Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran

Author(s):
Mohammad Mehdi Soltan-DallalMohammad Mehdi Soltan-Dallal1, 2, Mohsen Karami-TalabMohsen Karami-Talab1, Maneli AminshahidiManeli Aminshahidi3, Amir ArastehfarAmir Arastehfar3, Fereshteh FaniFereshteh FaniFereshteh Fani ORCID3,*
1Division of Food Microbiology, Department of Pathobiology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran
2Food Microbiology Research Center, Tehran University of Medical Sciences, Tehran, Iran
3Professor Alborzi Clinical Microbiology Research Center, Faculty of Medicine, Shiraz University of Medical Sciences, Fars, Iran

Archives of Pediatric Infectious Diseases:Vol. 6, issue 2; e11917
Published online:Mar 12, 2018
Article type:Research Article
Received:Dec 18, 2016
Accepted:Jul 01, 2017
How to Cite:Soltan-Dallal MM, Karami-Talab M, Aminshahidi M, Arastehfar A, Fani F. Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran. Arch Pediatr Infect Dis. 2018;6(2):e11917. doi: https://doi.org/10.5812/pedinfect.11917

Abstract

Background:

Acute diarrhea, a leading cause of morbidity and mortality worldwide, still remains a major global health problem, especially among children in the developing countries. Diarrheagenic E. coli represent one of the most common etiological causes of diarrhea in children worldwide.

Objectives:

This study was conducted in order to determine the rate of Enteroaggregative E. coli (EAEC) among 50 E. coli isolates as well as its antimicrobial resistance patterns.

Methods:

A total of 50 Escherichia coli strains had been isolated among children under 5 years of age during 75 reported outbreaks in various provinces of Iran from October 2013 to May 2014. PCR was employed for the identification of different groups of diarrheagenic E. coli. Antimicrobial susceptibility testing was performed using disc diffusion methods. In addition, extended spectrum beta-lactamase (ESBL) production ability was checked by way of combination disc methods of CLSI. Minimum inhibitory concentration of cefotaxime, ceftriaxone, and ceftazidime in EAEC with the ability of ESBL production was determined using the micro-broth dilution method of CLSI.

Results:

Out of the 50 E. coli isolates, 17 were identified as Enteroaggregative E. coli (EAEC) in that they were positive for at least 1 of the 2 tested virulent genes: agg and aap. ESBL production ability was observed in 4/17 (23.5%) EAEC isolates. MIC of cefotaxime and ceftriaxone in ESBL positive EAEC varied between 8 - 32 µg/mL and 8 - 64 µg/mL, respectively. Resistance to ampicillin and nalidixic-acid (47.1%), trimethoprim/sulfamethoxazole (41.2%), and ciprofloxacin (11.8%) was observed among the EAEC isolates. No evidence of resistance to gentamycin and meropenem was detected.

Conclusions:

This research has revealed that the most common type of diarrheagenic E. coli among children, who were affected in the diarrheal outbreak in different cities of the country, is Enteroaggregative E. coli (34%). The rate of ESBL positive cases in EAEC isolates were 23.5 %.

1. Background

Diarrhea in children remains an important public health concern in developing countries. It accounts for over 80% of diseases in Africa and South Asia (1). Escherichia coli (E. coli) are the predominant commensal organism found in the human intestine. However, some strains of E. coli have acquired specific virulence factors and have developed the ability to cause a variety of diseases in the gastrointestinal tract, urinary, as well as central nervous system (2, 3). Diarrheagenic E. coli represent 1 of the most common etiological causes of community-acquired diarrhea in children worldwide (1, 4). Among the E. coli that cause diarrhea, there are at least 6 well-described groups, each corresponding to a distinct clinical syndrome with distinct epidemiological and pathologic schemes. Enteroaggregative E. coli was first discovered in 1987 by Nataro and his colleagues (5) and was commonly recognized as a cause of endemic and epidemic diarrhea worldwide (6, 7). Diarrhea caused by this diarrheagenic E. coli is often watery, but could also be accompanied by mucous and blood (4, 5). Enteroaggregative E. coli is identified by the presence of the known virulence genes including an enteroaggregative heat stable toxin (astA), a transcriptional activator (aggR), and a dispersin secretory protein (aap) (2, 8).
Since the laboratories cannot differentiate diarrheagenic E. coli from the non-pathogenic E. coli, which resides in the intestine as a normal flora, we made use of multiplex PCR based on virulence gene detection (2, 5). In this study we report the rate of EAEC among 50 E. coli strains, which had been isolated from children under 5 years of age during 75 reported outbreaks from October 2013 to May 2014. We also report the antimicrobial resistance patterns among EAEC isolates.

2. Methods

The department of pathobiology in Tehran University of Medical Sciences, school of public health, Iran, has been involved in finding the causative factors for the various diarrheal outbreaks in the country. When 2 or more individuals present similar symptoms and experience a similar illness after the ingestion of common food or water, this is considered a case of foodborne outbreak.
Between October 2013 to May 2014, after province and local health departments reported outbreaks to the National Institute of Health (NIH) of Iran, rectal-swab samples are either transported to the referral laboratory of the NIH immediately or placed into a transport medium and analyzed for the presence of bacteria by standard culture methods. A total of 300 patients (184 males and 116 females, aged between 1 and 60 years) were enrolled in this study. Initially, all the colonies suspected of E. coli from MacConkey agar were identified by standard biochemical tests. API 20E (Biomerieux, France) was performed for confirmation. Several enteric pathogens other than E. coli (e.g. Shigella, Salmonella) were isolated during the out-breaks. However, since the focus of the study was on the 50 strains of E. coli, only these (Table 1) were sent to professor Alborzi clinical microbiology research center in Shiraz, Fars, for further study. They were then examined by PCR to identify any Enteroaggregative E. coli.
Table 1.Number of E. coli and EAEC Strains According to Province and Age Categories of Casesa
ProvinceAge Categories, moNo. of E. coli (No. of EAEC, rateb)
0 - 1112 - 2324 - 3536 - 4748 - 5960 - 79
Tehran4 (2)2 (0)3 (1)0 (0)2 (1)1 (0)12 (4, 23.5)
Alborz2 (1)1 (0)0 (0)1 (1)0 (0)0 (0)4 (2, 11.8)
Yazd0 (0)6 (0)1 (0)4 (2)1 (1)0 (0)12 (3, 17.7)
Hamadan1 (1)1 (0)1 (0)0 (0)1 (0)1 (1)5 (2, 11.8)
Kurdistan2 (1)1 (0)1 (0)1 (0)0 (0)0 (0)5 (1, 5.8)
Mazandaran0 (0)1 (1)3 (1)0 (0)1 (0)0 (0)5 (2, 11.8)
Semnan0 (0)0 (0)2 (1)0 (0)1 (1)0 (0)3 (2, 11.8)
Zanjan2 (1)0 (0)0 (0)0 (0)0 (0)0 (0)2 (1, 5.8)
Hormozgan0 (0)1 (0)0 (0)0 (0)0 (0)0 (0)1 (0)
Qazvin0 (0)0 (0)1 (0)0 (0)0 (0)0 (0)1 (0)
No. of E. coli (No. of EAEC, rateb)11 (5, 29.3)13 (2, 11.8)12 (3, 17.7)6 (3, 17.7)6 (3, 17.7)2 (1, 5.8)50 (17, 100%)

aIn each box the number of E. coli strains is indicated in the 1st row and the number of strains identified as EAEC is indicated in bold in 2nd row.

bThe rate of EAEC in each category in all the EAEC cases (17 strains) is indicated.

2.1. Polymerase Chain Reaction to Detect Enteroaggregative E. coli Virulence Genes

In order to identify Enteroaggregative E. coli, the associated specific primers aggR and aap were used. The DNA was extracted using PEG-200 alkaline buffer (8). PCR amplification was performed using the primers aggR-F (GTATACACAAAAGAAGGAAGC) as well as aggR-R (ACAGAATCGTCAGCATCAGC) to generate a fragment of 254-bp (9) and the primers aap-F (GGCATCTTGGGTATCAGCCTG) as well as aap-R (CCCATTCGGTTAGAGCACTATATT) to generate a 313-bp fragment (designed specifically for this study). PCR reaction was performed in the final volume of 50 µL including a 5 µL PCR buffer (Thermo scientific, Maxima Hot Start Taq DNA polymerase, EP0602), 2.5 mM of MgCl2 (Thermo scientific, Maxima Hot Start Taq DNA polymerase, EP0602), 0.4 ng of mixed dNTP (Thermo scientific, R0192), 15 picomol of each primer (Bioneer, South Korea), 2.5 units of Taq polymerase (Thermo scientific, Maxima Hot Start Taq DNA polymerase, EP0602), and 2 µL of template. The solutions were then subjected to the following cycling condition: 94°C for 5 minutes, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds (35 cycles), and a final extension step (72°C for 8 minutes) in a thermal cycler (Applied Biosystem, Veriti). Subsequently, 8 µL of PCR product was subjected to gel electrophoresis (Biorad, Wide mini-sub® Cell GT) consisting of 1.5% Agarose (Invitrogen, 16500), stained using GelRed Nucleic Acid Gel Stain (Biotium, 41002), and visualized by gel documentation (UVItec, DBT-08). Positive control with genomic DNA from E. coli containing pCVD432 (aggR+, aap+) was made use of in the PCR reactions. E. coli strains that were positive for aggR or/and aap genes were interpreted as EAEC.

2.2. Antimicrobial Susceptibility Testing

Antibiotic susceptibility was determined using the Kirby Bauer disc diffusion method to the following commercially available antibiotics (Rosco Neo-Sensitabs Denmark): cefotaxime (30 µg), ceftriaxone (30 µg), ceftazidime (30 µg), ampicillin (10 µg), trimethoprim/sulfamethoxazole (25 µg), gentamicin (10 µg), ciprofloxacin (5 µg), meropenem (10 µg), and nalidixic acid (30 µg) following the CLSI 2014 guidelines. Furthermore, a minimum of 2 independent experiments were conducted to identify the resistant phenotype of the isolated pathogen against each antibiotic.

2.3. Extended Spectrum Beta-Lactamase Production (ESBL) Detection

Isolates with resistance to cefotaxime or ceftazidime were screened for ESBL production through the combination disc method of CLSI, using cefotaxime and ceftazidime along with the discs to which clavulanic acid had been added. Zone diameters were determined using the HiAntibiotic zone scale (Himedia). A ≥ 5 mm increase in the zone diameter for both of the antimicrobial agents were tested in combination with clavulanate, versus the zone diameter of the agents when tested alone, which were considered as positive for ESBL production. MIC was performed through the micro-broth dilution method on the ESBL positive isolates using the following antibiotics: cefotaxime, ceftriaxone, and ceftazidime (Sigma).

3. Results

During the study period, October 2013 to May 2014, 10 provinces reported 75 outbreaks of foodborne illnesses. A total of 50 culture-confirmed cases of E. coli were isolated. Among the 50 E. coli isolates, the PCR detected 17 EAEC, representing 34% of all the cases. Table 1 illustrates the age distribution for children from whom E. coli and EAEC strains were isolated. Among those with EAEC, 9 and 7 isolates were positive for aggR and aap genes respectively. Only 1 EAEC isolate was positive for both of the virulence genes.
The results of the antimicrobial susceptibility testing of the 17 EAEC isolates to 9 antibiotics and of their ESBL screening are illustrated in Table 2. The highest rate of resistance was observed to ampicillin and nalidixic acid in 47.1% (8/17) of cases. Resistance to trimethoprim/sulfamethoxazole was detected in 41.2% (7/17) of cases. Resistance to cefotaxime and ceftriaxone was observed in 23.5% (4/17) of cases, while ceftazidime resistance was less than common (2/17, 11.8%). Resistance to ciprofloxacin was found in 2 (11.8%) of the isolates. There was no evidence of resistance to meropenem and gentamycin. The rate of ESBL positive cases in EAEC isolates was 23.5% (4/17). MIC of cefotaxime and ceftriaxone in ESBL positive EAEC was between 8 and 32 µg/mL and 8 and 64 µg/mL, respectively. MIC of ceftazidime in EAEC isolates varied between 4 and 8 µg/mL, still remaining in the susceptibility zone. Based on the results of the molecular method used for the detection of resistance genes, all the 4 EAEC isolates with the ability of ESBL production, turned to be positive only for CTX-M1 resistance gene from the 3 tested resistance genes: CTX-M1, SHV, and TEM genes (data not shown).
Table 2.Antibiotic Susceptibility Patterns of the EAEC Strainsa
Pathogens and ProvinceAntibiotics
AMPCTXCAZCROMRPSXTNALGMCIPESBL
EAEC1, TRSSSSRRSSNeg
EAEC2, TSSSSSSRSSNeg
EAEC3, MRRRRSRRSRPos
EAEC4, HRRRRSRSSSPos
EAEC5, ARRSRSRRSRPos
EAEC6, KSSSSSSSSSNeg
EAEC7, YSSSSSSSSSNeg
EAEC8, TSSSSSSSSSNeg
EAEC9, MSSSSSSSSSNeg
EAEC10,YSSSSSSSSSNeg
EAEC11, SSSSSSSSSSNeg
EAEC12, ZRRSRSRSSSPos
EAEC13, ASSSSSSRSSNeg
EAEC14, YSSSSSSSSSNeg
EAEC15, SRSSSSSRSSNeg
EAEC16, HRSSSSRRSSNeg
EAEC17, TRSSSSRRSSNeg
Total resistance (percentageb)8 (47.1)4 (23.5)2 (11.8)4 (23.5)0 (0)7 (41.2)8 (47.1)0 (0)2 (11.8)4 (23.5)

Abbreviations: A, Alborz; AMP, Ampicillin; CAZ, Ceftazidime; CIP, Ciprofloxacin; CRO, Ceftriaxone; CTX, Cefotaxime; EAEC: Enteroaggregative E. coli; ESBL, Extended -Spectrum Beta Lactamase; GM, Gentamycin; H, Hamadan; K, Kurdistan; M, Mazandaran; MRP, Meropenem; NAL, Nalidixic Acid; S, Semnan; SXT, Trimethoprim Sulfametaxazole; T, Tehran; Y, Yazd; Z, Zanjan.

aThe pattern of antibiotic susceptibility and ability of ESBL producing beta lactamase of EAEC isolates are shown in this Table.

bPercentage: percentage of resistant cases in total number of EAEC isolates.

4. Discussion

Enteroaggregative E. coli (EAEC) is a recently identified diarrheagenic E. coli that has been increasingly identified as a cause of acute and persistent diarrhea in both developed and developing countries (10). EAEC have been considered as a causative agent for diarrhea among sporadic cases across the country both in children and adults (11-15). The prevalence of EAEC among children with gastroenteritis was reported to be 18.2% in Tabriz (12). In another study carried out in Tehran, the prevalence of EAEC was reported 20% among children less than 5 years of age with acute diarrhea (11). This study has reported as a higher rate (i.e. as high as 34%) of EAEC among children compared to reports by other studies (11, 12); this is due to the fact that we have studied the cases of diarrheal outbreaks while others have looked at sporadic cases of gastroenteritis. Several outbreaks of gastroenteritis due to EAEC have been reported in Japan (16, 17), Korea (8), Italy (7), and UK (18). In 2015 our team, in professor Alborzi clinical microbiology research center has identified EAEC as a cause of gastroenteritis outbreak in Fars (south of Iran). However, the data has not been published yet.
A total of 17 EAEC isolated from 50 E. coli strains were tested in this research. A total of 94% of E. coli isolates that have been identified as EAEC in this study were positive for aggR or aap virulence genes. In Hamadan, Iran, Aslani et al., (11) used the pCVD432 gene as a sole common indicator for the molecular detection of EAEC and then checked the prevalence of 5 other virulence genes including aap, aggR, aafA, astA, aggA among the EAEC isolates. A total of 80% of the EAEC were positive for at least the aap, aggR genes, which could be considered as the most common virulence indicator for the detection of EAEC.
As shown in Table 2, the highest level of antibiotics resistance was observed to ampicillin and nalidixic acid (47.1%) and to trimethoprim-sulfamethoxazole (41.2%) among EAEC strains. Based on the results presented in this research, ciprofloxacin and ceftriaxone seem to be more effective against EAEC. Since the prescription of fluroquinolones to children is limited due to the arthropathy observed in juvenile animals (19), ceftriaxone could be a more suitable choice for the treatment of diarrhea caused by EAEC in the country. However, considering the 23.5% ESBL production ability observed among the EAEC, the prescription of third-generation cephalosporins in the treatment of diarrhea in children should be controlled. In the ESBL positive cases, ceftazidime resistance was observed less frequently in comparison to cefotaxime and ceftriaxone (Table 2). This can be accounted for by the fact that there are different Beta lactamses in terms of genotypes with different hydrolysis activities in the presence of different types of cephalosporins.
Although the levels of antimicrobial resistance among the EAEC remain high in the country (13, 14, 20), the resistance patterns are varied in different regions. Local information on antimicrobial resistance patterns should be updated regularly in order to adopt the most appropriate empirical course of treatment.

4.1. Conclusions

In conclusion, this research has revealed that the rate of EAEC among children in diarrheal outbreak is as high as 34%, indicating that 1/3 of E. coli strains, which are routinely reported as normal flora in patients with diarrhea, could in fact be EAEC. Therefore, the identification of E. coli strains at a patho-group level in diarrhea cases using PCR methods is needed to go over the research domain and it is necessary to consider it as part of the routine tests in microbiology labs.

Acknowledgments

Footnotes

References

  • 1.
    Nascimento DSF, Oenning Martins AL, Schuelter-Trevisol F. Incidence of acute diarrhea among children aged 0 - 1 year in Southern Brazil, 2012. Arch Pediatr Infect Dis. 2015;3(4). https://doi.org/10.5812/pedinfect.28054.
  • 2.
    Gomes TA, Elias WP, Scaletsky IC, Guth BE, Rodrigues JF, Piazza RM, et al. Diarrheagenic Escherichia coli. Braz J Microbiol. 2016;47 Suppl 1:3-30. [PubMed ID: 27866935]. https://doi.org/10.1016/j.bjm.2016.10.015.
  • 3.
    Weintraub A. Enteroaggregative Escherichia coli: epidemiology, virulence and detection. J Med Microbiol. 2007;56(Pt 1):4-8. [PubMed ID: 17172509]. https://doi.org/10.1099/jmm.0.46930-0.
  • 4.
    Nezarieh R, Shakibaie MR, Hosseini Nave H, Norouzi A, Salajegheh G, Hayatbakhsh M. Distribution of virulence genes, enterotoxin and biofilm formation among enteroaggregative Escherichia coli (EAEC) strains isolated from stools of children with diarrhea in South East Iran. Arch Pediatr Infect Dis. 2015;3(3). https://doi.org/10.5812/pedinfect.29745v2.
  • 5.
    Jafari A, Aslani MM, Bouzari S. Escherichia coli: a brief review of diarrheagenic pathotypes and their role in diarrheal diseases in Iran. Iran J Microbiol. 2012;4(3):102-17. [PubMed ID: 23066484].
  • 6.
    Huang DB, Nataro JP, DuPont HL, Kamat PP, Mhatre AD, Okhuysen PC, et al. Enteroaggregative Escherichia coli is a cause of acute diarrheal illness: a meta-analysis. Clin Infect Dis. 2006;43(5):556-63. [PubMed ID: 16886146]. https://doi.org/10.1086/505869.
  • 7.
    Scavia G, Staffolani M, Fisichella S, Striano G, Colletta S, Ferri G, et al. Enteroaggregative Escherichia coli associated with a foodborne outbreak of gastroenteritis. J Med Microbiol. 2008;57(Pt 9):1141-6. [PubMed ID: 18719185]. https://doi.org/10.1099/jmm.0.2008/001362-0.
  • 8.
    Shin J, Oh SS, Oh KH, Park JH, Jang EJ, Chung GT, et al. An Outbreak of Foodborne Illness Caused by Enteroaggregative Escherichia coli in a High School in South Korea. Jpn J Infect Dis. 2015;68(6):514-9. [PubMed ID: 25971323]. https://doi.org/10.7883/yoken.JJID.2014.460.
  • 9.
    Gomez-Duarte OG, Arzuza O, Urbina D, Bai J, Guerra J, Montes O, et al. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two Caribbean-Colombian cities. Foodborne Pathog Dis. 2010;7(2):199-206. [PubMed ID: 19839760]. https://doi.org/10.1089/fpd.2009.0355.
  • 10.
    Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40. [PubMed ID: 15040260]. https://doi.org/10.1038/nrmicro818.
  • 11.
    Aslani MM, Alikhani MY, Zavari A, Yousefi R, Zamani AR. Characterization of enteroaggregative Escherichia coli (EAEC) clinical isolates and their antibiotic resistance pattern. Int J Infect Dis. 2011;15(2):e136-9. [PubMed ID: 21130676]. https://doi.org/10.1016/j.ijid.2010.10.002.
  • 12.
    Ahangarzadeh Rezaee M, Shahbazi G, Hasani A, Asgharzadeh M, Rahim-Rahimi AA, Alebouyeh M. Prevalence of enteroaggregative Escherichia coli among children with gastroenteritis in the northwest of Iran. J Anal Res Clin Med. 2015;3(3):183-9. https://doi.org/10.15171/jarcm.2015.029.
  • 13.
    Bafandeh S, Haghi F, Zeighami H. Prevalence and virulence characteristics of enteroaggregative Escherichia coli in a case-control study among patients from Iran. J Med Microbiol. 2015;64(Pt 5):519-24. [PubMed ID: 25813820]. https://doi.org/10.1099/jmm.0.000055.
  • 14.
    Haghi F, Zeighami H, Hajiahmadi F, Khoshvaght H, Bayat M. Frequency and antimicrobial resistance of diarrhoeagenic Escherichia coli from young children in Iran. J Med Microbiol. 2014;63(Pt 3):427-32. [PubMed ID: 24281909]. https://doi.org/10.1099/jmm.0.064600-0.
  • 15.
    Pourakbari B, Heydari H, Mahmoudi S, Sabouni F, Teymuri M, Ferdosian F, et al. Diarrhoeagenic E. coli pathotypes in children with and without diarrhoea in an Iranian referral paediatrics centre. East Mediterr Health J. 2013;19(7):617-21. [PubMed ID: 24975306].
  • 16.
    Itoh Y, Nagano I, Kunishima M, Ezaki T. Laboratory investigation of enteroaggregative Escherichia coli O untypeable:H10 associated with a massive outbreak of gastrointestinal illness. J Clin Microbiol. 1997;35(10):2546-50. [PubMed ID: 9316905].
  • 17.
    Yatsuyanagi J, Saito S, Sato H, Miyajima Y, Amano K, Enomoto K. Characterization of enteropathogenic and enteroaggregative Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol. 2002;40(1):294-7. [PubMed ID: 11773137]. https://doi.org/10.1128/JCM.40.1.294-297.2002.
  • 18.
    Smith HR, Cheasty T, Rowe B. Enteroaggregative Escherichia coll and outbreaks of gastroenteritis in UK. Lancet. 1997;350(9080):814-5. [PubMed ID: 9298029]. https://doi.org/10.1016/S0140-6736(05)62611-6.
  • 19.
    Lietman PS. Fluoroquinolone toxicities. An update. Drugs. 1995;49 Suppl 2:159-63. [PubMed ID: 8549287]. https://doi.org/10.2165/00003495-199500492-00026.
  • 20.
    Aslani MM, Ahrabi SS, Alikhani YM, Jafari F, Zali RM, Mani M. Molecular detection and antimicrobial resistance of diarrheagenic Escherichia coli strains isolated from diarrheal cases. Saudi Med J. 2008;29(3):388-92. [PubMed ID: 18327365].

Similar Articles

28
Sep
2020
Jundishapur Journal of Microbiology

Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran

Mehrandokht Sirous,
Mohammad Hashemzadeh,
Maryam Keshtvarz,
Mansour Amin,
Nasim Shams,
Maryam Dastoorpoor
,et al.

Sirous M, Hashemzadeh M, Keshtvarz M, Amin M, Shams N, et al. Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran. Jundishapur J Microbiol. 2020;13(7):e100877. doi: https://doi.org/10.5812/jjm.100877

8
Sep
2015

Phenotypic and Genotypic Characterization of Enteroaggregative Escherichia coli Strains Isolated From Diarrheic Children in Iran

Abolfazl Davoodabadi,
Maryam Abbaszadeh,
Mana Oloomi,
Saeid Bouzari

Davoodabadi A, Abbaszadeh M, Oloomi M, Bouzari S. Phenotypic and Genotypic Characterization of Enteroaggregative Escherichia coli Strains Isolated From Diarrheic Children in Iran. Jundishapur J Microbiol. 2015;8(9):e22295. doi: https://doi.org/10.5812/jjm.22295

1
Jul
2015

Distribution of Virulence Genes, Enterotoxin and Biofilm Formation Among Enteroaggregative Escherichia Coli (EAEC) Strains Isolated From Stools of Children With Diarrhea in South East Iran

Razieh Nezarieh,
Mohammad Reza Shakibaie,
Hossein Hosseini Nave,
Amin Norouzi,
Gholamabas Salajegheh,
Mehdi Hayatbakhsh

Nezarieh R, Shakibaie MR, Hosseini Nave H, Norouzi A, Salajegheh G, et al. Distribution of Virulence Genes, Enterotoxin and Biofilm Formation Among Enteroaggregative Escherichia Coli (EAEC) Strains Isolated From Stools of Children With Diarrhea in South East Iran. Arch Pediatr Infect Dis. 2015;3(3):e29745. doi: https://doi.org/10.5812/pedinfect.29745v2

31
Oct
2015

Molecular Epidemiology of ESBL Genes and Multi-Drug Resistance in Diarrheagenic Escherichia Coli Strains Isolated from Adults in Iran

Sadegh Ghorbani-Dalini,
Mohammad Kargar,
Abbas Doosti,
Pejman Abbasi,
Meysam Sarshar

Ghorbani-Dalini S, Kargar M, Doosti A, Abbasi P, Sarshar M. Molecular Epidemiology of ESBL Genes and Multi-Drug Resistance in Diarrheagenic Escherichia Coli Strains Isolated from Adults in Iran. Iran J Pharm Res. 2015;14(4):e125390. doi: https://doi.org/10.22037/ijpr.2015.1753

17
Dec
2024
Jundishapur J Microbiol

The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran

Saba Farhadinia,
Shahin Najarpiraye,
Bita Bakhshi

Farhadinia S, Najarpiraye S, Bakhshi B. The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran. Jundishapur J Microbiol. 2024;17(12):e151793. doi: https://doi.org/10.5812/jjm-151793

Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles