Arch Neurosci

Image Credit:Arch Neurosci

C-Met Receptors Deficiency Was Involved in Absence Seizures Development in WAG/Rij Rats

Author(s):
Mona AmiriMona Amiri1, Samira GhorbaniSamira Ghorbani2, 3, Fahime ZavvariFahime Zavvari1, Hassan Hosseini RavandiHassan Hosseini Ravandi3, Fariba KarimzadehFariba KarimzadehFariba Karimzadeh ORCID1, 3,*
1Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran
2Immunology Department, Tehran University of Medical Sciences, Tehran, Iran
3Shefa Neuroscience Research Center, Khatam al Anbia Hospital, Tehran, Iran
*Corresponding Author: Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran; Shefa Neuroscience Research Center, Khatam al Anbia Hospital, Tehran, Iran. Email: [email protected]

Archives of Neuroscience:Vol. 10, issue 1; e132959
Published online:Jan 03, 2023
Article type:Research Article
Received:Nov 19, 2022
Accepted:Dec 07, 2022
How to Cite:Amiri M, Ghorbani S, Zavvari F, Hosseini Ravandi H, Karimzadeh F. C-Met Receptors Deficiency Was Involved in Absence Seizures Development in WAG/Rij Rats. Arch Neurosci. 2023;10(1):e132959. doi: https://doi.org/10.5812/ans-132959

Abstract

Background:

A variety of receptors may be involved in the pathogenesis of absence seizures. The c-Met receptors have a critical role in modulating the GABAergic interneurons and creating a balance between excitatory and inhibitory neurotransmission, sensorimotor gating, and normal synaptic plasticity.

Objectives:

This study aimed to assess the changes of the c-Met receptor during the appearance of absence attacks in the experimental model of absence epilepsy.

Methods:

A total of 48 animals were divided into four groups of two- and six-month-old WAG/Rij and Wistar rats. Epileptic WAG/Rij rats showing SWP in electrocorticogram (ECoG) were included in the epileptic group. The two-month-old WAG/Rij rats as well as two- and six-month-old Wistar rats not exhibiting SWP in ECoG were selected as the non-epileptic. Gene (RT-PCR) and protein expression (western blotting) of c-Met receptors as well as c-Met protein distribution (immunohistochemistry) in the somatosensory cortex and hippocampus were assessed during seizure development of the absence attacks.

Results:

According to the study findings, a lower c-Met gene and protein expression, as well as a lower protein distribution, were observed in the hippocampus (P < 0.001, P < 0.05, and P < 0.001, respectively) and cortex (P < 0.01, P < 0.001 and P < 0.001, respectively) of the two-month-old WAG/Rij rats compared to the same-age Wistar rats. Moreover, the data revealed a reduction of hippocampal and cortical c-Met protein expression (P < 0.001, for both) in six-month-old WAG/Rij rats compared to two-month-old ones. Six-month-old WAG/Rij rats had a lower cortical c-Met gene (P < 0.05) and protein expression (P < 0.001) as well as lower hippocampal and cortical protein distribution (P < 0.05 and P < 0.001) than the same-age Wistar rats.

Conclusions:

In sum, the c-Met receptor was found to play a significant role in the development of absence epilepsy. This receptor, therefore, may have been considered as an effective goal for absence seizure inhibition.

1. Background

Absence seizure is a kind of epilepsy disease accompanied by temporary loss of consciousness. The spike-wave potentiation (SWP), which appeared spontaneously and synchronously is the top specs of the electro-encephalogram (EEG) in the absence of epilepsy (1). WAG/Rij (Wistar Albino Glaxo Rijswijk) rat, which is a verified genetic model of absence seizure, is commonly used for the study of the pathophysiology of absence seizure. An age-dependent progression of absence seizures has been reported in WAG/Rij rats (2). The post-natal progression of SWPs in WAG/Rij rats can be triggered by cumulative structural and functional changes in the brain cells and neuronal networks, including changes in the excitability of individual neurons, the strength of network synaptic activity, and/or alteration in inhibitory interneurons, to generate synchronized discharges. Abnormal interconnection in different areas of the cortico-thalamocortical network has an important role in the appearance of SWPs (3). In addition, the tune of thalamocortical rhythmicity depends on the distribution of the cortical receptors (4-6).
The MET gene encodes the tyrosine kinase receptor known as c-Met. HGF is a major known ligand of the MET receptor. C-Met receptors have emerged as transmission regulators of GABA and dopamine neurotransmitters, and as potent modulators of glutamate-related synaptic plasticity (7). These receptors have incredible roles in creating a balance between excitatory and inhibitory neurotransmission, normal synaptic plasticity, and sensorimotor gating (8). The retention of excitation/inhibition balance is serious for the homeostatic control of brain function, and its impairment can result in the development of several brain disorders such as epilepsy (9). C-Met receptors regulate the activity of hippocampal and cortical pyramidal neurons, while dysfunction of c-Met channels perturb the neuronal network activity, functional connectivity, and synaptic plasticity (10, 11).

2. Objectives

Therefore, the present study aimed to investigate the alteration of c-Met receptors in both hippocampal and cortical brain areas during the absence seizures appearance in the WAG/Rij rats, which was known as the most valid laboratory rat model of absence attacks. It should be noted that absence attacks appear in the adult WAG/Rij rats spontaneously, approximately after three months of age.

3. Methods

3.1. Animals

Male Wistar and WAG/Rij rats were included in the study and adapted under standard laboratory conditions of 22ºC environmental temperature, 40% dampness, and 12 hours of light and dark with unrestricted access to food and drink. Animals were divided into four groups (n = 12) of two- and six-month-old WAG/Rij and Wistar rats. Animal trials were performed based on the guidelines offered by the Ethical Committee of Iran University of Medical Sciences, Tehran, Iran, and in accordance with Ethics in Animal Experiments (IR.IUMS.RFC.1396.30641).
To determine epileptic rats, ECoG recording (electrocorticogram) was carried out for at least six hours under sedated condition by intraperitoneal fentanyl injection (3 μg/kg) every 20 - 30 minutes (12). Epileptic WAG/Rij rats showing SWP in ECoG were included in the epileptic group (5). Two-month-old WAG/Rij rats as well as two- and six-month-old Wistar rats not exhibiting SWP in ECoG, were selected as the non-epileptic rats (Figure 1) (13).
Monitoring ECoG in the experimental groups. The ECoG was recorded by implemented electrodes on the somatosensory cortex. Up-trace indicates ECoG was recorded from non-epileptic rats (two and six-monhs old Wistar and also two-month-old WAG/Rij rats). Lower-trace indicates ECoG was recorded from epileptic rats (six-month-old WAG/Rij rats).
Figure 1.

Monitoring ECoG in the experimental groups. The ECoG was recorded by implemented electrodes on the somatosensory cortex. Up-trace indicates ECoG was recorded from non-epileptic rats (two and six-monhs old Wistar and also two-month-old WAG/Rij rats). Lower-trace indicates ECoG was recorded from epileptic rats (six-month-old WAG/Rij rats).

3.2. Molecular Study

3.2.1. RNA Extraction and Reverse Transcription

After inducing deep anesthesia by using chloralhydrate and transcardially perfusion with 200 mL of saline, the animals were decapitated, and the somatosensory cortex and hippocampus were dissected. Total tissue RNA was extracted from brain samples using Gene ALL Ribospin Kit.
A DNase treatment was performed using (RNase-Free DNase Set "DNase I," Qiagen) to remove genomic DNA. The Maxima first strand cDNA synthesis kit (Thermo Scientific) was used to synthesize complementary DNA (cDNA) from all of the recovered RNA (500 ng) based on the manufacturer's conductions.

3.2.2. Real-Time PCR

MET and β-actin primers sequences were gained from prior works (12, 14). Real-time PCR reactions were carried out on a CFX 96 Real-Time System (Bio-Rad). All data were analyzed by duplicated samples. Amplified products were detected by Eva Green dye. The primer sequences for internal control and the MET gene are as shown in Table 1. Conditions for PCR were an initial denaturation at 95°C (15 min), 40 denaturation cycles at 95°C (30 sec), primer annealing at 72°C (45 sec), and elongation at 72°C (30 sec). To assess product specificity, a melting curve analysis was performed following RT-PCR.
Table 1.Real-time PCR Primer Specifications and Sequences
GeneForward PrimerReverse PrimerLength
MET5'-TCCTGACGGCAAGGATGAC3'5'TGATGATACCCACATTGGTGTTC3'131 bp
β-Actin5'AAGTCCCTCACCCTCCCAAAAG3'5'AAGCAATGCTGTCACCTTCCC3’98 bp

3.2.3. Western Blot Analysis

The somatosensory cortex and hippocampus samples homogenization was performed using lysis buffer including: tris buffer (50 mM), EDTA (1 mM), 1% Triton, phenyl-Methyl-sulfonyl fluoride (1 mM), aprotinin (1 µg/mL), pepstatin (1 µg/mL), and leupeptin (1 µg/mL) in 4ºC. Protein extracts were normalized for concentration using the Bradford test. Then 0.5µg/µL of total cell protein per sample in the buffer of SDS-PAGE (0.25 M Tris-HCl, 10% (v/v) glycerol, 10% (wt/vol) SDS, and 10 mM dithiothreitol) at pH 6.8 were diluted. Protein samples were electrophoresed on a 12% SDS-polyacrylamide gel, transferred to PVDF membranes, and blocked with 5% non-fat dried milk in TBST buffer (Tween-200, 1%; Tris-HCl, 100 mM; NaCl, 150 mM, pH 7.4) for the night. Then the blots were incubated for three hours with mouse anti-MET mAb (Abcam) and mouse anti-β actin mAb (Sigma) at room temperature. After washing for three times (15 min each time), filters were incubated with secondary antibodies for 90 min. The secondary antibody was HRP-conjugated goat anti-mouse; Santa Cruz. ECL visualized the immuno-reactivity (Amersham Biosciences, Freiburg, Germany). The blots for 5 - 30 sec were exposed to sensitive X-ray film, and then films were scanned on a Bio-Rad scanner for densitometry. Quantitative analysis was performed by the monomeric band's data using Image J software.

3.3. Immunohistochemistry

After inducing deep anesthesia (chloral hydrate, i.p. injection) and transcardial perfusion by using 250 mL of normal saline and 400 mL of PFA (paraformaldehyde) 4% fixative solution, the brains were isolated and inserted in PFA 4% for about five days at 4ºC. After fixation and process steps for immunohistochemistry (IHC) studies, the serial coronal sections in 8μm thickness were prepared. Three slices from each brain were selected and rehydrated by the series of graduated alcohol, washed three times by PBS (pH = 7.4), and incubated for 5 min in the blockade solution (H2O2/ methanol, 3 %). Sections were boiled in citrate buffer at 95°C (pH = 6.0, 10 min) and kept at room temperature to cool. The sections were incubated in the normal goat serum (10%) and X-100 solution of Triton (0.2%) for 1 hour. Sections were incubated at 4ºC with the primary antibody against c-Met (1: 300) overnight, washed three times with PBS, and incubated by secondary antibody (goat anti-rabbit which conjugated with horseradish peroxidase (RNASEN; Abcam). The antibody was diluted in a ratio of 1: 100 in PBS with Triton X-100 0.3% and NGS 5% at 22ºC for 1 hour. To visualize the reactions, slides were incubated in 0.5 µL DAB (three-3'diaminobenzidine) and the buffer of peroxide (1.5 µL, 5 - 10 min), and were dyed with hematoxylin.
Negative control was carried out by removing the primary antibody incubation. Images were acquired using a digital camera (Nikon, objective lens 40X) linked to a microscope. The c-Met antibody labeled cells were counted in 1 mm2 in the areas of the somatosensory cortex (i.e., external and internal granular layers) and the hippocampus (CA1 and CA3).

3.4. Statistical Analysis

The Mean ± SEM of the data were analysed statistically using the one-way ANOVA followed by Bonferroni post-hoc test in the SPSS Statistics 22. The P < 0.05 was considered as the significant level.

4. Results

4.1. mRNA Level of c-Met Receptors

First, the expression of the MET gene in the hippocampus and somatosensory cortex of the two- and six-month-old WAG/Rij and Wistar rats was examined using RT-PCR.
A significantly high mRNA expression of c-Met was observed in the hippocampus of the two-month-old Wistar rats compared to that in the hippocampus of the six-month-old Wistar rats (P < 0.001). The results also indicated that the MET gene expression was lower in two-month-old WAG/Rij rats in comparison to the same-age Wistar group (P < 0.001; Figure 2).
Hippocampal and cortical MET mRNA expression in two- and six-month-old Wistar and WAG/Rij (epileptic) rats. Data are illustrated as the mean  ±  S.E.M. The symbols of *, ** and *** indicated P &lt; 0.05, P &lt; 0.01 and P &lt; 0.001, respectively.
Figure 2.

Hippocampal and cortical MET mRNA expression in two- and six-month-old Wistar and WAG/Rij (epileptic) rats. Data are illustrated as the mean  ±  S.E.M. The symbols of *, ** and *** indicated P < 0.05, P < 0.01 and P < 0.001, respectively.

MET mRNA levels were considerably higher in the cortex of the two-month-old Wistar rats compared to those in the cortexes of two- and six-month-old WAG/Rij rats (P < 0.01). Likewise, the gene expression of MET was significantly decreased in six-month-old WAG/Rij rats in comparison with that in the same-age of Wistar group (P < 0.01).

4.2. Protein Level of c-Met Receptors

Next, the hippocampal and cortical c-Met receptor protein expression levels were determined using a western blot (Figure 3A and B).
Western blot analysis of c-Met protein in the cortex and hippocampus. A and B, Immunoblotting images of hippocampal and cortical c-Met protein in two- and six-month-old Wistar and WAG/Rij (epileptic) rats; C, The quantitative results of hippocampal and cortical c-Met protein expression. The symbols of *, ** and *** indicated P &lt; 0.05, P &lt; 0.01 and P &lt; 0.001 (data has been illustrated as the mean ± S.E.M).
Figure 3.

Western blot analysis of c-Met protein in the cortex and hippocampus. A and B, Immunoblotting images of hippocampal and cortical c-Met protein in two- and six-month-old Wistar and WAG/Rij (epileptic) rats; C, The quantitative results of hippocampal and cortical c-Met protein expression. The symbols of *, ** and *** indicated P < 0.05, P < 0.01 and P < 0.001 (data has been illustrated as the mean ± S.E.M).

As for the hippocampus, the six-month-old Wistar and WAG/Rij rats displayed significantly low-level c-Met protein expression compared with the two-month-old Wistar and WAG/Rij rats (P < 0.001; Figure 3C). Interestingly, c-Met protein expression in two-month-old WAG/Rij rats was lower than that in the same-age Wistar rats (P < 0.05); however, no significant difference was observed between the six-month-old Wistar and WAG/Rij rats in this regard (Figure 3C).
As for the cortex, the two-month-old WAG/Rij rats displayed a lower level of c-Met protein expression than the age-matched Wistar rats (P < 0.001). C-Met protein expression was reduced in six-month-old Wistar rats compared to that in two-month-old Wistar rats (P < 0.01). In addition, our results revealed that there was a significant decline in the expression of the c-Met protein in six-month-old WAG/Rij rats compared to that in two-month-old WAG/Rij rats and six-month-old Wistar rats (P < 0.001 and P < 0.001 respectively; Figure 3C).

4.3. Distribution of c-Met Receptors

The mean number of immunohistochemistry spots was analyzed in the CA1 and CA3 hippocampal regions as well as in the somatosensory cortex (Figure 4A and B).
Immunohistochemistry results of cortical and hippocampal c-Met receptor distribution. A, Photomicrographs of c-Met-labeled cells (magnification: 200X); B, The bar graph shows the quantitative results of c-Met-labeled cells. Values have been indicated as means ± SEM (the symbols of *, ** and *** indicated P &lt; 0.05, P &lt; 0.01 and P &lt; 0.001).
Figure 4.

Immunohistochemistry results of cortical and hippocampal c-Met receptor distribution. A, Photomicrographs of c-Met-labeled cells (magnification: 200X); B, The bar graph shows the quantitative results of c-Met-labeled cells. Values have been indicated as means ± SEM (the symbols of *, ** and *** indicated P < 0.05, P < 0.01 and P < 0.001).

As for the CA1 area, the expression of c-Met receptors in the two- and six-month-old WAG/Rij rats, as well as in the six-month-old Wistar rats, was significantly lower than that in two-month-old Wistar rats (P < 0.001). The c-Met distribution reduced significantly in the six-month-old Wistar (P < 0.01) and WAG/Rij rats (P < 0.05) compared to the two-month-old WAG/Rij rats. The mean number of reacted cells/mm2 was 0.5 ± 0.025 and 0.28 ± 0.02 in two-month-old Wistar and WAG/Rij rats, and it was 0.16 ± 0.01 and 0.19 ± 0.01 in six-month-old Wistar and WAG/Rij rats, respectively.
As for the CA3 area, the expression of c-Met receptors in the two-month-old WAG/Rij rats was significantly lower than that in the two-month-old Wistar rats (P < 0.05). The c-Met distribution remarkably reduced in the six-month-old Wistar and WAG/Rij rats in comparison to the two-month-old WAG/Rij rats (P < 0.001). Furthermore, the c-Met receptors were significantly less-expressed in the CA3 area of six-month-old WAG/Rij rats compared to the same-age Wistar rats (P < 0.05). The mean number of reacted cells/mm2 was 0.36 ± 0.008 and 0.32 ± 0.009 in the two-month-old Wistar and WAG/Rij rats, and it was 0.18 ± 0.005 and 0.01 ± 0.009 in the six-month-old Wistar and WAG/Rij rats, respectively.
The expression of c-Met receptors in the internal granular layer of the cortex of the two- and six-month-old WAG/Rij rats and six-month-old Wistar rats was significantly lower than that in the internal granular layer of the cortex of the two-month-old Wistar group (P < 0.001). In addition, the c-Met receptors were significantly less-expressed in six-month-old WAG/Rij rats compared to the group of six-month-old Wistar and two-month-old WAG/Rij (P < 0.001). The mean number of reacted cells/mm2 was 0.52 ± 0.03 and 0.21 ± 0.01 in the two-month-old Wistar and WAG/Rij rats, and it was 0.23 ± 0.005 and 0.059 ± 0.006 in the six-month-old Wistar and WAG/Rij rats, respectively.
The expression of c-Met receptors in the external granular layer of the cortex of the two- and six-month-old WAG/Rij rats as well as the six-month-old Wistar rats, was significantly lower than that in the external granular layer of the cortex of the two-month-old Wistar rats (P < 0.001). The c-Met receptors reduction was also significant in the six-month-old WAG/Rij rats compared to six-month-old Wistar rats (P < 0.001). The mean number of reacted cells/mm2 was 0.30 ± 0.02 and 0.10 ± 0.007 in two-month-old Wistar and WAG/Rij rats, and it was 0.15 ± 0.01 and 0.055 ± 0.01 in six-month-old Wistar and WAG/Rij rats, respectively.

5. Discussion

Our study findings revealed that the gene and protein expressions of both hippocampal and cortical c-Met receptors were significantly lower in WAG/Rij rats compared to Wistar rats. Our findings also showed that the gene expression and protein level of the c-Met receptor in the epileptic rats decreased as their age increased. The WAG/Rij rat is a naturally occurring genetic model that is widely used for absence epilepsy investigations (15). Electrophysiological records and behavioural tests clearly show absent seizures in each member of WAG/Rij rats. SWPs begin to appear on the cortical records of the two-month-old WAG/Rij rats, and their duration and frequency increase with age (16). The somatosensory cortex has an important role in triggering and generating of SWPs (17). The somatosensory cortex has typically six layers. The most superficial of them is layer one (next to the brain surface), and the deepest is layer six. The sensory signals first go into the neural layer four and then spread into more superficial and deeper layers of the cortex. The processed signals are dispatched to the thalamus from the deepest layer (i.e., layer six). These signals are involved in set-out the excitation of thalamic nuclei (12, 18).
Electrocorticographic (ECoG) analysis of the WAG/Rij rats has indicated that SWPs are initiated in the underside layers of the primary neocortex and, from there quickly spread to motor cortices and thalamic nuclei (19, 20). Deep layers of the somatosensory cortex display ictogenic properties known to have depolarized membrane potential leading to hyperexcitability, fast activation, and hyper synchronization in the absence seizures (4, 21). During SWPs, moreover, enhanced synchronization and functional connectivity between the hippocampus and thalamocortical network have been reported in WAG/Rij rats. The hippocampus is involved in absence seizures through thalamocortical activity (22-24).
Previous studies in WAG/Rij rats reported progressive changes in the duration and frequency of SWPs in adult animals (25), associated with alteration in the density of different ligand and voltage-gated ion channels in the somatosensory cortex (26-28).
The c-Met is a tyrosine kinase transmembrane receptor, and HGF (hepatocyte growth factor) is its known ligand. These potent signaling molecules have key roles in many neurodevelopmental and neuroplasticity aspects. C-Met receptors are distributed in several brain regions including neurons of the olfactory bulb, cerebral cortex, hippocampus, amygdala, and cerebellum (29). The extensive expression of c-Met receptors has been found in inhibitory interneurons of the cortex (30). The critical role of c-Met receptors in cortical neural circuit formation and brain development has also been reported. C-Met receptors help radial glia aliveness and normal migration of neurons in the cerebral cortex and cerebellum during brain development (7). These receptors participate in regulating the direction of movement of GABAergic interneurons from the originating sites (the ganglionic eminence) to the neocortex, where they then differentiate and function (31). Impaired migration of inhibitory interneurons from the ganglionic eminences to the neocortex leads to hyperexcitability and a tendency to seizures (32).
Comprehension of the role of c-Met receptors in the development of circuits or synaptic function might have a critical role in understanding the etiology of epilepsy. HGF and c-Met promote neurite outgrowth and dendritic maturation during the differentiation of hippocampal neurons, as well as stimulate dendrite arborization, regulate spines size in mature neurons, and guide axons to their targets (33-35). Moreover, the role of c-Met receptors in the regulation of LTP (long-term potentiation) and increment of synaptic transmission of the entorhinal-hippocampal track has been documented (36). Therefore, alteration in c-Met receptor expression can impair synaptic plasticity and increase the susceptibility to seizures, as our results showed that c-Met receptor expression was lower in epileptic rats compared to Wistar rats.
More importantly, a disbalance in the release of glutamatergic excitatory and GABAergic inhibitory neurotransmitters is a chief etiology of absence seizure. An important role of c-Met receptors is to balance the excitatory and inhibitory neurotransmission in the cortex (8, 37). The cortex and hippocampus GABAergic interneurons express MET mRNAs (29, 38). These receptors regulate cellular properties associated with GABAergic interneurons (8). We observed that mutation in the activator of urokinase plasminogen receptor, an important agent for activation of HGF, decreased the expression of HGF, that was associated with a noticeable reduction in cortical GABAergic interneurons, the development of spontaneous seizures, and also increased sensitivity to pharmacologically induced seizures (39, 40).
According to our findings, c-Met gene and protein expression, as well as protein distribution, were lower in the two-month-old WAG/Rij rats compared to the same-age Wistar rats, and in six-month-old WAG/Rij rats compared to two-month-old ones. Previous studies showed that a decrease in c-Met activity during the development of WAG/Rij rats may have led to a deficiency in the inhibitory inputs of cortical neurons followed by a reduction in the release of GABA by cortical interneurons. Developmental reduction in the cortical c-Met signaling may have played a role in the appearance of SWP in the WAG/Rij rats.
Involvement of the hippocampus in absence seizures may contribute to cognitive impairment of patients with absence seizures (23). Cognitive dysfunctions (e.g., memory and attention impairment) due to alterations in signaling pathways and neuronal network dysfunction are common comorbidities that occur in epilepsy (41). Cognitive, emotional, and behavioral abnormalities have been reported in children with absence epilepsy (42, 43). Our previous studies documented the cognitive and memory impairments in epileptic WAG/Rij rats (5, 13). Seemingly, the reduced c-Met activity plays a role in memory and cognitive deficit in WAG/Rij rats. It has been shown that c-Met is capable of improving cognitive impairment in aged mice (44). The administration of HGF, the known ligand of the c-Met receptors, to kainate-induced epileptic model rats has been found to alleviate the seizure scores and improve learning and memory (45). Moreover, angiotensin IV (Ang IV) has been indicated to have anticonvulsant activity in seizure models (46). The beneficial effects of Ang IV on synaptic plasticity, memory improvement, and alleviation of seizures in animal models of epilepsy and cognitive deficits convinced the researchers to find a mechanism for these effects; therefore, several studies were conducted, and the results revealed that the biological actions of Ang IV were related to interaction with HGF and subsequently regulation of c-Met activity (44). c-MET is a high-affinity binding site mediating the biological effects of angiotensin IV (47).
In sum, our study results demonstrated that the gene and protein expression as well as the protein distribution of the c-Met receptor in the somatosensory cortex and hippocampus were inversely associated with the development of epileptic seizures. The above-mentioned studies partially explain how activation of c-MET may account for its anticonvulsive and anti-epileptogenic effects. Clarifying these mechanisms may have effectively contributed to the establishment of novel strategies in the treatment of epilepsy.

Acknowledgments

Footnotes

  • Authors' Contribution: Conception and design of research, Fariba Karimzadeh; Administrative, technical, and material support, Samira Ghorbani, Fariba Karimzadeh and Mona Amiri; Performing of experiment and Acquisition of data, Mona Amiri and Fahime Zavvari; Analysis and interpretation of data, Fariba Karimzadeh and Hassan Hosseini Ravandi; Preparation of the manuscript, Fahime Zavvari; Critical revision of the manuscript for important intellectual content, Fariba Karimzadeh.

  • Conflict of Interests: This work was supported by a grant from the Iran University of Medical Sciences (96-01-117-30641) to Dr. Karimzadeh. The authors have no conflict of interest in this research.

  • Ethical Approval: Animal trials were performed based on the guidelines offered by the Ethical committee of Iran University of Medical Sciences, Tehran, Iran, and in accordance with Ethics in Animal Experiments (IR.IUMS.RFC.1396.30641).

  • Funding/Support: This study was supported by a grant from the Iran University of Medical Sciences (96-01-117-30641) to Dr. Karimzadeh.

References

  • 1.
    Studer F, Jarre G, Pouyatos B, Nemoz C, Brauer-Krisch E, Muzelle C, et al. Aberrant neuronal connectivity in the cortex drives generation of seizures in rat absence epilepsy. Brain. 2022;145(6):1978-91. [PubMed ID: 35141747]. https://doi.org/10.1093/brain/awab438.
  • 2.
    Lazarini-Lopes W, Campos-Rodriguez C, Palmer D, N'Gouemo P, Garcia-Cairasco N, Forcelli PA. Absence epilepsy in male and female WAG/Rij rats: A longitudinal EEG analysis of seizure expression. Epilepsy Res. 2021;176:106693. [PubMed ID: 34225231]. [PubMed Central ID: PMC8453043]. https://doi.org/10.1016/j.eplepsyres.2021.106693.
  • 3.
    Adotevi N, Su A, Peiris D, Hassan M, Leitch B. Altered Neurotransmitter Expression in the Corticothalamocortical Network of an Absence Epilepsy Model with impaired Feedforward Inhibition. Neuroscience. 2021;467:73-80. [PubMed ID: 34048799]. https://doi.org/10.1016/j.neuroscience.2021.05.024.
  • 4.
    Polack PO, Guillemain I, Hu E, Deransart C, Depaulis A, Charpier S. Deep layer somatosensory cortical neurons initiate spike-and-wave discharges in a genetic model of absence seizures. J Neurosci. 2007;27(24):6590-9. [PubMed ID: 17567820]. [PubMed Central ID: PMC6672429]. https://doi.org/10.1523/jneurosci.0753-07.2007.
  • 5.
    Karimzadeh F, Soleimani M, Mehdizadeh M, Jafarian M, Mohamadpour M, Kazemi H, et al. Diminution of the NMDA receptor NR2B subunit in cortical and subcortical areas of WAG/Rij rats. Synapse. 2013;67(12):839-46. [PubMed ID: 23754322]. https://doi.org/10.1002/syn.21687.
  • 6.
    Hughes JR. Absence seizures: a review of recent reports with new concepts. Epilepsy Behav. 2009;15(4):404-12. [PubMed ID: 19632158]. https://doi.org/10.1016/j.yebeh.2009.06.007.
  • 7.
    Harkany T, Keimpema E, Barabás K, Mulder J. Endocannabinoid functions controlling neuronal specification during brain development. Mol Cell Endocrinol. 2008;286(1-2 Suppl 1):S84-90. [PubMed ID: 18394789]. https://doi.org/10.1016/j.mce.2008.02.011.
  • 8.
    Kim YH, Back SK, Davies AJ, Jeong H, Jo HJ, Chung G, et al. TRPV1 in GABAergic interneurons mediates neuropathic mechanical allodynia and disinhibition of the nociceptive circuitry in the spinal cord. Neuron. 2012;74(4):640-7. [PubMed ID: 22632722]. https://doi.org/10.1016/j.neuron.2012.02.039.
  • 9.
    Fisher RS, Velasco AL. Electrical brain stimulation for epilepsy. Nat Rev Neurol. 2014;10(5):261-70. [PubMed ID: 24709892]. https://doi.org/10.1038/nrneurol.2014.59.
  • 10.
    Bhaskaran MD, Smith BN. Effects of TRPV1 activation on synaptic excitation in the dentate gyrus of a mouse model of temporal lobe epilepsy. Exp Neurol. 2010;223(2):529-36. [PubMed ID: 20144892]. [PubMed Central ID: PMC2864369]. https://doi.org/10.1016/j.expneurol.2010.01.021.
  • 11.
    Gibson HE, Edwards JG, Page RS, Van Hook MJ, Kauer JA. TRPV1 channels mediate long-term depression at synapses on hippocampal interneurons. Neuron. 2008;57(5):746-59. [PubMed ID: 18341994]. [PubMed Central ID: PMC2698707]. https://doi.org/10.1016/j.neuron.2007.12.027.
  • 12.
    Karimzadeh F, Modarres Mousavi SM, Ghadiri T, Jafarian M, Soleimani M, Sadeghi SM, et al. The Modulatory Effect of Metabotropic Glutamate Receptor Type-1α on Spike-Wave Discharges in WAG/Rij Rats. Mol Neurobiol. 2017;54(2):846-54. [PubMed ID: 26780454]. https://doi.org/10.1007/s12035-016-9692-x.
  • 13.
    Jafarian M, Karimzadeh F, Alipour F, Attari F, Lotfinia AA, Speckmann EJ, et al. Cognitive impairments and neuronal injury in different brain regions of a genetic rat model of absence epilepsy. Neuroscience. 2015;298:161-70. [PubMed ID: 25907443]. https://doi.org/10.1016/j.neuroscience.2015.04.033.
  • 14.
    Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol. 2004;5:3. [PubMed ID: 15040812]. [PubMed Central ID: PMC373448]. https://doi.org/10.1186/1471-2172-5-3.
  • 15.
    Coenen AM, Drinkenburg WH, Inoue M, van Luijtelaar EL. Genetic models of absence epilepsy, with emphasis on the WAG/Rij strain of rats. Epilepsy Res. 1992;12(2):75-86. [PubMed ID: 1396543]. https://doi.org/10.1016/0920-1211(92)90029-s.
  • 16.
    Coenen AM, Van Luijtelaar EL. Genetic animal models for absence epilepsy: a review of the WAG/Rij strain of rats. Behav Genet. 2003;33(6):635-55. [PubMed ID: 14574120]. https://doi.org/10.1023/a:1026179013847.
  • 17.
    Akyuz E, Ozenen C, Pinyazhko OR, Poshyvak OB, Godlevsky LS. Cerebellar contribution to absence epilepsy. Neurosci Lett. 2021;761:136110. [PubMed ID: 34256107]. https://doi.org/10.1016/j.neulet.2021.136110.
  • 18.
    Kaas JH. The functional organization of somatosensory cortex in primates. Ann Anat. 1993;175(6):509-18. [PubMed ID: 8297039]. https://doi.org/10.1016/s0940-9602(11)80212-8.
  • 19.
    Polack PO, Mahon S, Chavez M, Charpier S. Inactivation of the somatosensory cortex prevents paroxysmal oscillations in cortical and related thalamic neurons in a genetic model of absence epilepsy. Cereb Cortex. 2009;19(9):2078-91. [PubMed ID: 19276326]. https://doi.org/10.1093/cercor/bhn237.
  • 20.
    Demjan M. Automatic Spike-Wave discharge detection within EEG of mice models of human absence epilepsy [master's thesis]. Finland: Itä-Suomen yliopisto; 2020.
  • 21.
    Williams MS, Altwegg-Boussac T, Chavez M, Lecas S, Mahon S, Charpier S. Integrative properties and transfer function of cortical neurons initiating absence seizures in a rat genetic model. J Physiol. 2016;594(22):6733-51. [PubMed ID: 27311433]. [PubMed Central ID: PMC5108890]. https://doi.org/10.1113/jp272162.
  • 22.
    Arcaro J, Ma J, Chu L, Kuo M, Mirsattari SM, Stan Leung L. The hippocampus participates in a pharmacological rat model of absence seizures. Epilepsy Res. 2016;120:79-90. [PubMed ID: 26773250]. [PubMed Central ID: PMC4942264]. https://doi.org/10.1016/j.eplepsyres.2015.12.007.
  • 23.
    Mousavi SR, Arcaro JA, Leung LS, Tenney JR, Mirsattari SM. Functional connectivity of the hippocampus to the thalamocortical circuitry in an animal model of absence seizures. Epilepsy Res. 2017;137:19-24. [PubMed ID: 28886474]. https://doi.org/10.1016/j.eplepsyres.2017.08.004.
  • 24.
    Papp P, Kovács Z, Szocsics P, Juhász G, Maglóczky Z. Alterations in hippocampal and cortical densities of functionally different interneurons in rat models of absence epilepsy. Epilepsy Res. 2018;145:40-50. [PubMed ID: 29885592]. https://doi.org/10.1016/j.eplepsyres.2018.05.013.
  • 25.
    Depaulis A, van Luijtelaar G. Genetic Models of Absence Epilepsy in the Rat. In: Pitkänen A, Schwartzkroin PA, Moshé SL, editors. Models of Seizures and Epilepsy. Massachusetts, USA: Academic Press; 2006. p. 233-48. https://doi.org/10.1016/b978-012088554-1/50020-7.
  • 26.
    Klein JP, Khera DS, Nersesyan H, Kimchi EY, Waxman SG, Blumenfeld H. Dysregulation of sodium channel expression in cortical neurons in a rodent model of absence epilepsy. Brain Res. 2004;1000(1-2):102-9. [PubMed ID: 15053958]. https://doi.org/10.1016/j.brainres.2003.11.051.
  • 27.
    Kole MH, Bräuer AU, Stuart GJ. Inherited cortical HCN1 channel loss amplifies dendritic calcium electrogenesis and burst firing in a rat absence epilepsy model. J Physiol. 2007;578(Pt 2):507-25. [PubMed ID: 17095562]. [PubMed Central ID: PMC2075144]. https://doi.org/10.1113/jphysiol.2006.122028.
  • 28.
    Zavvari F, Modarres Mousavi SM, Ejlali M, Barfi S, Karimzadeh F. Glutamate Signaling Pathway in Absence Epilepsy: Possible Role of Ionotropic AMPA Glutamate Receptor Type 1 Subunit. Iran J Pharm Res. 2020;19(4):410-8. [PubMed ID: 33841553]. [PubMed Central ID: PMC8019882]. https://doi.org/10.22037/ijpr.2020.112638.13869.
  • 29.
    Honda S, Kagoshima M, Wanaka A, Tohyama M, Matsumoto K, Nakamura T. Localization and functional coupling of HGF and c-Met/HGF receptor in rat brain: implication as neurotrophic factor. Brain Res Mol Brain Res. 1995;32(2):197-210. [PubMed ID: 7500831]. https://doi.org/10.1016/0169-328x(95)00075-4.
  • 30.
    Cristino L, de Petrocellis L, Pryce G, Baker D, Guglielmotti V, Di Marzo V. Immunohistochemical localization of cannabinoid type 1 and vanilloid transient receptor potential vanilloid type 1 receptors in the mouse brain. Neuroscience. 2006;139(4):1405-15. [PubMed ID: 16603318]. https://doi.org/10.1016/j.neuroscience.2006.02.074.
  • 31.
    Kelsom C, Lu W. Development and specification of GABAergic cortical interneurons. Cell Biosci. 2013;3(1):19. [PubMed ID: 23618463]. [PubMed Central ID: PMC3668182]. https://doi.org/10.1186/2045-3701-3-19.
  • 32.
    Marsh ED, Nasrallah MP, Walsh C, Murray KA, Nicole Sunnen C, McCoy A, et al. Developmental interneuron subtype deficits after targeted loss of Arx. BMC Neurosci. 2016;17(1):35. [PubMed ID: 27287386]. [PubMed Central ID: PMC4902966]. https://doi.org/10.1186/s12868-016-0265-8.
  • 33.
    Lim CS, Walikonis RS. Hepatocyte growth factor and c-Met promote dendritic maturation during hippocampal neuron differentiation via the Akt pathway. Cell Signal. 2008;20(5):825-35. [PubMed ID: 18262389]. [PubMed Central ID: PMC2302788]. https://doi.org/10.1016/j.cellsig.2007.12.013.
  • 34.
    Tyndall SJ, Walikonis RS. Signaling by hepatocyte growth factor in neurons is induced by pharmacological stimulation of synaptic activity. Synapse. 2007;61(4):199-204. [PubMed ID: 17230549]. https://doi.org/10.1002/syn.20362.
  • 35.
    Gutierrez H, Dolcet X, Tolcos M, Davies A. HGF regulates the development of cortical pyramidal dendrites. Development. 2004;131(15):3717-26. [PubMed ID: 15229174]. https://doi.org/10.1242/dev.01209.
  • 36.
    Goswami C, Rademacher N, Smalla KH, Kalscheuer V, Ropers HH, Gundelfinger ED, et al. TRPV1 acts as a synaptic protein and regulates vesicle recycling. J Cell Sci. 2010;123(Pt 12):2045-57. [PubMed ID: 20483957]. https://doi.org/10.1242/jcs.065144.
  • 37.
    Marinelli S, Di Marzo V, Berretta N, Matias I, Maccarrone M, Bernardi G, et al. Presynaptic facilitation of glutamatergic synapses to dopaminergic neurons of the rat substantia nigra by endogenous stimulation of vanilloid receptors. J Neurosci. 2003;23(8):3136-44. [PubMed ID: 12716921]. [PubMed Central ID: PMC6742307]. https://doi.org/10.1523/jneurosci.23-08-03136.2003.
  • 38.
    Braz JM, Juarez-Salinas D, Ross SE, Basbaum AI. Transplant restoration of spinal cord inhibitory controls ameliorates neuropathic itch. J Clin Invest. 2014;124(8):3612-6. [PubMed ID: 25003193]. [PubMed Central ID: PMC4109547]. https://doi.org/10.1172/jci75214.
  • 39.
    Powell EM, Campbell DB, Stanwood GD, Davis C, Noebels JL, Levitt P. Transplant restoration of spinal cord inhibitory controls ameliorates neuropathic itch. J Clin Invest. 2014;124(8):3612-6. [PubMed ID: 25003193]. [PubMed Central ID: PMC4109547]. https://doi.org/10.1172/jci75214.
  • 40.
    Levitt P. Disruption of interneuron development. Epilepsia. 2005;46 Suppl 7:22-8. [PubMed ID: 16201992]. https://doi.org/10.1111/j.1528-1167.2005.00305.x.
  • 41.
    Holmes GL. Cognitive impairment in epilepsy: the role of network abnormalities. Epileptic Disord. 2015;17(2):101-16. [PubMed ID: 25905906]. [PubMed Central ID: PMC5410366]. https://doi.org/10.1684/epd.2015.0739.
  • 42.
    Caplan R, Siddarth P, Stahl L, Lanphier E, Vona P, Gurbani S, et al. Childhood absence epilepsy: behavioral, cognitive, and linguistic comorbidities. Epilepsia. 2008;49(11):1838-46. [PubMed ID: 18557780]. https://doi.org/10.1111/j.1528-1167.2008.01680.x.
  • 43.
    Masur D, Shinnar S, Cnaan A, Shinnar RC, Clark P, Wang J, et al. Pretreatment cognitive deficits and treatment effects on attention in childhood absence epilepsy. Neurology. 2013;81(18):1572-80. [PubMed ID: 24089388]. [PubMed Central ID: PMC3806916]. https://doi.org/10.1212/WNL.0b013e3182a9f3ca.
  • 44.
    Benoist CC, Kawas LH, Zhu M, Tyson KA, Stillmaker L, Appleyard SM, et al. The procognitive and synaptogenic effects of angiotensin IV-derived peptides are dependent on activation of the hepatocyte growth factor/c-met system. J Pharmacol Exp Ther. 2014;351(2):390-402. [PubMed ID: 25187433]. [PubMed Central ID: PMC4201273]. https://doi.org/10.1124/jpet.114.218735.
  • 45.
    Jamali-Raoufi N, Haghani S, Roghani M, Fahanik-Babaei J, Baluchnejadmojarad T. The effect of hepatocyte growth factor on learning and memory abilities in a rat model of kainate-induced epilepsy. J Basic Clin Physiol. 2017;5(2):15-20.
  • 46.
    Tchekalarova J, Georgiev V. Angiotensin peptides modulatory system: how is it implicated in the control of seizure susceptibility? Life Sci. 2005;76(9):955-70. [PubMed ID: 15607326]. https://doi.org/10.1016/j.lfs.2004.10.012.
  • 47.
    Wright JW, Yamamoto BJ, Harding JW. Angiotensin receptor subtype mediated physiologies and behaviors: new discoveries and clinical targets. Prog Neurobiol. 2008;84(2):157-81. [PubMed ID: 18160199]. [PubMed Central ID: PMC2276843]. https://doi.org/10.1016/j.pneurobio.2007.10.009.

Copyright

Copyright © 2023, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

31
Oct
2020

Glutamate Signaling Pathway in Absence Epilepsy: Possible Role of Ionotropic AMPA Glutamate Receptor Type 1 Subunit

Fahime Zavvari,
Sayed Mostafa Modarres Mousavi,
Maryam Ejlali,
Shahram Barfi,
Fariba Karimzadeh

Zavvari F, Modarres Mousavi SM, Ejlali M, Barfi S, Karimzadeh F. Glutamate Signaling Pathway in Absence Epilepsy: Possible Role of Ionotropic AMPA Glutamate Receptor Type 1 Subunit. Iran J Pharm Res. 2020;19(4):e124665. doi: https://doi.org/10.22037/ijpr.2020.112638.13869

1
Oct
2014

Expressional Analysis of Inwardly Rectifying Kir4.1 Channels in Groggy Rats, a Rat Model of Absence Seizures

Yuya Harada,
Yuki Nagao,
Takahiro Mukai,
Saki Shimizu,
Kentaro Tokudome,
Naofumi Kunisawa
,et al.

Harada Y, Nagao Y, Mukai T, Shimizu S, Tokudome K, et al. Expressional Analysis of Inwardly Rectifying Kir4.1 Channels in Groggy Rats, a Rat Model of Absence Seizures. Arch Neurosci. 2014;1(3):e18651. doi: https://doi.org/10.5812/archneurosci.18651

23
Mar
2009

The role of GABAA receptor activity in post-ictal depression period in a rat kindling model of epilepsy

Javad Mirnajafi,
Vahid Shibani,
MohammadReza PalizVan,
Mehdi Sadegh,
Tahereh Zeynali

Mirnajafi J, Shibani V, PalizVan M, Sadegh M, Zeynali T. The role of GABAA receptor activity in post-ictal depression period in a rat kindling model of epilepsy. koomesh. 2009;10(2):e152224. doi:

6
Jul
2021

Altered expression of orexin 1 and endocannabinoid 1 receptors of the hippocampus in three pentylenetetrazol, pilocarpine and kainate seizure models

Giti Nasudi,
Mahmoud Elahdadi Salmani Elahdadi Salmani,
Narges Hosseinmardi,
Taghi Lashkarbolouki,
Iran Goudarzi,
Farshad Moradpour

Nasudi G, Elahdadi Salmani MES, Hosseinmardi N, Lashkarbolouki T, Goudarzi I, et al. Altered expression of orexin 1 and endocannabinoid 1 receptors of the hippocampus in three pentylenetetrazol, pilocarpine and kainate seizure models. koomesh. 2021;23(2):e153264. doi:

31
Oct
2016

Creatine Revealed Anticonvulsant Properties on Chemically and Electrically Induced Seizures in Mice

Hamed Shafaroodi,
Farnaz Shahbek,
Mehrdad Faizi,
Farzad Ebrahimi,
Leila Moezi

Shafaroodi H, Shahbek F, Faizi M, Ebrahimi F, Moezi L. Creatine Revealed Anticonvulsant Properties on Chemically and Electrically Induced Seizures in Mice. Iran J Pharm Res. 2016;15(4):e125214. doi: https://doi.org/10.22037/ijpr.2016.1943

Download PDF6.84 MB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles