisha Akya2,*, Azam ElahiAzam Elahi1
1MSc Student of Medical Microbiology, Department of Microbiology, Faculty of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran
2Associate Professor of Medical Microbiology, Nosocomial Infection Research Centre, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran

Jundishapur Journal of Natural Pharmaceutical Products:Vol. 13, issue 1; e57964
Published online:Feb 24, 2018
Article type:Research Article
Received:Dec 27, 2016
Accepted:Feb 20, 2018
How to Cite:Chegene Lorestani R, Akya A, Elahi A. The Mutations of Topoisomerase Genes and Their Effect on Resistance to Fluoroquinolones in Extended-Spectrum β-Lactamase-Producing Escherichia coli. Jundishapur J Nat Pharm Prod. 2018;13(1):e57964. doi: https://doi.org/10.5812/jjnpp.57964

Abstract

Background:

Fluoroquinolones have been used for empirical treatment of urinary tract infections in recent years. This study aimed at identifying mutations in gyrA and parC genes and their correlation with fluoroquinolone minimal inhibitory concentration (MIC) among extended-spectrum β-lactamase-producing (ESBL) Escherichia coli.

Methods:

A total of 240 E. coli were isolated from urine of patients during 2014 and 2015 in the west of Iran. The isolates were screened for ESBL-producing phenotype using combined disc diffusion test. The susceptibility of ESBL isolates to ciprofloxacin and levofloxacin was determined by disk diffusion and microdilution assay. PCR, sequencing and bioinformatics analysis were performed to identify mutations in gyrA and parC genes.

Results:

Of 240 isolates, 66 (27.5%) were ESBL positive. Of them, 45 (68.1%) isolates were resistant to both ciprofloxacin and levofloxacin. Sequence analysis showed mutations in the quinolone resistance determining region (QRDR) in the 2 codons (Ser-83, Asp-87) of gyrA and 2 codons (Ser-80, Glu-84) of parC. One mutation at codon of Ala-192 was found outside the QRDR in parC.

Conclusions:

Isolates with mutations in QRDR of parC and gyrA had the higher MIC level compared to isolates with mutations only in gyrA. The highest level of resistance was detected in isolates with accumulation of mutations in gyrA and parC. A high frequency of fluoroquinolone resistance among ESBL producing E. coli isolates indicated the clustered transmission of resistance genes in this bacterium. A new mutation outside the QRDR of parC was detected, which may play a role in fluoroquinolone resistance.

1. Background

Urinary tract infection (UTI) is one of the most common infections among outpatients visit medical centers (1). Escherichia coli is the most common etiologic agent of UTI and has been isolated in 75% to 90% of cases (2). The incidence of UTIs caused by strains of community acquired extended spectrum β-lactamase-producing (ESBL) E. coli is globally increasing (3, 4). In recent years, fluoroquinolones have been used as alternatives for empirical treatment of UTIs caused by E. coli (5). A systematic review in Iran revealed that 28.2% of E. coli isolates from UTI were resistant to ciprofloxacin (6). The quinolones inhibit bacterial DNA synthesis by binding to the topoisomerase II (DNA gyrase) and topoisomerase IV enzymes (7). The topoisomerase II consists subunits of A and B encoded by gyrA and gyrB, respectively. Similarly, the topoisomerase IV also consists of C and E subunits encoded by parC and parE, respectively (7). DNA gyrase in E. coli is the main target of quinolones (8), an enzyme which is essential for preserving the bacterial DNA topology. The second target of quinolones in gram-negative bacteria is the topoisomerase IV involves the separation of daughter cells’chromosomes at the end of DNA replication cycles (8, 9). The widespread use of fluoroquinolones in empiric treatment of UTI has resulted in resistance among E. coli strains (5). So far, 3 basic mechanisms of resistance to fluoroquinolones have been identified: 1, mutations in quinolone resistance determining region (QRDR) of topoisomerase genes; 2, decreasing the concentration of antibiotics within bacterial cells by efflux pumps or decreased expression of the porins; and 3, acquisition of plasmid- mediated resistant genes (10, 11). The most important mechanisms of resistance to quinolones in E. coli is mutations in DNA gyrase and topoisomerase IV (12). Mutations usually take place within the N-terminal regions of gyrA and parC subunits, which are more common than mutations in gyrB and parE (7). In E. coli, gyrA mutations usually occur at serine-83, which is substituted by leucine or tryptophan and causes high resistance to quinolones. However, the replacement of serine by alanine causes a lower resistance level (8, 13). Another common mutation is the substitution of aspartate-87 by asparagine and/or valine (13). Mutations in parC usually occur at 78, 80 and 84 positions, with the replacement of glycine by aspartate, serine by arginine, or isoleucine and glycine by aspartate, respectively (14). The amino acid substitutions can have a significant effect on the minimal inhibitory concentration (MIC) of fluoroquinolones. Research has shown that 3 or 4 mutations are required for high level of resistance (15, 16). The present study aimed at identifying mutations in gyrA and parC and the correlation between fluoroquinolone MIC and the number of mutations among ESBL producing E. coli.

2. Methods

2.1. Bacterial Isolates

In this cross-sectional study, 240 isolates of E. coli were isolated from urine of patients with urinary tract infections during 2014 and 2015 in Kermanshah, west of Iran. Urinary tract infection was defined as 105 or more bacteria per 1 mL of urine in people clinically suspected of having urinary infection (17). Isolates were identified using bacteriological and biochemical tests (18).

2.2. ESBL Screening of Isolates

For screening the ESBL production of isolates, the combined disc test was used according to the Clinical and Laboratory Standards Institute (CLSI) protocols (18). Briefly, the combined discs of ceftazidime (30 µg) plus clavulanic acid (10 µg) and cefotaxime (30 µg) plus clavulanic acid (10 µg) (MAST, England) were used in a standard disk diffusion assay. If the diameter of inhibited growth zone around the combined discs for an isolate was at least 5 mm or more than the zone for single disc of the same antibiotic, then, the isolate was considered ESBL-producer (19). The strain of ESBL-producing E. coli ATCC 35218 was used for quality control.

2.3. Antibiotic Susceptibility Testing

The susceptibility of E. coli isolates to ciprofloxacin and levofloxacin (MAST, England) was first assessed by the standard disk diffusion method according to the CLSI guidelines (19). Then, the MIC for ciprofloxacin and levofloxacin (Sigma, USA) was determined by the broth microdilution method using CLSI criteria (19). Briefly, a serial dilution of ciprofloxacin and levofloxacin was prepared in Mueller Hinton broth containing 5 × 106 CFU/mL bacteria. The culture tubes were incubated at 37°C for 18 hours and the lowest concentration of antibiotic with no visible bacterial growth was defined as the MIC. E. coli ATCC 25922 strain was used as the quality control. The range of antibiotic concentrations was from 0.015 to 1024 µg/mL. The CLSI breakpoints were used for ciprofloxacin (susceptible ≤ 1 µg/mL; resistant ≥ 4 µg/mL) and levofloxacin (susceptible ≤ 2 µg/mL; resistant ≥ 8 µg/mL).

2.4. DNA Amplification and Sequencing

Bacterial DNA was extracted using genomic DNA purification kit (SinaClon, Iran). The QRDR of parC and gyrA genes in 45 isolates resistant to both antibiotics (ciprofloxacin and levofloxacin) was amplified by PCR (Table 1). After electrophoresis of PCR products on 1% agarose gel and staining with ethidium bromide, the DNA bands were visualized by GelDoc apparatus (BioRad, USA).
Table 1.The Primers
PrimersPrimer Sequences (5’ - 3’)Target SiteAmplicon Size, bpReference
parC F / parC RAGCGCCTTGCGTACATGAATQRDR of parC964(20)
GTGGTAGCGAAGAGGTGGTT
gyrA F / gyrA RTACACCGGTCAACATTGAGGQRDR of gyrA684(21)
CCGGATCGGTAAGCTTCTTCAAT
All PCR products for parC and gyrA genes were purified by kit and sequenced (SinaColon, Iran). The sequence was performed using an ABI 3730XL DNA analyzer apparatus (Macrogen Inc., Korea). Sequence data were analyzed for homology with genetic data using the national center for biotechnology information GenBank database (http:/www.ncbi.nlm.nih.gov/BLAST/).

2.5. Statistical Analysis

All data were analyzed using SPSS Version 20 for the correlation between gene mutations and ciprofloxacin and levofloxacin resistance by chi square or Fisher’s exact test. Statistical significance was defined as P value less than 0.05.

3. Results

Of 240 isolates, 66 (27.5%) were ESBL positive. The isolates belonged to 57 women (86.4%) and 9 (13.6%) males with the average age of 43.5 ± 22 years. In terms of age distribution of the patients, 12 (18.2%), 14 (21.2%) and 40 (60.6%) were under 20, 21 to 40 and above 40 years, respectively. The antibiotic susceptibility and MIC of ciprofloxacin and levofloxacin for 66 ESBL producing E. coli isolates are presented in Table 2 and Figure 1. Of these 66 isolates, 45 (68.1%) were resistant to both ciprofloxacin and levofloxacin. The amplification results of gyrA and parC genes are displayed in Figure 2.
Table 2.Antibiotic Susceptibility of 66 E. coli Isolates to Fluoroquinolonesa
FluoroquinolonesAntibiotic Susceptibility of Isolates
SusceptibleIntermediateResistanceMIC50MIC90
Ciprofloxacin20 (30.3)1 (1.5)45 (68.1)64256
Levofloxacin20 (30.3)1 (1.5)45 (68.1)64256

aValues are expressed as No. (%).

The Distribution of Isolates According to Their MIC (µg/mL) for Ciprofloxacin and Levofloxacin
Figure 1.

The Distribution of Isolates According to Their MIC (µg/mL) for Ciprofloxacin and Levofloxacin

Lane M, 100bp DNA marker; lanes 1 to 6, PCR products of <i>gyrA</i> and <i>parC</i> genes.
Figure 2.

Lane M, 100bp DNA marker; lanes 1 to 6, PCR products of gyrA and parC genes.

DNA sequence analysis of the QRDR of gyrA and parC showed mutations in gyrA and parC in 45 isolates resistant to both antibiotics. All isolates resistant to fluoroqinolones showed mutations in gyrA at codon 83 (C → T Transition of codon TCG) and resulted in substitution of serine by leucine. A total of 42 (93.3%) isolates showed mutations at codon 87 (G → A Transition of codon GAC) and resulted in the substitution of aspartic acid by asparagine.
Mutations at 80 and 84 amino acid positions were found in QRDR of parC. In 42 (93.3%) isolates, a mutation was found at codon 80, in 40 cases serine was substituted by isoleucine (G → T Transversion of codon AGC), and in 2 cases serine was substituted by Leusine (AGC → CTT). A mutation at codon 84 of parC was found in 26 (57.7%) isolates, in 25 cases of them the A → T transposition of codon GAA was detected that resulted in substitutions of glutamic acid by valine, and in 1 case the G → A transposition of codon GAA resulted in the substitutions of glutamic acid by lysine. A mutation outside QRDR of parC was also detected in 22 (48.8%) isolates where C → T transposition in GCA codon at 192 position resulted in the substitution of alanine by valine amino acid. The nucleotide sequence data of ParC have been deposited into the GenBank under the accession number of Ky308189.
The correlation of mutations in gyrA and parC with the MIC of isolates is demonstrated in Tables 3 and 4. Isolates with a single mutation in gyrA and no mutations in parC showed the lower MIC breakpoints compared to isolates with mutations in QRDR of both parC and gyrA genes, which were statistically significant for both ciprofloxacin (P = 0.008) and levofloxacin (P = 0.026).
Table 3.Mutations in gyrA and parC Genes in Resistant Isolates and Their Corresponding MIC for Ciprofloxacin
Mutations in the QRDRNo. of IsolatesNo. of Isolates with MIC (≥ 4 µg/mL) to Ciprofloxacin
gyrAparC
Ser83Asp87Ser80Glu84Ala19248163264128256512
LeuAsnIleVal-3111
LeuAsnIle--1511724
Leu----321
LeuAsnIleValVal2036542
LeuAsnIle-Val11
LeuAsnIleLys-11
LeuAsnLeuVal-11
LeuAsnLeuValVal11

Abbreviations: Ala, Alanine; Asn, Asparagine; Asp, Aspartic Acid; CLSI Breakpoint for Ciprofloxacin Resistant; Glu, Glutamic Acid; Ile, Isoleucine; Leu, Leucine; Lys, Lysine; Ser, Serine; Val, Valin.

Table 4.Mutations in gyrA and parC Genes in Resistant Isolates and Their Corresponding MIC for Levofloxacin
Mutations in the QRDRNo. of IsolatesNo. of Isolates with MIC (≥ 8 µg/mL) to Levofloxacin
gyrAparC
Ser83Asp87Ser80Glu84Ala1928163264128256512
LeuAsnIleVal-312
LeuAsnIle--1511445
Leu----321
LeuAsnIleValVal2017822
LeuAsnIle-Val11
LeuAsnIleLys-11
LeuAsnLeuVal-11
LeuAsnLeuValVal11

Abbreviation: CLSI, Breakpoint for Levofloxacin Resistance.

4. Discussion

Following the extensive use of fluoroquinolone in the past few decades, resistance to this group of antibiotic has increased in E. coli. Given the cotransmission of resistance genes, research showed that the ESBL positive isolates are more resistant to fluoroquinolones than non-ESBL isolates (22, 23). Our results revealed a high resistance rate to ciprofloxacin and/or levofloxacin among ESBL positive isolates of E. coli, which is consistent with the results reported for fluoroquinolones by a number of studies in Iran (64.2%), Canada (79.4%), Egypt (60%) and Syria (65.8%) (24-27). Given the fact that only ESBL positive isolates were used in our study, it is reasonable to expect a higher antibiotic resistance compared to some previous studies, which have used a mix of ESBL positive and negative E. coli isolates (28, 29). The association of DNA gyrase and topoisomerase IV mutations with fluoroquinolones resistance has been reported for both Gram-negative and Gram-positive organisms (12). In our study, the significant role of mutations in the resistance of E. coli to fluoroquinolones was determined. Moreover, the accumulation of mutations in gyrA and the simultaneous mutations in parC play a fundamental role in developing high level resistance to ciprofloxacin in clinical isolates (30).
The sequence analysis of QRDR in gyrA indicates that mutations occur in 2 positions at serine-83 and aspartate-87, which is similar to the report of a previous research (31). Mutations at codons 83 and 87 in gyrA are the most frequent ones among fluoroquinolone resistant E. coli. The substitution of the serine-83 by leucine is the most common change, which is consistent with the results of other studies in Iran (32, 33). It seems that this mutation is the basic change for resistance to fluoroquinolones (34). Research has shown that a point mutation in the gyrA can only slightly reduce the susceptibility of E. coli to fluoroquinolones, but high-level resistance is associated with double mutations in the GyrA protein (35). This is similar with our results indicating that a single mutation in the serine amino acid at position 83 in gyrA can only result in a low level of resistance.
Sequence analysis of QRDR of parC showed the high frequency of mutations in codon Ser80 and Glu84 among isolates. The mutation at these 2 positions has been previously reported (36). In our study, the most common mutation in parC was the replacement of serine by isoleucine at position 80, which has been known as the most common amino acid changes in the ParC protein (34). Furthermore, 22 of the isolates showed a mutation at codon 192 outside the QRDR of parC, where alanine was substituted by valine, but this substitution doesn’t apparently increase resistance to fluoroquinolones. This novel mutation needs further investigation to confirm its impact on bacterial resistance. All the isolates with mutations in QRDR of parC showed simultaneous mutations in gyrA, which is consistent with the fact that in the Gram-negative bacteria, such as E. coli, topoisomerase IV is the second target for quinolones (37). However, mutations in parC have an important role in the high level of fluoroquinolone resistance (37). It has been speculated that the high resistance to fluoroquinolones is a gradual process, which begins primarily with mutations in gyrA followed by changes in parC (38).
In conclusion, our results suggest that isolates with mutations in QRDR of both parC and gyrA have higher MIC levels compared to isolates with only mutations in gyrA. Furthermore, the highest level of resistance can be found in isolates with 2 mutations in gyrA and 2 or 3 mutations in the parC. Therefore, there is a significant correlation between the number of gyrA and parC mutations and the level of ciprofloxacin and levofloxacin resistance. These findings are in agreement with the results of other studies (16, 39). A high frequency of fluoroquinolone resistance among ESBL producing E. coli isolates in our region indicate the clustered transmission of resistance genes among ESBL producing bacteria that need regular surveillance. Consequently, the fluoroquinolones should only be used for susceptible E. coli isolates in urinary tract infections.

Acknowledgments

Footnotes

References

  • 1.
    Barratt M, Avner ED, Harmon WE. Pediatric nephrology. 4th ed. Pensylvania: Lippincott Williams& Wilkinas; 2000. p. 158-67.
  • 2.
    Nicolle LE. Epidemiology of urinary tract infection. Infect Med. 2001;18:153-82.
  • 3.
    Apisarnthanarak A, Kiratisin P, Mundy LM. Predictors of mortality from community-onset bloodstream infections due to extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae. Infect Control Hosp Epidemiol. 2008;29(7):671-4. [PubMed ID: 18624669]. https://doi.org/10.1086/588082.
  • 4.
    Rodriguez-Bano J, Alcala JC, Cisneros JM, Grill F, Oliver A, Horcajada JP, et al. Community infections caused by extended-spectrum beta-lactamase-producing Escherichia coli. Arch Intern Med. 2008;168(17):1897-902. [PubMed ID: 18809817]. https://doi.org/10.1001/archinte.168.17.1897.
  • 5.
    Drago L, De Vecchi E, Mombelli B, Nicola L, Valli M, Gismondo MR. Activity of levofloxacin and ciprofloxacin against urinary pathogens. J Antimicrob Chemother. 2001;48(1):37-45. [PubMed ID: 11418511]. https://doi.org/10.1093/jac/48.1.37.
  • 6.
    Akya A, Najafi F, Sohrabi N, Vaziri S, Mansouri F, Azizi M, et al. The systematic review of quinolones resistance of escherichia coli isolated from urinary tract infections in Iran over the last ten years (2001-2011). Annu Res Rev Biol. 2015;6(4):234-44. https://doi.org/10.9734/arrb/2015/12676.
  • 7.
    Hooper DC. Emerging mechanisms of fluoroquinolone resistance. Emerg Infect Dis. 2001;7(2):337-41. [PubMed ID: 11294736]. https://doi.org/10.3201/eid0702.700337.
  • 8.
    Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother. 2003;51(5):1109-17. [PubMed ID: 12697644]. https://doi.org/10.1093/jac/dkg222.
  • 9.
    Ambrozic Avgustin J, Keber R, Zerjavic K, Orazem T, Grabnar M. Emergence of the quinolone resistance-mediating gene aac(6')-Ib-cr in extended-spectrum-beta-lactamase-producing Klebsiella isolates collected in Slovenia between 2000 and 2005. Antimicrob Agents Chemother. 2007;51(11):4171-3. [PubMed ID: 17846136]. https://doi.org/10.1128/AAC.01480-06.
  • 10.
    Robicsek A, Jacoby GA, Hooper DC. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect Dis. 2006;6(10):629-40. [PubMed ID: 17008172]. https://doi.org/10.1016/S1473-3099(06)70599-0.
  • 11.
    Yamane K, Wachino J, Suzuki S, Kimura K, Shibata N, Kato H, et al. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother. 2007;51(9):3354-60. [PubMed ID: 17548499]. https://doi.org/10.1128/AAC.00339-07.
  • 12.
    Frank T, Mbecko JR, Misatou P, Monchy D. Emergence of quinolone resistance among extended-spectrum beta-lactamase-producing Enterobacteriaceae in the Central African Republic: genetic characterization. BMC Res Notes. 2011;4:309. [PubMed ID: 21867486]. https://doi.org/10.1186/1756-0500-4-309.
  • 13.
    Krishnan S, Balasubramanian D, Raju BA, Lakshmi BS. Use of a naturally occurring codon bias for identifying topoisomerase mutations in ciprofloxacin resistant Escherichia coli using PCR and future prospects with other bacterial genera: A pilot study. Adv Biol Chem. 2012;2(4):366-71. https://doi.org/10.4236/abc.2012.24045.
  • 14.
    Ito CA, Gales AC, Tognim MC, Munerato P, Dalla Costa LM. Quinolone-resistant Escherichia coli. Braz J Infect Dis. 2008;12(1):5-9. [PubMed ID: 18553006]. https://doi.org/10.1590/S1413-86702008000100003.
  • 15.
    Shigemura K, Tanaka K, Yamamichi F, Shirakawa T, Miyake H, Fujisawa M. Does mutation in gyrA and/or parC or efflux pump expression play the main role in fluoroquinolone resistance in Escherichia coli urinary tract infections?: A statistical analysis study. Int J Antimicrob Agents. 2012;40(6):516-20. [PubMed ID: 23068598]. https://doi.org/10.1016/j.ijantimicag.2012.07.019.
  • 16.
    Fabrega A, Madurga S, Giralt E, Vila J. Mechanism of action of and resistance to quinolones. Microb Biotechnol. 2009;2(1):40-61. [PubMed ID: 21261881]. https://doi.org/10.1111/j.1751-7915.2008.00063.x.
  • 17.
    Fauci AS, Braunwald E, Kasper DL. Harrison's principles of internal medicine. 17th ed. USA: McGraw-Hill; 2008.
  • 18.
    Washington C, Stephen A, Janda W. Koneman's color atlas and textbook of diagnostic microbiology. 6th ed. USA: Lippincott williams & wilkins; 2006.
  • 19.
    Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-second Informational Supplement M100-S22. Wayne, PA, USA: CLSI; 2012.
  • 20.
    Komp Lindgren P, Karlsson A, Hughes D. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother. 2003;47(10):3222-32. [PubMed ID: 14506034]. https://doi.org/10.1128/AAC.47.10.3222-3232.2003.
  • 21.
    Park YH, Yoo JH, Huh DH, Cho YK, Choi JH, Shin WS. Molecular analysis of fluoroquinolone-resistance in Escherichia coli on the aspect of gyrase and multiple antibiotic resistance (mar) genes. Yonsei Med J. 1998;39(6):534-40. [PubMed ID: 10097680]. https://doi.org/10.3349/ymj.1998.39.6.534.
  • 22.
    Raei F, Eftekhar F, Feizabadi MM. Prevalence of Quinolone Resistance Among Extended-Spectrum beta -Lactamase Producing Uropathogenic Klebsiella pneumoniae. Jundishapur J Microbiol. 2014;7(6). e10887. [PubMed ID: 25371807]. https://doi.org/10.5812/jjm.10887.
  • 23.
    Hsueh PR. Study for Monitoring Antimicrobial Resistance Trends (SMART) in the Asia-Pacific region, 2002-2010. Int J Antimicrob Agents. 2012;40 Suppl:S1-3. [PubMed ID: 22749052]. https://doi.org/10.1016/S0924-8579(12)00244-0.
  • 24.
    Pakzad I, Ghafourian S, Taherikalani M, Sadeghifard N, Abtahi H, Rahbar M, et al. qnr Prevalence in Extended Spectrum Beta-lactamases (ESBLs) and None-ESBLs Producing Escherichia coli Isolated from Urinary Tract Infections in Central of Iran. Iran J Basic Med Sci. 2011;14(5):458-64. [PubMed ID: 23493061].
  • 25.
    Lagace-Wiens PR, Nichol KA, Nicolle LE, Decorby MR, McCracken M, Alfa MJ, et al. ESBL genotypes in fluoroquinolone-resistant and fluoroquinolone-susceptible ESBL-producing Escherichia coli urinary isolates in Manitoba. Can J Infect Dis Med Microbiol. 2007;18(2):133-7. [PubMed ID: 18923714]. https://doi.org/10.1155/2007/848194.
  • 26.
    Hassan WM, Hashim A, Domany R. Plasmid mediated quinolone resistance determinants qnr, aac(6')-Ib-cr, and qep in ESBL-producing Escherichia coli clinical isolates from Egypt. Indian J Med Microbiol. 2012;30(4):442-7. [PubMed ID: 23183470]. https://doi.org/10.4103/0255-0857.103766.
  • 27.
    Alheib O, Al Kayali R, Abajy MY. Prevalence of plasmid-mediated quinolone resistance (PMQR) determinants among extended spectrum beta-lactamases (ESBL)-producing isolates of escherichia coli and klebsiella pneumoniae in Aleppo, Syria. Arch Clin Infect Dis. 2015;10(3). https://doi.org/10.5812/archcid.20631.
  • 28.
    Soleimani-Asl Y, Zibaei M, Firoozeh F. Detection of qnrA gene among quinolone-resistant Escherichia coli isolated from urinary tract infections in Khorram Abad during 2011-2012 [In Persian]. Feyz. 2013;17(5):488-94.
  • 29.
    Mansouri Jamshidi N, Pakzad I, Tabaraei B. Evaluating the frequency of ciprofloxacin resistance qnr genes in escherichia coli strains isolated from clinical samples of Imam Khomani and Milad Hospitals in Ilam and Tehran, Iran [In Persian]. J Ilam Univ Med Sci. 2012;21(6):16-22.
  • 30.
    Shibl AM, Radwa HH; Al-Agamy. Detection of mutations in quinolone-resistant determining regions in clinical isolates of Escherichia coli from Saudi Arabia. Afr J Biotechnol. 2012;11(5):1054-8.
  • 31.
    Piddock LJ. Mechanisms of fluoroquinolone resistance: an update 1994-1998. Drugs. 1999;58 Suppl 2:11-8. [PubMed ID: 10553699]. https://doi.org/10.2165/00003495-199958002-00003.
  • 32.
    Abdi-Hachesoo B, Asasi K, Sharifiyazdi H. Rapid detection of Escherichia coli gyrA and parC mutants in one-day-old broiler chicks in Iran. Vet Ital. 2013;49(3):291-7. [PubMed ID: 24358491].
  • 33.
    Ardebili A, Lari AR, Beheshti M, Lari ER. Association between mutations in gyrA and parC genes of Acinetobacter baumannii clinical isolates and ciprofloxacin resistance. Iran J Basic Med Sci. 2015;18(6):623-6. [PubMed ID: 26221488].
  • 34.
    Liu BT, Liao XP, Yang SS, Wang XM, Li LL, Sun J, et al. Detection of mutations in the gyrA and parC genes in Escherichia coli isolates carrying plasmid-mediated quinolone resistance genes from diseased food-producing animals. J Med Microbiol. 2012;61(Pt 11):1591-9. [PubMed ID: 22878251]. https://doi.org/10.1099/jmm.0.043307-0.
  • 35.
    Weigel LM, Steward CD, Tenover FC. gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrob Agents Chemother. 1998;42(10):2661-7. [PubMed ID: 9756773].
  • 36.
    Vila J, Ruiz J, Goni P, De Anta MT. Detection of mutations in parC in quinolone-resistant clinical isolates of Escherichia coli. Antimicrob Agents Chemother. 1996;40(2):491-3. [PubMed ID: 8834907].
  • 37.
    Hopkins KL, Davies RH, Threlfall EJ. Mechanisms of quinolone resistance in Escherichia coli and Salmonella: recent developments. Int J Antimicrob Agents. 2005;25(5):358-73. [PubMed ID: 15848289]. https://doi.org/10.1016/j.ijantimicag.2005.02.006.
  • 38.
    Al-Marzooq F, Mohd Yusof MY, Tay ST. Molecular analysis of ciprofloxacin resistance mechanisms in Malaysian ESBL-producing Klebsiella pneumoniae isolates and development of mismatch amplification mutation assays (MAMA) for rapid detection of gyrA and parC mutations. Biomed Res Int. 2014;2014:601630. [PubMed ID: 24860827]. https://doi.org/10.1155/2014/601630.
  • 39.
    Ogbolu DO, Daini OA, Ogunledun A. Effects of gyrA and parC mutations in quinolones resistant clinical gram negative bacteria from Nigeria. Afr J Biomed Res. 2012;15(2):97-104.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles